CN111269945B - Method for constructing retinal pigment degeneration disease model by using Gm20541 gene and application - Google Patents

Abstract

The invention discloses a method for constructing a retinal pigment degeneration disease model by using a Gm20541 gene and application, and relates to the technical field of medical engineering. According to the method, the Gm20541 gene sequence in the genome of the retinal precursor cell is specifically targeted and knocked out, so that a target animal shows typical retinal pigment degeneration disease characteristics, a reliable animal model is provided for the research of the retinal pigment degeneration disease related to the Gm20541 gene, the pathogenic process and mechanism of the retinal pigment degeneration disease can be clarified, a new target is provided for the treatment or prevention of the retinal pigment degeneration disease, and the application prospect is wide.

Description

Method for constructing retinal pigment degeneration disease model by using Gm20541 gene and application

Technical Field

The invention relates to the technical field of medical engineering, in particular to a method for constructing a retinal pigment degeneration disease model by using a Gm20541 gene and application thereof.

Background

Retinitis Pigmentosa (RP) is a group of hereditary blinding fundus diseases caused by abnormal retinal photoreceptors, the worldwide incidence rate is about 1/3000-1/4000, the incidence rate of Chinese people can reach 1/3500, and due to the large population of China, RP patients can reach three hundred thousand, and heavy burden is brought to families and society. At present, diagnosis and treatment of RP face many difficulties, and no effective treatment means exists, which is mainly due to high heterogeneity of clinical phenotype and heredity and insufficient systematic research of pathological mechanism. The typical RP patients first develop night blindness and visual field stenosis due to rod cell function defects, gradually developing into tubular visual fields until blindness; retinal pigmentation was visible by fundus examination. Pathologically, the classical RP affects predominantly rod cells, causing rod cell death and secondary cone cell death, mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer retinal nuclear layer until it disappears, and corresponding pathological changes in the outer retinal layer and other related cell layers.

In addition, due to the high heterogeneity of RP in clinical phenotype and genetic pattern, many pathogenic mechanisms of RP are not yet clear, which brings great difficulty to clinical diagnosis and treatment of RP diseases, and thus research on pathogenic mechanisms of RP diseases is urgent.

At present, however, there is a lack of corresponding RP disease models.

Disclosure of Invention

The invention aims to provide a method for constructing a retinal pigment degeneration disease model by utilizing a Gm20541 gene and application thereof, the retinal pigment degeneration disease model can be obtained by adopting the construction method, the model can show the characteristics of the retinal pigment degeneration disease, the model can be used for researching the retinal pigment degeneration disease, can help to clarify the pathogenesis and mechanism of RP, and provides a new target for the treatment or prevention of the disease.

The invention is realized by the following steps:

in a first aspect, embodiments of the present invention provide a method for constructing a retinal pigment degeneration disease model using a Gm20541 gene, including: knocking out Gm20541 gene in the genome of the retina precursor cell of the target animal.

Znf124 is a novel gene encoding a zinc finger protein. Zinc finger proteins are transcription factors with finger-like domains, and play an important role in gene regulation. ZNF124 protein can enter nucleus through nuclear pore and can be used as transcription factor to regulate the expression of other genes. The current research on the function of the ZNF124 protein is not reported and the function is not known much, and the ZNF124 is related to Dandy-Walker complex (DWC) which is a congenital central nervous system development disease. Furthermore, ZNF124 is thought to be involved in the inhibition of human hematopoietic apoptosis by precursor growth factor (VEGF), suggesting that ZNF124 plays an important role in human life activities.

