CN117296799B

CN117296799B - Construction method and application of retinal pigment degeneration disease model

Info

Publication number: CN117296799B
Application number: CN202311604059.7A
Authority: CN
Inventors: 石毅; 戴超; 蒋灵晰; 朱献军; 张露含; 张悦心
Original assignee: Sichuan Peoples Hospital of Sichuan Academy of Medical Sciences
Current assignee: Sichuan Peoples Hospital of Sichuan Academy of Medical Sciences
Priority date: 2023-11-28
Filing date: 2023-11-28
Publication date: 2024-02-02
Anticipated expiration: 2043-11-28
Also published as: CN117296799A

Abstract

The invention provides a construction method and application of a retinal pigment degeneration disease model, and belongs to the field of animal models. The animal model construction method of the invention comprises the following steps: using gene editing technology to make target animal retinaSetdb1Gene non-expression or expression inhibition, to obtain retinal precursor cellsSetdb1Animals with genes not expressed or expressed under low levels are required. The invention successfully builds the model of the retinal pigment degeneration disease, can be applied to the research of the retinal pigment degeneration disease, and has good application prospect.

Description

Construction method and application of retinal pigment degeneration disease model

Technical Field

The invention belongs to the field of animal models, and particularly relates to a construction method and application of a retinal pigment degeneration disease model.

Background

Retinitis pigmentosa (Retinitis pigmentosa, RP) is a complex inherited retinal disease with clinical variability with a global incidence of about 1/3000-1/7000, with a incidence of 1/4500 in china, and with RP patients up to millions based on the vast population in china. The diagnosis and treatment of RP at present face a plurality of difficulties, and no effective treatment means exists, so that the health and the quality of life of patients are seriously affected. Initial symptoms of RP often include night blindness and progressive visual field loss, which ultimately may lead to irreversible blindness, and visual retinal pigmentation seen in fundus examination.

Pathologically, a typical RP is characterized by rod cell death, followed by cone cell death. RP is mainly characterized by damaged and denatured photoreceptors, gradually thinning the outer nuclear layer of the retina until it disappears, and the corresponding pathological changes of the retinal pigment epithelium and other related cell layers occur. RP shows high heterogeneity in heredity, multiple pathogenic genes, multiple hereditary modes and complex pathogenic molecular mechanism, which causes the pathogenic molecular mechanism to lack systematic pathological mechanism research and brings a plurality of difficulties for therapeutic intervention.

However, the pathogenesis of RP is difficult to be effectively studied due to the current lack of ideal animal models for RP. In order to better screen and study the pathogenesis of retinal pigment degeneration diseases, and to screen effective targeted therapeutic drugs, it is therefore highly desirable to construct animal models that characterize retinal pigment degeneration diseases.

Setdb1 protein (set domain bifurcated 1) is a histone methyltransferase, the gene accession number of which is ID 9869, setdb1 can be used as a target to play an important role in treating inflammatory bowel disease, and no related report of Setdb1 related to retinal pigment degeneration exists at present.

Disclosure of Invention

The invention provides a construction method of an animal model of a retinal pigment degeneration disease, which comprises the following steps: using gene editing technology to make target animal retinaSetdb1Gene non-expression or expression inhibition, to obtain retinal precursor cellsSetdb1Animals with genes not expressed or expressed under low levels are required.

Further, the retinal precursor cellsSetdb1Gene non-expressionOr the animal with low expression is retina precursor cellSetdb1Animals with gene 5 exon sequences knocked out.

Further, the gene editing technology comprises DNA homologous recombination technology and conditional gene knockout technology. Preferably, the conditional gene knockout technique is a Cre-loxp conditional gene knockout technique.

Further, the target animal is a mouse, rat, horse, pig, monkey, dog, or ape.

