CN112126659A - Non-human mammal model and construction method and application thereof - Google Patents

Abstract

The invention provides a non-human mammal model with a knocked-in androgen receptor-luciferase gene, and a construction method and application thereof. The non-human mammal model with the knocked-in androgen receptor-luciferase constructed by the invention can be used as a screening platform for drugs for treating castration-resistant prostate cancer, polycystic ovarian syndrome and other diseases related to abnormal expression of androgen receptor, and can realize simple, rapid and large-scale screening of drugs for regulating and controlling gene expression of androgen receptor; can directly detect the expression and distribution of androgen receptor in vivo by using a fluorescence imaging instrument on the premise of not harming non-human mammals.

Description

Non-human mammal model and construction method and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a non-human mammal model and a construction method and application thereof.

Background

Androgen, as a steroid hormone that controls male development and adult male phenotype and maintains reproductive function, has important physiological significance, and its physiological function is mainly to regulate the expression of downstream genes by binding to Androgen Receptor (AR), thereby activating transcriptional activity of androgen receptor. Without androgen receptors, androgens do not have a stimulating response to tissues.

The Androgen Receptor (AR), a member of the steroid hormone receptor, also belongs to a member of the nuclear receptor superfamily. It generally consists of four domains: an N-terminal transcriptional activation region (NTD), a DNA binding region (DBD), a hinge region, and a ligand binding region (LBD).

Current research indicates that Androgen Receptor (AR) -mediated androgen/androgen receptor signaling plays an important role not only in participating in embryogenesis, spermatogenesis, sexual behavior, and the development of male-specific phenotypes. At the same time, this signal has been shown to play an important role in the development of female reproductive organs and their function, such as ovarian follicular development, embryo implantation and embryo transfer, and uterine and breast development. Therefore, abnormalities in the expression level of androgen receptor are often closely related to the development of various diseases, such as castration-resistant prostate cancer, Polycystic ovary syndrome (PCOS), and the like.

Among them, polycystic ovary syndrome (PCOS), a disease caused by a complex endocrine and metabolic abnormality common to women at the birth age, has now affected 6% -20% of women worldwide, and its incidence rate is still rising in recent years. The PCOS is characterized by: hyperandrogenism, ovulation dysfunction, and polycystic ovary morphology; most patients with PCOS are also associated with metabolic dysfunction characterized by insulin resistance and compensatory hyperinsulinemia, and have an increased risk of type 2 diabetes, gestational diabetes and other pregnancy related complications, venous thromboembolism, cardiovascular and cerebrovascular disease, endometrial cancer. Because of the heterogeneous and heterogeneous clinical characterization of PCOS, its etiology and pathogenesis have not been fully elucidated. There is therefore an increasing need to find drugs that can effectively treat PCOS.

Currently, the methods for treating PCOS are symptomatic treatments of different clinical characteristics for different complaints of patients. Among them, antiandrogen therapy is targeted at hyperandrogenism, which is one of the key causes in the development and progression of PCOS, and androgens act mainly depending on androgen receptors, and studies have shown that an increase in androgen levels in PCOS rats also increases androgen receptor levels. Therefore, the expression level of androgen receptor can be regulated and controlled as a new strategy for treating PCOS.

However, for screening drugs that regulate changes in AR expression, especially changes in AR protein levels, drug screening using either real-time quantitative RT-PCR or western blot methods is time consuming, labor intensive, and expensive. Real-time quantitative PCR requires at least one day to detect the change of AR, while western blot requires at least two days to perform detection and analysis, which is time-consuming and inefficient.

Therefore, it is very important to construct a platform that can rapidly and accurately screen, regulate and control the AR expression of the drugs for treating PCOS.

Disclosure of Invention

Based on the above, the invention aims to provide a non-human mammal model with a knocked-in androgen receptor-luciferase, and a construction method and application thereof.