Another study of the inventors shows that Znf124 gene mutation is related to RP, which is greatly helpful for exploring pathogenic mechanism of RP. Therefore, the ZNF124 has great potential in the treatment and the cause discussion of the retinal pigment degeneration diseases. However, the present research on ZNF124 is still in the early stage, and the mouse homologous gene is Gm20541(predicted gene 20541, MGI: 5142006), the gene is located on mouse chromosome 17 No. 38009647 and 38012396bp, the full length is 2750kb, the cDNA full length is 1406 bp, comprises 3 exons, and the cDNA sequence is shown in SEQ ID NO.1 as follows: GAATGCAGTGACCTATGATGATGTGTGTGTGAACTTCACTCTGGAAGA ATGGACTTTACTGGATCCTTCACAGAAGAGTCTCTACAGAGATGTGAT GCAGGAAACCTACAGGAATCTCACTGCTATAGGCTACAATTGGGAAGA TGACAATATTGAAGACTATTTTCAAAGTTCTAGAAGACATGGAAGGCA TGAAAGAAATCATAGTGGAGAGAAACCTTATGCTTGTAACCAATGTGA TAAAGCCTTTTCATGTCATCATAGTCTCCAAATACATAAAAGAAGACAT ACTGGAGAGAAACTCTATGAATGTAACCGTTGTAATAAAGGCTTTCCA TATCCCAGTGCTCTACAAATACATAAAAGGATACACAGTGGAGAGAAA CCCTATGAATGTAAACAATGTGGTAAAGCCTTTGCATGTCACAGTTCT CTTCAAAGGCATGAAAGAATACATACTGGTGAGAAACCTTATGAATGT AGCCAATGTGGTAAAGCCTTTACACATCAAAAGAGTCTCCAAATACAT AAAAGAACTCACAGTGGAGAAAAACCATATGGGTGTAGTCAGTGTGG AAAAGACTTTGTAAGTCAGAGTCGTCTTCTAGAACATAAAAGGACAC ATACTGGAGAGAAACCCTATGAATGTAACCAATGTGGTAAAGCCTTTG CATATTCCAACAGTCTCCAAATACATCAAAGAACACACACTGGAGAG AAACCCTATGAATGTAACCAGTGTGGTAAAGCCTTTGCATATCACAAT AGTCTCCAAATACATAAAAGTACACACACTGGAGAGAAACCCTATAAA TGTAACCAGTGTGGTAAAGCCTTTGCATATCACATTACTCTCCGAACA CATAAAGGAACACACACTGAAGAGAAACCCTATGAATGTAACCAATG TGGTAAAGCCTTTGCATATTCCAACAGTCTCCAAATACATCAAAGAAC ACACACTGGAGAGAAACCCTATGAATGTAACCAGTGTGGTAAAGCCT TTGCATATCACAATAGTCTCCAAATACATAAAAGTACACACACTGGAG AGAAACCCTATGAATGTAACCAGTGTGGTAAAGCCTTTGTATGTAGCA GTCATTTTCAAAGGCATAAAAAAATTCATACTGGAGAGAAACCCTATG ATTGTAACCAGTGTGGTAAAGCCTTTGCATATAAAAGTAATCTCCAAAT TCATGAAAGAAAACACACTGGAGGGAAACCCTCTGAATGTAATTAAT GTAGTAAAGCTTTTGCATTTCATAATAGTTTCCAAATACATAAAAGAAC ACATAGTGAGAGAAACCCTATGAATATAACCAATGTGGTAAAACATTT CCATATCTCAGTGGTCTCCGCATTTATAACAGAACACATAGTGGAGAG AAACCCTATGGATGTAA are provided.

The specific action mechanism of Gm20541 in mice is not clear, and the development and application of the Gm20541 are limited. To date, there is no functional study on the Gm20541 gene, and the biological function thereof is unclear.

The inventor of the invention firstly discovers that the target animal can show the characteristics related to the retinitis pigmentosa diseases such as rod cell death and secondary cone cell death, mainly as damaged and degenerated photoreceptors, the outer nuclear layer of the retina is gradually thinned until disappears, and the outer retinal reticulum layer and other related cell layers show corresponding pathological changes by knocking out the Gm20541 gene, namely silencing or knocking down the expression of the Gm20541 gene in the precursor cells of the retina of the target animal such as a mouse. Therefore, the animal with the Gm20541 gene knocked out in the retinal precursor cell can be used as a retinal pigment degeneration disease model, is used in the fields of research on retinal pigment degeneration diseases and the like, and provides a new model for the research on the diseases, such as the pathogenesis, and the screening of related medicines.

Further, in some embodiments of the invention, knockout of the Gm20541 gene sequence refers to knockout of an exon sequence of the Gm20541 gene.

The sequence of the Gm20541 gene knockout can be a sequence of the Gm20541 gene in the full length, or can be a sequence of a part of the Gm20541 gene, such as a part of exon sequence, and the sequence of any type (part or full length) can be knocked out, so long as the sequence can silence the expression of the Gm20541 gene in precursor cells, and the corresponding characteristics of the retinitis pigmentosa diseases can be expressed by animals, which falls into the protection scope of the invention.