Further, the animal model is a mouse model, and the construction steps are as follows:

1) Preparation by DNA homologous recombination techniqueSetdb1The mouse embryo stem cell with the conditional knockout gene is obtained to obtain a chimeric mouse, and the chimeric mouse is bred with a wild mouse to obtainSetdb1A heterozygote mouse with the gene knocked out;

2) The step 1) is carried outSetdb1Mating and breeding heterozygote mice with knocked out genes and transgenic mice FLPer mice to obtainSetdb1Conditional knockout of the gene into heterozygote mice;

3) The step 2) is carried outSetdb1The heterozygote mice subjected to conditional gene knockout are bred by mating with each other to obtain the homozygous mice subjected to conditional gene knockout of Setdb 1;

4) The step 3) is carried outSetdb1Mating the homozygous mouse with Six3-Cre transgenic mouse to obtain retina precursor cellSetdb1A knockout mouse.

In the step 1)Setdb1In the mouse embryo stem cell with the conditional knockout gene,Setdb1the gene 5 exon sequence is flanked by LoxP sites.

The invention also provides application of the animal model of the retinal pigment degeneration disease constructed by the method in preparing and screening medicaments for treating the retinal pigment degeneration disease.

The invention also provides application of the animal model of the retinal pigment degeneration disease constructed by the method in the research of the retinal pigment degeneration disease, wherein the research aims at diagnosis or treatment of non-disease.

The successfully constructed model of the retinal pigment degeneration disease can be applied to the research of the retinal pigment degeneration disease, so that the early molecular screening, the pathogenesis and the research of the pathogenic mechanism of the retinal pigment degeneration disease are possible, and the model of the retinal pigment degeneration disease can also be applied to the screening of medicines for treating the retinal pigment degeneration disease, and the research and the development of the medicines for treating the retinal pigment degeneration are accelerated.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 is a schematic representation of conditional knockout mouse construction strategy.

FIG. 2 is a diagram showing the PCR identification results of homologous recombinant mice; wherein, figure A is a diagram of the PCR identification result of a 5' arm positive homologous recombination mouse; panel B is a graph of PCR identification of 3' arm positive homologous recombination mice.

FIG. 3 is a graph showing the results of gel electrophoresis of flox mouse genotyping.

FIG. 4 is a graph showing the identification of Setdb1 conditional knockout mice; wherein, figure A is a graph of the genotyping result of Setdb1 conditional knockout mice; panel B is a diagram of the results of the verification of the effectiveness of the WB assay conditional knockdown Setdb1 gene.

FIG. 5 is a diagram of the results of Electroretinogram (ERG) detection; wherein, the graph A shows that the intensity of dark reaction light detected by ERG is 0.1 cd.s/m ² A detection result diagram of the signal; FIG. B shows that the intensity of ERG-detected dark reaction light is 1.0 cd.s/m ² A detection result diagram of the signal; FIG. C shows that the dark reaction light intensity is 0.1 cd.s/m ² 、1.0cd·s/m ² And a, b wave statistical analysis result graph of the signals.

FIG. 6 is a graph of the detection results of ERG; FIG. A shows that the ERG detected light intensity is 3.0 cd.s/m ² A detection result diagram of the signal; drawing of the figureB is ERG, and the light intensity of the bright reaction is 10.0 cd.s/m ² A detection result diagram of the signal; FIG. C shows that the intensity of the reaction light is 3.0 cd.s/m ² 、10.0cd·s/m ² And a, b wave statistical analysis result graph of the signals.

FIG. 7 is a graph showing the results of H & E staining of retinal paraffin sections from a mouse model of retinitis pigmentosa. FIG. A is a graph of H & E staining results of retinal paraffin sections of wild type mice; FIG. B is a graph of H & E staining results of retinal paraffin sections of conditional Setdb1 knockout mice; panel C is a graph of statistical analysis of the results of H & E staining of the outer section thickness of retina of wild type, conditional Setdb1 knockout mice.