In order to achieve the purpose, the invention provides the following technical scheme:

a method for constructing a non-human mammal model, comprising the steps of:

microinjecting Cas9 mRNA, gRNA and homologous recombination vector into fertilized eggs of non-human mammals, so as to knock in a tandem peptide-luciferase expression frame in front of the stop codon site of androgen receptor gene of the non-human mammals through homologous recombination fixed point knocking-in;

the gRNA includes: two nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO. 3;

the homologous recombination vector is sequentially connected with a 5 'homologous arm, a tandem peptide gene, a luciferase gene and a 3' homologous arm;

the 5 'homology arm and the 3' homology arm can undergo homologous recombination with the genome of the non-human mammal.

The invention also provides a non-human mammal model, and the specific technical scheme is as follows:

the non-human mammal model knock-in androgen receptor-luciferase gene constructed by the above construction method.

The invention also provides an application of the non-human mammal model with the androgen receptor-luciferase gene knocked in, and the specific technical scheme is as follows:

the use of the non-human mammal model knock-in with androgen receptor-luciferase gene as described above in screening for a drug that modulates the expression level of androgen receptor.

The use of the non-human mammal model knock-in with androgen receptor-luciferase gene as described above in screening for a medicament for treating a disease caused by a change in expression level of androgen receptor.

Based on the technical scheme, the invention has the following beneficial effects:

the invention designs a proper gRNA and a homologous recombination vector aiming at the characteristics of an androgen receptor gene by adopting a gene fixed-point knocking-in mode, inserts a luciferase gene into a specific site of an androgen receptor gene expression frame, and ensures accurate insertion site, wherein the homologous recombination vector comprises a tandem peptide and the luciferase gene, so that the luciferase gene is transcribed and translated into protein together with the androgen receptor gene, and the expression level of the androgen receptor can be quantitatively reflected by directly measuring the fluorescence intensity of the luciferase.

The non-human mammal model with the knocked-in androgen receptor-luciferase can be used as a screening platform for drugs for diseases related to the change of the expression level of the androgen receptor, such as polycystic ovarian syndrome and prostatic cancer, and can realize simple, rapid and large-scale screening of drugs for regulating and controlling AR expression; the model can complete the screening of a 24-pore plate in 1 hour, and compared with the existing real-time quantitative RT-PCR or western blot method, the detection efficiency is greatly improved.

The non-human mammal model with the androgen receptor-luciferase knocked in constructed by the invention can directly detect the expression and distribution of AR in vivo by using a fluorescence imaging instrument on the premise of not damaging the non-human mammal, thereby accurately reflecting the tissue part of the AR.

Drawings

FIG. 1 shows a strategy for constructing a mouse model in which AR-lcuiferase is knocked in example 1 of the present invention;

FIG. 2 is a map of the homologous recombinant vector in example 1 of the present invention;

FIG. 3 is a measurement of fluorescence activity of each tissue of a mouse knocked in with AR-lcuiferase in example 2 of the present invention;

FIG. 4 is a graph showing the effect of the drug in the isolated MEF cells of mice in example 3 of the present invention;

FIG. 5 is a photograph showing an image of a mouse knocked in AR-lcuiferase in example 4 of the present invention in vivo.

Detailed Description

In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It is to be understood that the experimental procedures in the following examples, where specific conditions are not noted, are generally in accordance with conventional conditions, or with conditions recommended by the manufacturer. The various reagents used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The invention relates to a method for constructing a non-human mammal model, which comprises the following steps:

microinjecting Cas9 mRNA, gRNA and homologous recombination vector into fertilized eggs of non-human mammals, so as to knock in a tandem peptide-luciferase expression frame in front of the stop codon site of androgen receptor gene of the non-human mammals through homologous recombination fixed point knocking-in;

the gRNA includes: two nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO. 3;

the homologous recombination vector is sequentially connected with a 5 'homologous arm, a tandem peptide gene, a fluorescein gene and a 3' homologous arm of an androgen receptor gene stop codon site; the 5 'homology arm and the 3' homology arm can undergo homologous recombination with the genome of the non-human mammal.

The constructed non-mammal animal model with the knocked-in androgen receptor-luciferase adopts a gene fixed-point knocking-in mode, and can insert the luciferase gene into a specific site of the androgen receptor, so that the change of the gene can be accurately reflected; the existing animal model with luciferase is generally constructed by randomly inserting a promoter of a certain gene and luciferase into a genome by adopting a transgenic method, and the inserted site is not necessarily accurate and cannot accurately reflect the change of the gene.