Further, in some embodiments of the invention, the exon sequences are selected from any one or more of exon 1, exon 2, and exon 3 sequences.

On the basis of the disclosure of the present invention, that is, on the premise that the present invention reveals the correlation between the Gm20541 gene and the retinal pigment degeneration disease, one skilled in the art can easily think of knocking out any one or more exon sequences of the Gm20541 gene, so as to damage the function of the Gm20541 gene and further obtain a similar retinal pigment degeneration disease model, and such methods also belong to the protection scope of the present invention.

Further, in some embodiments of the invention, the exon sequences are exon 3 sequences.

Further, in some embodiments of the invention, the 3 rd exon sequence on the Gm20541 gene is knocked out using Cre-loxp gene knock-out technology.

The knockout strategy is to knock out the Gm20541 gene by adopting Cre-loxP knockout technology. However, in other embodiments, there are many technical means for implementing gene knockout, such as CRISPR/Cas9 technology, artificial nuclease-mediated zinc finger nuclease technology (ZFN), transcription activator-like effector nuclease Technology (TALEN), and the like. Therefore, in other embodiments, the Gm20541 gene is knocked out by using CRISPR/Cas9 technology or other technical means, which also belongs to the protection scope of the present invention.

Further, in some embodiments of the invention, the target animal is a mammal.

Further, in some embodiments of the present invention, the mammal is selected from any one of a mouse, a rat, a dog, a pig, a monkey, and a ape.

It should be noted that the target animal of the present invention is not limited to the above-mentioned animals, and other types of mammals are also possible, and any animal may be selected as long as it is an animal having the Gm20541 gene or a homologous gene thereof, and it is also within the scope of the present invention that the Gm20541 gene is knocked out in its precursor cell to express a characteristic of a retinal pigment degeneration disease as a model of the retinal pigment degeneration disease.

In a second aspect, the embodiments of the present invention provide applications of the retinal pigment degeneration disease model obtained by the above method in research of retinal pigment degeneration diseases.

Further, in some embodiments of the invention, the study is directed to treatment of a non-disease.

The animal model obtained by the construction method has the characteristics of typical retinitis pigmentosa diseases, has very wide application prospect, and provides a basis for deeply understanding and researching the retinitis pigmentosa diseases by using the animal model for researching the pathogenesis of the retinitis pigmentosa diseases. Or screening a drug for preventing or treating a retinal pigment degeneration disease, evaluating the efficacy or prognosis of the drug, or the like.

In a third aspect, the embodiments of the present invention provide an application of the retinal pigment degeneration disease model obtained by the above method in screening a drug for preventing or treating retinal pigment degeneration diseases.

Based on the construction method provided by the first aspect of the present invention, those skilled in the art will easily understand that the retinal pigment degeneration disease model obtained by the method can be used for screening drugs for preventing or treating retinal pigment degeneration diseases or other similar fields, which also belongs to the protection scope of the present invention.

Further, in some embodiments of the invention, the use comprises: administering a drug candidate to the retinal pigment degeneration disease model, indicating that the drug candidate may act as a drug for preventing or treating retinal pigment degeneration disease if the retinal pigment degeneration disease model undergoes at least one of the following changes before and after administration of the drug candidate:

(1) after administration of the drug candidate, the retinal pigment degeneration disease model has improved vision compared to before administration of the drug candidate;

(2) (ii) after administration of the drug candidate, the retinal outer nuclear layer of the retinal pigmented degenerative disease model is thickened compared to before administration of the drug candidate;

(3) after administration of the drug candidate, the retinal outer segment of the retinal pigmented degenerative disease model increases compared to before administration of the drug candidate.

In a fourth aspect, an embodiment of the present invention provides a method for breeding a retinal pigment degeneration disease model, which includes: the retinal pigment degeneration disease model obtained by the method described above was selfed.

On the basis of the retinal pigment degeneration disease model obtained by the construction method of the first aspect, in order to obtain more retinal pigment degeneration disease models, the skilled person will easily think that the retinal pigment degeneration disease model obtained by the construction method described above is directly selfed to breed or breed more retinal pigment degeneration disease models, which also belongs to the protection scope of the present invention.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1: detecting the expression of the Gm20541 gene in different tissues and organs;

in the figure: a: RT-PCR detection results of expression results of GM20541 gene in different tissues and organs, Brain: brain tissue; liver: a liver; retina: retina, Intestine: a bowel; music: a muscle; heart: a heart; kidney: the kidney; spleen: a spleen; b: statistical results of a in fig. 1; western Blot for detecting the expression of GM20541 protein in different tissues and organs; d, the statistical result of C in figure 1.