FIG. 8 is a graph of Immunohistochemical (IHC) staining results of retinal paraffin sections from a mouse model of retinitis pigmentosa. FIG. A is a diagram of IHC staining results of wild-type mouse retina frozen sections; panel B is a plot of IHC staining results from a frozen section of retina from a conditional Setdb1 knockout mouse.

Detailed Description

The raw materials and equipment used in the invention are all known products and are obtained by purchasing commercial products.

EXAMPLE 1 construction of the model for retinitis pigmentosa disease of the present invention

1. Retinal precursor cellsSetdb1Preparation method of gene knockout mouse

The embodiment uses a mouse as a target animal, and describes a construction method of a model of the retinal pigment degeneration disease provided by the invention,Setdb1the route of gene knockout is shown in FIG. 1, and the specific procedures are as follows:

gene knockout mice acquisition procedure:

1. will be in contact with miceSetdb1The 5' arm of the gene homology, the expression cassette with Neo resistance gene, the 5 th exon with LoxP sites arranged in the same direction at both ends and the 3' arm were cloned into a vector (Setdb 1-CKO1-N Targeting Vector, available from Shanghai's model Biotechnology Co., ltd.) for replacement of the gene to be knocked outSetdb1Gene 5 th exon;

related sequences:

5' arm sequence (SEQ ID NO. 1): CAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCAAAAAACCAAAAAAAAAAAAAATATATATATACACACACACACCTGCACACATATATATACATATATATAATCTCCATGTTTCTGTAGTTATTGATAGTTTTGTTGCACCATGCTTCTGGAAAATAA;

3' arm sequence (SEQ ID NO. 2): CATTAATTTTATGTCCACAGTCAGTCTGAGAGTTATTGATTGATGCGGTGGCTCAGGCTGTTAACT;

loxp sequence (SEQ ID NO. 3):

ATAACTTCGTATAATGTATGCTATACGAAGTTAT；

2. using DNA homologous recombination techniqueSetdb1Substitution of the 5 th exon in the Gene (ID: 84505) to giveSetdb1Mouse embryonic stem cells with conditional gene knockout;

3. preparing the embryonic stem cells obtained in the step 2 to obtain the cell-containingSetdb1Chimeric mice of the knockout cells;

4. mating and breeding the chimeric mice obtained in the step 3 and wild mice, and screening out offspringSetdb1Heterozygote mice with knocked-out genes.

Knock-out identification:

and long-distance PCR identification of the experimental result of homologous recombination positive offspring mice.

Amplification of the 3' long arm primers were used:

F1（SEQ ID NO.4）:5’ - AGTCCAAGGGCCCTATCAAGTCTA -3’；

R2（SEQ ID NO.5）:5’ - GAGTTCGCAAGTTCCAGGTTT -3’；

the result is shown in FIG. 2, A, and the amplified product is 6.1kb. Wherein A10 and B2 are positive.

Amplification of the 3' long arm primers were used:

F3（SEQ ID NO.6）:5’ - AAGTGCCAAGATCATAGGTGTCAA-3’；

R4（SEQ ID NO.7）:5’ - CGTGGGTGGGCAAAGTGTCAGATG-3’；

the result is shown in FIG. 2, B, and the amplified product is 6.8kb. Wherein: a10 B2 is a positive heterozygote.

5. Mating and breeding the heterozygote mouse animal obtained in the step 4 and the transgenic mouse FLPer mouse to obtainSetdb1Conditional knockout of the gene into heterozygote mice;

6. the step 5 is carried outSetdb1The heterozygote mice subjected to conditional gene knockout are bred by mating with each other to obtainSetdb1A homozygous mouse is knocked out conditionally from the gene;

7. the step 6 is carried outSetdb1Mating the homozygous animal subjected to gene conditional knockout with the Six3-Cre gene-transferred animal to obtain a retina precursor cellSetdb1A knockout mouse.