Preferably, the nucleotide sequence of the tandem peptide gene is shown as SEQ ID NO. 4. The tandem peptide is designed aiming at the characteristics of AR genes and luciferase of non-human mammals, the luciferase genes can be translated into protein together with AR by the tandem peptide, and the luciferase is not fused with the AR protein, so that the activity of the AR protein cannot be influenced, after the luciferase and the AR protein are expressed together, the fluorescence intensity can be measured by combining with a luciferase substrate, and the fluorescence intensity can quantitatively reflect the expression level of the AR protein, so that the method is a quantitative means which cannot be realized by other fluorescent proteins.

Preferably, the nucleotide sequence of the fluorescein gene is shown as SEQ ID NO. 5.

Preferably, the nucleotide sequence of the Cas9 mRNA is shown as SEQ ID No. 6.

In some of these embodiments, Cas9 mRNA, gRNA, is obtained by in vitro transcription methods.

Preferably, the step of obtaining Cas9 mRNA by in vitro transcription comprises: obtaining a Cas9 mRNA in-vitro transcription template by enzyme cutting of an MLM3613 vector, in-vitro transcription and addition of a polyA sequence.

The method comprises the following specific steps:

1) preparation of in vitro transcription template for Cas9 mRNA: the MLM3613 vector (Amp resistance) is linearized by a single enzyme pmeI (37 ℃, 4h or more); after a small amount of electrophoresis is taken to confirm that the linearization is complete, the nucleic acid gel is run to recover the linearization product.

2) In vitro transcription of Cas9 mRNA:

mRNA in vitro transcription System (T7 mMESSAGE)

Kit，Life)：

At 37 ℃ for 2 h; mu.L of TURBO DNase was added at 37 ℃ for 15min to remove the DNA template.

3) Adding a polyA sequence, and recovering to obtain Cas9 mRNA which can be used for microinjection:

reaction system: (use NEB's polyA kit)

The effect of transcription was checked by taking 0.3. mu.L of electrophoresis (1% agarose, product about 2 Kbp).

Preferably, the step of obtaining the gRNA by in vitro transcription comprises: and (3) carrying out PCR (polymerase chain reaction) by using a T7-cr fwd primer pair and a tracr rev primer pair to obtain a gRNA in-vitro transcription template, and carrying out in-vitro transcription to obtain the gRNA.

The method comprises the following specific steps:

1) preparation of PCR in vitro transcription template for gRNA: the gRNA in vitro transcription templates were generated using high fidelity enzymatic PCR with a T7-cr fwd and tracr rev primer pair (annealing at 58 ℃ for 15sec, 40 cycles, 40. mu.L system). After electrophoresis of 5. mu.L of the PCR product and confirmation of a single band (125bp), the PCR product was directly recovered and used in the subsequent steps.

2) In vitro transcription of gRNAs

gRNA in vitro transcription system (NEB T7 Kit):

adding 1 μ L of TURBO DNase, and removing DNA template at 37 deg.C for 30 min;

taking 0.3 mu L, checking the transcription effect by electrophoresis (3% agarose, product 100bp or so);

3) and (3) recovery of gRNA: RNA was recovered from RNeasy MinElute Cleanup Kit (QIAGEN).

Preferably, the non-human mammal is a mouse. More preferably, the mouse is a C57BL/6J mouse. C57BL/6J mice are used because of their clear genetic background and easy rearing, and the initial genome sequencing of the mice is performed by using C57 mice, so that transgenic mice or gene targeting mice are also used in most cases.

Preferably, the nucleotide sequence of the androgen receptor gene is shown in SEQ ID NO. 1.

The invention also provides a non-human mammal model which is obtained by the construction method and knocked in the androgen receptor-luciferase gene.

In some of these embodiments, the non-human mammalian model into which the androgen receptor-luciferase gene is knocked in is a mouse. Preferably, the non-human mammal model is a C57BL/6J mouse knock-in with androgen receptor-luciferase gene constructed by homologous recombination.