FIG. 2: a construction route of a Gm20541 gene knockout mouse;

SixKO or cKO in the figure indicates Gm20541 knock-out homozygous mice; ctr means wild type; het means heterozygote.

FIG. 3: identifying the result of the first-generation mouse by using middle-long distance PCR;

in the figure: a: amplifying a 5 ' end long arm by using a primer pair Gm 5 ' LRF and SA3 ' R, wherein the amplification product is 2.3 kb; wherein A2,3,6,9,10, B1 is positive; b: the 3 'long arm was amplified using the primer pair NeoF and Gm 3' LRR, resulting in an amplification product of 2.6 kb. Wherein: a2,3,6,9,10, B6,9, ES1G, ES2G are positive heterozygotes, and +/- + is a wild-type control.

FIG. 4: identifying a Gm20541 gene knockout mouse;

a: the genotype identification result of the Gm20541 gene knockout mouse; b: the gene knockout efficiency of the Gm20541 knockout mouse retina is analyzed through a real-time quantitative PCR experiment, and the Gm20541 is proved to be no longer expressed in the knockout mouse retina; SixKO or cKO represents Gm20541 knockout homozygous mice; ctr means wild type; het means heterozygote.

FIG. 5: dark adaptation Electroretinogram (ERG) test results;

in the figure: A-C: dark adaptation electroretinogram trace graphs of Gm20541 knockout mice under different light intensities; d: dark adaptation electroretinogram a-wave statistics of Gm20541 gene knockout mice under different light intensities; e: dark adaptation electroretinogram b-wave statistics of Gm20541 gene knockout mice under different light intensities; scotopic amplitude: measuring the peak value by dark light; flash intensity: flash intensity; a-wave: a wave; b-wave: b wave.

FIG. 6: photoadaptive Electroretinogram (ERG) measurements;

in the figure: A-B: a light-adaptive electroretinogram trace map of a Gm20541 knockout mouse under different light intensities; c: 20cd s/m²Light-adapted scintillation (Flicker) electroretinogram trace of Gm20541 knockout mice under light intensity; d: light adaptation electroretinogram a-wave statistics of the Gm20541 gene knockout mouse under different light intensities; e: light adaptation electroretinogram b-wave statistics of the Gm20541 gene knockout mouse under different light intensities; f: 20cd s/m²Light-adapted scintillation (Flicker) electroretinogram statistics of Gm20541 knockout mice at light intensity. SixKO or cKO represents Gm20541 knockout homozygous mice; ctr means wild type; het means heterozygote.

FIG. 7: performing immunohistochemical staining on a mouse retina section by specifically knocking out a Gm20541 gene from a retina precursor cell; age of the mice: 4 months; and OS: outer-segment; IS: inner-segment; ONL: outer nuclear layer; INL: inner nuclear layer;

in the figure: a: h & E staining results of mouse retina paraffin sections with Gm20541 genes specifically knocked out by retina precursor cells show that an outer nuclear layer and an inner nuclear layer are thinned; b: and counting the thickness of the outer nuclear layer of the retina of the Gm20541 knockout mouse at different positions.

FIG. 8: the IHC staining result of a mouse with a specific knockout Gm20541 gene of a retinal precursor cell shows that the mouse with the Gm20541 knockout retinal outer segment is shortened and degenerated. SixKO represents Gm20541 knockout homozygous mice; ctr refers to wild-type mouse; DAPI (4', 6-diamidino-2-phenylindole): the nuclear dye 4', 6-diamidino-2-phenylindole; rhodopsin: rhodopsin antibodies; merge: the two colors overlap.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

1, detecting the expression condition of the Gm20541 gene in different tissues and organs by adopting an RT-PCR method.