Transgenic mice FLPer mice were purchased from the Czechralski laboratory (strain name: B6.129S4-Gt (ROSA) 26Sortm1 (FLP 1) Dym/RainJ). Six3-Cre transgenic mice (MGI: 3574771) were given away by the Andersen cancer center, university of Texas, U.S.A.. Six3 is a marker transcription factor of forebrain ventral and retina precursor cells, specifically drives Cre genes to be expressed in retina precursor cells, cre proteins can enter cell nuclei, and LoxP sites on genome are identified, so that gene knockout is realized.

2. Retinal precursor cellsSetdb1Gene knockout condition detection in gene knockout mice

I. Gel electrophoresis for identifying mice

For the above-mentioned retinal precursor cellsSetdb1Genotyping of knockout mice was performed as follows:

(1) Cutting a small amount of tissue samples from the tail tips of the mice, and placing the small tissue samples into a clean 1.5mL centrifuge tube;

(2) 65. Mu.L of lysate (40mM NaOH,0.2mM EDTA solution) was added to the centrifuge tube and heated at 95℃in a metal bath for 1h;

(3) The tube was removed, cooled to room temperature, and 65. Mu.L of a neutralization solution (40 mM Tris-HCl, pH 5.5) was added thereto, and 10000g of the solution was centrifuged for 2 minutes, followed by taking the supernatant for genotyping of mice.

(4) And (3) PCR amplification: the PCR reaction system was configured as follows

2×taq Mix:10 mu L, tail tissue lysate: 4. Mu.L, primer 1 (Setdb 1-loxP-Forward or Six 3-Cre-Forward): 1. Mu.L (concentration: 10 mM), primer 2 (Setdb 1-loxP-Reverse or Six 3-Cre-Reverse): 1. Mu.L (concentration: 10 mM); ddH2O:4 mu L

The primer sequences were as follows:

setdb1-loxP-Forward sequence (SEQ ID NO. 8):

5’- TGCCTTAAGAAAATCAGC -3’；

setdb1-loxP-Reverse sequence (SEQ ID NO. 9):

5’- AGCCACCGCATCAATCAATAACTC -3’；

six3-Cre-Forward sequence (SEQ ID NO. 10):

5’- GAACGCACTGATTTCGACCA -3’；

six3-Cre-Reverse sequence (SEQ ID NO. 11):

5’- GCTAACCAGCGTTTTCGTTC -3’。

amplification procedure: after the PCR reaction system is prepared, the template DNA is fully denatured by preheating at 94 ℃ for 5 minutes on a PCR instrument, and then the amplification cycle is carried out. In each cycle, the template is denatured prior to holding at 94 ℃ for 30 seconds, then the temperature is reduced to 57 ℃ for 30 seconds, and the primer and the template are fully annealed; the reaction was kept at 72℃for 1 minute, and primers were allowed to extend on the template to synthesize DNA, thereby completing one cycle. This cycle was repeated 32 times to accumulate a large amount of amplified DNA fragments. Finally, the product was left to extend intact for 1 minute at 72℃and stored at 4 ℃.

3.0g agarose was weighed into a 100mL TAE buffer and melted in a microwave oven to produce 3% agarose. 10. Mu.L of the PCR product was taken in the well and subjected to agarose electrophoresis at a constant voltage of 150V for 20min and imaged by a gel imaging system.

FIG. 3 is the result of genotyping assay on flox mice, WT representing a wild-type control with a band size of 436bp; het represents a heterozygote with two bands 436bp and 580bp.

FIG. 4A is an upper panel showing the genotyping of Setdb1 conditional knockout mice, WT representing a wild type control, band size 436bp; het represents a heterozygote with two bands 436bp and 580bp; CKO represents homozygote, band size is 580bp. The lower panel of FIG. 4A is the Six3-Cre assay. The size of Six3-Cre is 200bp.