The invention also provides an application of the non-human mammal model with the knocked-in androgen receptor-luciferase gene, which comprises the following specific steps: the non-human mammal model is applied to screening of drugs for regulating the expression level of androgen receptor. The method can directly utilize a fluorescence imaging instrument to detect the expression and distribution of AR in vivo without extracting DNA or protein on the premise of not damaging animals, thereby screening the drugs for regulating the expression level of the androgen receptor, and can also directly extract the histones without the steps of amplification, antibody incubation and the like, thereby directly screening the drugs for regulating the expression level of the androgen receptor by detecting the fluorescence intensity.

In some embodiments, the non-human mammal model knocked-in androgen receptor-luciferase gene can also be used for screening drugs for treating diseases caused by the change of the expression level of androgen receptor. Optionally, the diseases caused by the androgen receptor expression level change comprise polycystic ovary syndrome, prostatic cancer, androgen insensitivity syndrome, bulbar spinal muscular atrophy, male breast cancer and the like.

Example 1

As shown in FIG. 1, for the construction strategy diagram of the mouse model with AR-lcuiferase knocked in the example, 2A-Luc expression cassettes are knocked in the termination codon sites of the AR genes by means of homologous recombination by using CRISPR/Cas9 technology. The grnas used were effective only against AR sequences.

The method mainly comprises the following steps:

1. guide RNAs (guide RNAs, gRNAs) were designed in the upstream and downstream sequences (SEQ ID NO.1) of the termination codon of the AR gene for the purpose of knocking in the 2A-Luc expression cassette at the site of the termination codon of the AR gene at a desired point.

SEQ ID NO.1：

ATTGCAAGAGAGCTGCATCAGTTCACTTTTGACCTGCTAATCAAGTCCCATATGGTGAGCGTGGACTTTCCTGAAATGATGGCAGAGATCATCTCTGTGCAAGTGCCCAAGATCCTTTCTGGGAAAGTCAAGCCCATCTATTTCCACACACAGTGAAGATTTGGAAACCCTAATACCCAAAACCCACCTTGTTCCCTTTCCAGATGTCTTCTGCCTGTTATATAACTCTGCACTACTTCTCTGCAGTGCCTTGGGGGAAATTCCTCTACTGATGTACAGTCTGTCGTGA

The gRNA sequence information selected for this example is SEQ ID NO. 2-3.

SEQ ID NO.2：gRNA1:5’-TTCCAAATCTTCACTGTGTGTGG-3’

SEQ ID NO.3：gRNA2:5’-TTCCACACACAGTGAAGATTTGG-3’

2. Obtaining Cas9 mRNA and gRNA through an in vitro transcription mode;

A. preparation of Cas9 mRNA

1) Preparation of in vitro transcription template for Cas9 mRNA (SEQ ID No. 6): the MLM3613 vector (Amp resistance) is linearized by a single enzyme pmeI (37 ℃, 4h or more); after a small amount of electrophoresis is taken to confirm that the linearization is complete, the nucleic acid gel is run to recover the linearization product.

2) In vitro transcription of Cas9 mRNA:

mRNA in vitro transcription System (T7 mMESSAGE)

Kit，Life)：

At 37 ℃ for 2 h; mu.L of TURBO DNase was added at 37 ℃ for 15min to remove the DNA template.

3) Adding a polyA sequence, and recovering to obtain Cas9 mRNA which can be used for microinjection:

reaction system: (use NEB's polyA kit)

The effect of transcription was checked by taking 0.3. mu.L of electrophoresis. (1% agarose, product about 2 Kbp)

Cas9 sequence information is SEQ ID No. 6:

ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAA

B. preparation of gRNA

1) Preparation of PCR in vitro transcription template for gRNA: the gRNA in vitro transcription templates were generated using high fidelity enzymatic PCR with a T7-cr fwd (SEQ ID NO.7) and tracr rev (SEQ ID NO.8) primer pair (annealing at 58 ℃, extension for 15sec, 40 cycles, 40. mu.L system). After electrophoresis of 5. mu.L of the PCR product and confirmation of a single band (125bp), the PCR product was directly recovered and used in the subsequent steps.