The method comprises the following steps: total RNAs of mouse brain, liver, retina, intestine, muscle, heart, kidney and spleen were extracted, respectively, and then cDNA was synthesized using a cDNA synthesis kit (Invitrogen, Waltham, MA, USA). Primers were designed based on the cDNA sequence of Gm 20541:

Gm20541-cDNA-F：5’-TCGGTCTCATCTTCATTCCC-3'；

Gm20541-cDNA-R：5’-GGAAGGCTCTGTTCCGGTAT-3'。

RT-PCR was performed using the extracted cDNA as a template. The results of electrophoresis after amplification are shown in FIG. 1.

The results are shown in A and B in FIG. 1, and it can be seen that the expression of the Gm20541 gene in mouse brain, liver, retina, intestine, muscle, heart, kidney and spleen is detected by RT-PCR method, and as a result, the expression of Gm20541 is found in all the tissues and organs, which indicates that the gene may play an important function in vivo.

2, the expression of the Gm20541 gene in different tissues and organs is detected by adopting an immunoblotting (western blot) method.

The method comprises the following steps:

(1) the mouse brain, liver, retina, heart, kidney and spleen were obtained separately, and 200. mu.l of protein lysate RIPA was added after sufficient grinding.

(2) After cell disruption by sonication, the cells were lysed on ice for 20 min.

(3) Centrifuging at 16000g for 10min at 4 deg.C, transferring the supernatant to another clean centrifuge tube, adding 50 μ l protein sample solution, mixing, and heating at 95 deg.C for 5min.

(4) After the sample was cooled, 20. mu.l of each sample was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) at 160V to separate proteins.

(5) After SDS-PAGE is finished, cutting a nitrocellulose membrane with a proper size according to needs, sequentially laying filter paper, glue, the nitrocellulose membrane and the filter paper, removing bubbles, putting a membrane transferring groove into an ice water bath, and transferring the membrane for 2 hours by adopting a constant current of 0.28A.

(6) After the film transfer is finished, the nitrocellulose film is washed once by pure water, dried and marked. Then blocked with 8% skimmed milk for 2 h.

(7) After blocking was complete, a defined amount of primary antibody diluted in blocking solution in a defined ratio (according to the instructions for antibody use) was added and incubated overnight at 4 ℃.

(8) The primary antibody was recovered and the membrane was washed 4 times with 1 × TBST buffer for 10min each time, and depending on the source of the primary antibody, the appropriate secondary antibody was selected, and horseradish catalase (HRP) -labeled secondary antibody was diluted with 1 × TBST and incubated for 2h on a shaker at room temperature.

(9) After the secondary antibody incubation was completed, the membrane was washed 3 times with 1 XTSST for 10min each time, and the protein was detected using Thermo's ELC luminescence kit using Bio-Rad's chemiluminescence gel imaging system.

The results are shown in fig. 1C and D, and it can be seen that the Gm20541 protein was demonstrated to be expressed in mouse brain, liver, retina, heart, kidney and spleen by the method of immunoblotting (western blot).

Example 2

In this embodiment, a mouse is used as a target animal to explain the method for constructing a retinal pigment degeneration disease model provided by the present invention, and the Gm20541 gene knockout route is shown in fig. 2, and the specific operations are as follows:

obtaining a knockout mouse:

1 cloning 5 'arm homologous with mouse Gm20541 gene, an expression frame containing reporter gene GFP, an expression frame with NEO resistance gene, 3 rd exon with loxP sites arranged in the same direction at two ends and 3' end arm into BAC vector (figure 2) to replace 3 rd exon of Gm20541 gene to be knocked out;

2, replacing the 3 rd exon in the Gm20541 gene by using a DNA homologous recombination technology to obtain a mouse embryonic stem cell conditionally knocked out by the Gm20541 gene;

3, preparing a chimeric mouse containing a Gm20541 gene knockout cell by using the embryonic stem cell obtained in the step 2 (figure 2);

4, the chimera mouse obtained in the step 3 and a wild mouse are bred by mating, and a heterozygous mouse with a Gm20541 gene knockout is selected in the offspring (FIG. 2).

And (3) identification:

in example 2, the long-range PCR results of the experiments for identifying the positive first-generation mice, the amplification 5 ' end long arm uses a primer pair Gm 5 ' LRF and SA3 ' R, and the amplification product is 2.3 Kb.

Gm 5’LRF:5’-GGCAGGATCTTCACCTGTTGACCAACATGCCT-3’；

SA3’R:5’-CCAACCCCTTCCTCCTACATAGTTGGCAGT-3’。

The result is shown in FIG. 3, panel A, and the amplification product was 2.3 kb. Wherein A2,3,6,9,10, B1 are positive.