Based on the results of FIG. 4A, it was shown that the identification method used can effectively identify the genotype of the newborn mouse. Wherein,Setdb1the homozygous mouse can be used as retinal pigment degeneration disease after gene knockoutDisease model (hereinafter denoted by CKO)Setdb1A homozygous mouse is knocked out; ctr refers to wild type; het refers to heterozygote) and verification of the relevant phenotype is performed.

II. WB (western blot) experimental analysis of the efficiency of gene knockout in the retina of Six3-cre knockout mice was verified by the following experimental method:

(a) Wild-type and mutant mouse retinal tissues were isolated, placed in a 1.5mL centrifuge tube, and 160. Mu.L of protein lysate RIPA was added.

(b) After sonicating the cells, they were lysed on ice for 20min.

(c) After centrifugation at 12000g for 10min at 4℃the supernatant was transferred to another clean centrifuge tube, 40. Mu.L of 5 Xprotein loading buffer was added and after mixing, heated at 95℃for 5min.

(d) After the sample was cooled, 20. Mu.L of each sample was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) at 80V,20min,120V,60min to isolate proteins.

(e) After SDS-PAGE is finished, cutting a nitrocellulose membrane with proper size according to the requirement, paving filter paper, glue, the nitrocellulose membrane and the filter paper in sequence, removing bubbles, putting the membrane transferring groove into an ice-water bath, and transferring the membrane by adopting a constant current of 0.28A for 100min.

(f) After the transfer, nitrocellulose membrane was placed in an antibody incubation box and then blocked with 5% skim milk for 2h at room temperature.

(g) After the closure is completed, the process is carried out with a method of 1: after 2000 dilutions of SETDB1 antibody (Cat No:11231-1-AP, proteintech) the primary antibody was incubated overnight at 4 ℃.

(h) The primary antibody was recovered, washed 3 times with 1 XTBE buffer for 10min each, and appropriate secondary antibody was selected depending on the source of primary antibody, and horseradish peroxidase (HRP) -labeled secondary antibody was diluted with 1 XTBE and incubated on a shaker at room temperature for 1h.

(i) After the secondary antibody incubation was completed, the membrane was washed 3 times with 1 XTBST for 5min each, and the protein was detected with ELC luminescence kit using a chemiluminescent gel imaging system of Bio-Rad.

As a result, as shown in FIG. 4B, it can be seen that the immunoblotting (western blot) experiment proves that the Setdb1 protein is inSetdb1The expression level in the retina of the homozygous mice knocked out was significantly reduced. In FIG. 4B Ctrl refers to wild type control and CKO refers toSetdb1Homozygous mice were knocked out.

3. Retinal precursor cellsSetdb1Pathological detection of gene knockout mice

1. ERG detection of constructed retinitis pigmentosa mouse models to determineSetdb1Effect of gene knockout on mouse retinal function. The specific operation is as follows:

(1) Dark adaptation: placing wild and CKO mice in dark environment overnight before the experiment, wherein the environment is absolutely free of light, and the hands are not stretched to the five fingers;

(2) The next day of anesthesia: weighing and injecting into abdominal cavity; deep anesthesia is preferred;

(3) Mydriasis and fixation of animals: after anesthesia is completed, dripping mydriasis agent into eyes of a mouse under dark red light illumination, and mydriasis for 5min; after mydriasis is completed, a little physiological saline is added dropwise to moisten eyes of a mouse, so that dryness is avoided; the mice are placed on an animal placing table (heated in advance, the temperature of the experiment table is kept at about 37 ℃), namely the heads are close to the stimulation ports of the flash stimulator, the heights of the eyes are consistent, and the eyes are fully exposed.