SEQ ID NO.7：5’-GAAATTAATACGACTCACTATA-3’；

SEQ ID NO.8：5’-AAAAAAAGCACCGACTCGGTGCCAC-3’。

2) In vitro transcription of gRNAs

gRNA in vitro transcription system (NEB T7 Kit):

adding 1 μ L of TURBO DNase, and removing DNA template at 37 deg.C for 30 min;

taking 0.3 mu L, checking the transcription effect by electrophoresis (3% agarose, product 100bp or so);

3) and (3) recovery of gRNA: RNA was recovered from RNeasy MinElute Cleanup Kit (QIAGEN).

3. A homologous recombinant vector (donor vector) was constructed by the method of In-Fusion cloning (FIG. II),the The vector contained a 5.7kb 5 'homology arm, 2A-Luciferase and a 5.7kb 3' homology arm. The homologous recombination vector was constructed by selecting the tandem peptide 2A gene (SEQ ID NO.4) linked to the luciferase gene (SEQ ID NO. 5). The advantage of using the tandem peptide 2A is that the tandem peptide 2A allows the luciferase gene to be translated into protein together with AR, but does not fuse with AR protein, thus not affecting the activity of AR protein and allowing the expression of luciferase to be consistent with that of AR; after the luciferase gene connected in series behind 2A and the AR protein are expressed together, the fluorescence intensity can be measured by combining with a substrate specifically reacting with the luciferase, and the fluorescence intensity can quantitatively reflect the expression level of the AR protein and is a quantitative means which cannot be realized by other fluorescent proteins.

Tandem peptide 2A gene SEQ ID No. 4:

AAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGGATGTAGAAAGCAATCCAGGTCCA

luciferase gene SEQ ID No. 5:

ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAA

4. obtaining a mouse model

Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of C57BL/6J mice, and a mouse model with AR-2A-luciferase knocked in was constructed by the principle of homologous recombination.

Example 2

Luciferase signal detection for each tissue of the rat model of knock-in androgen receptor-luciferase of example 1, comprising the steps of:

1) one mouse obtained in example 1, into which androgen receptor-luciferase was knocked, was taken, sacrificed by breaking the neck, and each tissue was isolated;

2) 20mg of each tissue was dispensed into a 1.5mL centrifuge tube and 200uL luciferase signal detection buffer (150mM KCl, 20mM HEPES, 5mM MgCl)₂1mM EGTA. Adjusting the pH to 7.0 with NaOH), grinding the tissue into a homogenate;

3) centrifuging at 4 deg.C and 13kpm for 20 min;

4) taking 15uL of supernatant, 15uL of high-sugar DMEM medium and 30 mu L of high-sugar DMEM medium

Reagent (A), (B)

Luciferase Assay System, Promega) were mixed into wells of a CulturPlate (TM) -96 white solid-bottom 96-well plate (Perkinelmer);

5) shaking for 10 minutes;

6) measurements were made on a luminometer (luciferase reacted with substrate in a yellow-green flash, emission peak 560 nm).

The measurement results are shown in fig. 3. The expression of Androgen Receptor (AR) in each tissue can be seen in figure 3. The mouse animal model which is knocked in the androgen receptor-luciferase can accurately reflect the tissue expression condition of the androgen receptor.

Example 3

Luciferase signal detection in drug-stimulated embryonic fibroblast (MEF) cells for the rat model knocked-in androgen receptor-luciferase of example 1, comprising the steps of:

1. isolation and culture of Mouse Embryonic Fibroblast (MEF) cells

1) Taking a female rat obtained in example 1 and having androgen receptor-luciferase knocked therein and pregnant for 12.5-14.5 days, cutting off the neck, killing, soaking in 75% alcohol for 5min, transferring to a console, and aseptically exposing uterus;

2) the whole uterus was removed, placed in a dish with PBS and washed three times with PBS;

3) cutting the uterus along the mesentery side of the uterus, taking out the embryo with the fetal membranes, placing the embryo in another plate containing PBS, and fully washing;

4) tearing the fetal membranes by using tweezers, taking out the peptide rat, washing the peptide rat by using PBS for three times, taking out the head, the viscera and the limbs of the embryo, placing the trunk in another plate containing the PBS, and washing the embryo rat by using the PBS for at least three times;

5) shearing the mouse embryo trunk with sterile ophthalmic small scissors, sucking into a centrifuge tube, adding a proper amount of pancreatin, and digesting in a 37-degree incubator for 10-20 minutes;

6) taking out the centrifuge tube, repeatedly blowing and beating, and adding sufficient culture solution to stop digestion;

7) centrifuging for 5 minutes at 1000 revolutions;

8) removing supernatant, adding high-glucose DMEM culture solution containing 10% fetal calf serum, repeatedly beating for 20 times, placing in a cell culture dish, and culturing in an incubator with 37 ° and 5% saturated humidity;

9) after the cells are overlapped for several days, the cells can be subcultured and plated, and after the cells are overgrown, 1 mu M and 3 mu M of medicine PF-3758309 are added. After 24 hours, the cells were lysed and luciferase activity was assayed.

2. Luciferase Signal detection of cells

1) Taking 1 well of a 24-well cell plate as an example, the culture solution of the cells is removed, and then the cells are washed once with 500 microliters of PBS, and then the PBS is removed as clean as possible;

2) 100uL luciferase Signal detection buffer (150mM KCl, 20mM HEPES, 5mM MgCl) was added₂1mM EGTA. NaOH adjusted pH to 7.0), placed on ice for half an hour to crack. The cells were subsequently scraped off and transferred to a 1.5ml EP tube.

3) Centrifuge at 13kpm for 20 min at 4 ℃.

4) Taking 15uL of supernatant, 15uL of high-sugar DMEM medium and 30 mu L of high-sugar DMEM medium

Reagent (A), (B)

Luciferase Assay System, Promega) were mixed into wells of a CulturPlate (TM) -96 white solid-bottom 96-well plate (Perkinelmer).

5) Shake for 10 minutes.

6) Measurements were performed on a fluorescence luminometer.

The luciferase assay results are shown in FIG. 4. As can be seen from fig. 4, the luciferase activity of MEF cells significantly decreased after the addition of the drug stimulation. PF-3758309 is a well-known drug that can reduce the expression of androgen receptor (In the reference of the In vivo quantitative phosphoric profiling of the reaction-resistant pro-state cancer growth). The result shows that the MEF cell separated by the mouse model can be used as a good drug screening platform.

Example 4

In vivo imaging assay of the mouse model of knock-in androgen receptor-luciferase of example 1, comprising the steps of:

1) a stock solution (15mg/ml) of fluorescein (D-luciferin Firefoy) was prepared, i.e., the fluorescein was dissolved well with DPBS and then filtered through a 0.22 micron filter. Storing at-20 deg.C.

2) Using Avermectin (first named tribromoethanol 1.25g, add 2.5ml tert-amyl alcohol, then add 97.5ml ultrapure water, stir overnight (room temperature) in the dark. The next day, the mixture was filtered through a 0.22 μm filter and stored at 4 ℃ in the dark) to anesthetize one mouse into which androgen receptor-luciferase had been knocked (weight: 26.5 g);

3) injecting 265 microliter of fluorescein stock solution 10-15 minutes before imaging (one mouse injected at a dose of 10 microliter per gram);

4) and performing living body imaging on the upper fluorescence imager.

The in vivo imaging graph is shown in FIG. 5, and it can be seen from FIG. 5 that there is a significant fluorescence in each tissue of the mouse, which indicates that the knock-in mouse model of the present invention can well respond to the expression of androgen receptor in vivo.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<120> non-human mammal model, construction method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 289

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attgcaagag agctgcatca gttcactttt gacctgctaa tcaagtccca tatggtgagc 60

gtggactttc ctgaaatgat ggcagagatc atctctgtgc aagtgcccaa gatcctttct 120

gggaaagtca agcccatcta tttccacaca cagtgaagat ttggaaaccc taatacccaa 180

aacccacctt gttccctttc cagatgtctt ctgcctgtta tataactctg cactacttct 240

ctgcagtgcc ttgggggaaa ttcctctact gatgtacagt ctgtcgtga 289

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttccaaatct tcactgtgtg tgg 23