(4) Electrode installation: the electroretinogram electrodes are arranged in advance, the temperature of 37 ℃ is preheated, after a mouse is placed on a laboratory bench, the eyes of the mouse are covered with the electrode 'eye cups', and the 'eye cups' and the angles of the electrodes (the resistance is judged by the computer program image size and is optimal about 5.0 k) are carefully adjusted, so that the 'eye cups' are completely covered on the eyes of the mouse. The contact effect of the 'eye cup' and cornea is improved by dropping normal saline to eyes through the needle tube. The electrodes are ensured to contact the same positions of the central positive ends of the cornea of two eyes at the same angle and in the same mode.

(5) And closing the dark red light after the record oscillographic signal confirms no error. The ERG pre-detection of preview is attempted, confirming the quality of the following signal: if the amplitudes of the eyes differ greatly from the expected amplitudes, it is recommended to check the mounting position of the electrodes again. Pre-darkening is adapted for 10min, then detection is started, and the dark reaction light intensity is recorded to be 0.1 and 1.0 cd.s/m in sequence ² Is a signal of (a).

(6) Immediately performing bright adaptation for 10min after dark reaction test is completed, and sequentially recording bright reaction of 3.0 cd.s/m after bright adaptation ² 10.0 cd.s/m ² Waveform under light intensity, finally recording 10.0 and 30.0 cd.s/m ² The retinal evoked potential blinks at light intensity.

(7) The detected mice are placed on an electric blanket to wait for awakening.

2. Paraffin section H of retinas of the constructed retinas pigmentosa mouse model&E staining to determineSetdb1Effect of gene knockout on mouse retinal structure.

Retinas of 3 month old mice were stained by paraffin section, hematoxylin-eosin staining (H & E staining method) as follows:

(1) Quickly taking eyeballs of the mice, and placing the eyeballs in a fixing solution for fixing for 24 hours;

(2) Embedding paraffin, slicing with thickness of 4 μm;

(3) Slices were conventionally dewaxed with xylene, washed with multi-stage ethanol to water: xylene (I) 5 min- & gt xylene (II) 5 min- & gt 100% ethanol 2 min- & gt 95% ethanol 1 min- & gt 80% ethanol 1 min- & gt 75% ethanol 1 min- & gt distilled water washing 2min;

(4) Hematoxylin staining for 5 minutes, washing with tap water;

(5) Ethanol hydrochloride differentiation for 30 seconds;

(6) Soaking in tap water for 15 minutes;

(7) And (5) placing eosin solution for 2 minutes.

(8) Conventional dehydration, transparency and sealing sheet: 95% ethanol (I) 1min, 95% ethanol (II) 1min, 100% ethanol (I) 1min, 100% ethanol (II) 1min, xylenol carbonic acid (3:1) 1min, xylene (I) 1min, xylene (II) 1min and neutral resin sealing.

(9) And photographing under a microscope.

3. Paraffin section Immunohistochemical (IHC) staining of retinas of the constructed retinas pigmentosa mouse model was performed to determineSetdb1Effect of gene knockout on mouse retinal structure.

Retinas of 3 month old mice were stained for paraffin section Immunohistochemistry (IHC) as follows:

(1) Using the results obtained in example 2Setdb1The homozygous mice were sacrificed by cervical scission, the eyeballs were quickly removed and placed in 4% PFA, and after 15min fixation on ice, the cornea was cut and then fixation on ice continued. After 2h, the eyeball was dehydrated in 30% sucrose solution for 2h, then the cornea and lens were cut off under a dissecting lens, OCT was embedded and rapidly frozen in a refrigerator at-80 ℃. After about 20min, the OCT embedded eyeball block is taken out, and is placed in a frozen microtome for 30min at the temperature of minus 25 ℃ to be sliced. The slice thickness was 12. Mu.m.

After slicing, higher quality pieces were selected and placed in an oven at 37 ℃ for 60min, then circled around the retinal tissue using an immunohistochemical pen, washed three times with PBS to remove OCT, then 5% NDS (containing 0.25% triton) blocked through for 2h, primary antibodies incubated, and overnight at 4 ℃. The following day, after PBS is washed three times, the corresponding fluorescent secondary antibody is incubated, and then PBS is used for washing three times, sealing and confocal microscopy observation and photographing are carried out.