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttccacacac agtgaagatt tgg 23

<210> 4

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaaattgtcg ctcctgtcaa acaaactctt aactttgatt tactcaaact ggctggggat 60

gtagaaagca atccaggtcc a 81

<210> 5

<211> 1653

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60

accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120

gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180

gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240

tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300

gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgggcatt 360

tcgcagccta ccgtggtgtt cgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420

aaaaagctcc caatcatcca aaaaattatt atcatggatt ctaaaacgga ttaccaggga 480

tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540

tttgtgccag agtccttcga tagggacaag acaattgcac tgatcatgaa ctcctctgga 600

tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660

catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720

gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780

cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840

aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900

attgacaaat acgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960

aaggaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag gcaaggatat 1020

gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080

gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140

acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200

tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260

ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320

ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380

caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440

cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500

tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560

gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620

aaggccaaga agggcggaaa gatcgccgtg taa 1653

<210> 6

<211> 4272

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60

gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc 120

gacaagaagt acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc 180

accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240

agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300

acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 360

ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 420

gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 480

atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 540

ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 600

atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 660

gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 720

aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 780

ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840

attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 900

gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 960

atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 1020

ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 1080

atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1140

cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1200

tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1260

aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1320

cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1380

attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1440

aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1500

ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1560

gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1620

ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1680

aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1740

ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1800

aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1860

ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1920

aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1980

accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 2040

ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 2100

ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2160

ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2220

ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2280

gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2340

aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2400

gaaatggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg 2460

aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2520

gaaaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2580

atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc 2640

gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2700

aagaaccggg gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac 2760

tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2820

aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2880

gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2940

aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 3000

ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 3060

caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3120

cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3180

atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3240

atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3300

ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3360

accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3420

acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3480

agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3540

tctgtgctgg tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa 3600

gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3660

ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3720

tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3780

aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3840

tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3900

cacaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3960

ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 4020

atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 4080

gccgccttca agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag 4140

gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4200

ctgtctcagc tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260

aagaaaaagt aa 4272

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaaattaata cgactcacta ta 22

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaaaaaagca ccgactcggt gccac 25

Claims (10)

1. A method for constructing a non-human mammal model, comprising the steps of:

introducing Cas9 mRNA, gRNA and a homologous recombination vector into a fertilized egg of a non-human mammal, so that a tandem peptide-luciferase expression frame is knocked in by homologous recombination fixed points before a stop codon site of an androgen receptor gene of the non-human mammal;

the gRNA includes: two segments with nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO. 3;

the 5 'homologous arm, the tandem peptide gene, the luciferase gene and the 3' homologous arm on the homologous recombination vector are connected in sequence; the 5 'homology arm and the 3' homology arm can undergo homologous recombination with the genome of the non-human mammal.

2. The method for constructing a non-human mammal model according to claim 1, wherein the nucleotide sequence of the tandem peptide gene is represented by SEQ ID No. 4.

3. The method for constructing a non-human mammal model according to claim 1, wherein the nucleotide sequence of the luciferase gene is represented by SEQ ID No. 5.

4. The method of constructing a non-human mammal model according to any one of claim 1, wherein the nucleotide sequence of Cas9 transcribed to Cas9 mRNA is shown as SEQ ID No. 6.

5. The method of constructing a non-human mammal model according to any one of claims 1 to 4, wherein the non-human mammal is a mouse.

6. The method of claim 5, wherein the mouse is a C57BL/6J mouse.

7. The method of claim 6, wherein the androgen receptor gene has a nucleotide sequence shown in SEQ ID No. 1.

8. The non-human mammal model knock-in with androgen receptor-luciferase gene constructed by the construction method of any one of claims 1 to 7.

9. The use of the non-human mammal model knock-in with androgen receptor-luciferase gene of claim 8 in screening for a drug that modulates the expression level of androgen receptor or in screening for a drug that treats a disease caused by a change in the expression level of androgen receptor.

10. The use of claim 9, wherein the disorders caused by a change in the expression level of androgen receptor comprise: polycystic ovary syndrome, prostatic cancer, androgen insensitivity syndrome, bulbar spinal muscular atrophy, male breast cancer and the like.

Images