The detection result is as follows:

1) ERG detection found CKO @ 3 months compared to Ctrl (control) miceSetdb1The a wave and b wave of the homozygous mice knocked out) mice are obviously reduced under dark reaction and bright reaction conditions, which indicatesSetdb1Resulting in impaired retinal function following knockout (see fig. 5A, B, C and 6A, B, C).

2) Paraffin section H & E staining results found that at 3 months, the outer nuclear layer of the retina was thinned in CKO mice compared to Ctrl (control) mice, indicating photoreceptor cell death (fig. 7A, B, C).

3) The results of Immunohistochemical (IHC) staining of paraffin sections are shown in FIG. 8A, B, and when mice are 3 months old, it was found that, after staining the outer section antibody Rhodopsin and the inner section antibody NaK-Atpase by retinal frozen tissue sections, compared with wild-type mice,Setdb1the outer retinal node of the homozygous mice (CKO in the figure) was significantly shortened, and a significantly photoreceptor degenerated phenotype was exhibited.

From the experimental results, it can be seen that the retinal precursor cells are compared with the controlSetdb1The knockout mice exhibit a typical characterization of retinal pigment degeneration disease: the retina has impaired function, the outer nuclear layer of retina is thinned, the photoreceptor cells die, the outer segments of retina are obviously shortened, obvious photoreceptor degeneration occurs, and the retina can be used as a model of the retinal pigment degeneration disease.

In the embodiment of the invention, by taking a mouse as an example, we construct the gene for the first time through Cre-loxP gene knockout technologySetdb1The gene knockout mouse model shows typical characterization of retinal pigment degeneration diseases such as retinal function impairment, shortening and degeneration of outer segments of visual cells, and loss of photoreceptor cells. Thus, it is fully demonstrated that the cell knockout is carried out on the retina precursorSetdb1The gene can cause the target animal to show the retinal pigment degeneration disease. Retinal precursor cell knockoutSetdb1The animal with the gene can be used as a model of the retinal pigment degeneration disease.

The model of the retinal pigment degeneration disease constructed by the invention can be used in the fields of retinal pigment degeneration disease research and the like, provides a new model for the research of the disease, such as early molecular screening, pathogenesis and pathogenesis of the retinal pigment degeneration disease, and can also be used for screening drugs for treating the retinal pigment degeneration disease.

Claims

1. A method for constructing an animal model of a retinal pigment degeneration disease, which is characterized by comprising the following steps: using gene editing technology to make target animal retinaSetdb1Gene non-expression or expression inhibition, to obtain retinal precursor cellsSetdb1Animals with genes not expressed or expressed under low levels can be obtained;

the retinal precursor cellsSetdb1Animals in which the gene is not expressed or is underexpressed are retinal precursor cellsSetdb1An animal from which the gene 5 th exon sequence has been knocked out; the target animal is a mouse.

2. The construction method according to claim 1, wherein: the gene editing technology comprises a DNA homologous recombination technology and a conditional gene knockout technology.

3. The construction method according to claim 2, wherein: the conditional gene knockout technology is Cre-loxp conditional gene knockout technology.

4. A method of construction according to claim 3, wherein: the animal model is a mouse model, and the construction steps are as follows:

5. The construction method according to claim 4, wherein: in the step 1)Setdb1In the mouse embryo stem cell with the conditional knockout gene,Setdb1the gene 5 exon sequence is flanked by LoxP sites.

6. Use of an animal model of a retinal pigment-modified disease constructed by the method according to any one of claims 1 to 5 for screening a therapeutic agent for a retinal pigment-modified disease.

7. Use of an animal model of a retinitis pigmentosa disease constructed by the method of any one of claims 1-5 in the study of retinitis pigmentosa disease for the purpose of diagnosis or treatment of a non-disease.