Primers were used to amplify the 3' long arm:

NeoF:5’-CGCCTT CTTGACGAG TTCTTCTGA-3’；

Gm 3’LRR:5’-GGTGCTTGAGTAGTGTTGAATCTCAGTGGACCA-3’

the result is shown in FIG. 3B, and the amplification product was 2.6 kb. Wherein: a2,3,6,9,10, B6,9, ES1G, ES2G are positive heterozygotes, and +/- + is a wild-type control.

5, mating and breeding the heterozygote mouse animal obtained in the step 4 with a transgenic mouse FLPer mouse to obtain a Gm20541 gene conditional knockout heterozygote mouse;

6, mutually mating and breeding the Gm20541 gene conditional knockout heterozygous mice obtained in the step 5 to obtain Gm20541 gene conditional knockout homozygous mice;

7, mating the Gm20541 gene conditional knockout homozygote animal obtained in the step 6 with a Six3-Cre gene transfer animal to obtain a retina precursor cell Gm20541 gene knockout mouse.

Transgenic mice FLPer mice were purchased from the U.S. Czewson laboratory (strain name: B6.129S4-Gt (ROSA)26Sortm1(FLP1) Dym/RainJ). Six3-Cre transgenic mice (MGI: 3574771) were donated by the Anderson cancer center, university of Texas, USA. Six3 is a marker transcription factor of forebrain ventral and retinal precursor cells, the specificity of the transcription factor drives Cre gene to express in the retinal precursor cells, Cre protein can enter cell nucleus to recognize LoxP sites on genome, and gene knockout is realized.

Identifying a knockout mouse:

the genotype identification of the mouse with the retinal precursor cell knockout of the Gm20541 gene is carried out as follows:

(1) cutting a little tissue sample from the tail tip of the mouse, and placing the cut tissue sample in a clean 1.5ml centrifuge tube;

(2) add 100. mu.l lysis buffer (40mM NaOH, 0.2mM EDTA solution) to the centrifuge tube and heat for 1h at 100 ℃ in a metal bath; (3) the centrifuge tube was removed, cooled to room temperature, 100. mu.l of a neutralizing solution (40mM Tris-HCl, pH5.5) was added thereto, and after centrifugation at 10000g for 2min, the supernatant was used for mouse genotyping.

(3) And (3) PCR amplification: the PCR reaction system was configured as follows

2×Taq Mix：10μL

Tail tissue lysate: 2 μ L

Primer 1(Gm20541-loxP-Forward or Six 3-Cre-Forward): 1 μ L (concentration: 10mM)

Primer 2(Gm20541-loxP-Reverse or Six 3-Cre-Reverse): 1 μ L (concentration: 10mM)

ddH₂O：6μL。

The primer sequences are as follows:

gm20541-loxP-Forward sequence: 5'-ATTCCCCTTCAAGATAGCTAC-3', respectively;

gm20541-loxP-Reverse sequence: 5'-AATGATCAACTGTAATTCCCC-3', respectively;

six3-Cre-Forward sequence: 5'-GCCGCCGGGATCACTCTCG-3', respectively;

six3-Cre-Reverse sequence: 5'-CCAGCCGCCGTCGCAACTC-3' are provided.

And (3) amplification procedure: after the PCR reaction system was prepared, the template DNA was fully denatured by preheating at 95 ℃ for 5 minutes in a PCR instrument, and then subjected to an amplification cycle. In each cycle, the template is denatured by keeping the temperature at 95 ℃ for 30 seconds, then the temperature is reduced to the renaturation temperature of 58 ℃ and kept for 30 seconds, so that the primer and the template are fully annealed; the reaction mixture was held at 72 ℃ for 30 seconds, and the primers were extended on the template to synthesize DNA, thereby completing one cycle. This cycle was repeated 25 times to allow the amplified DNA fragments to accumulate in large amounts. Finally, the product was left intact for 5 minutes at 72 ℃ and stored at 4 ℃.

(4) Gel electrophoresis

1g of agarose was weighed and placed in 100ml of TAE buffer, and melted in a microwave oven to prepare 1% agarose gel. 10 μ l of PCR product was placed in a well and subjected to 120V constant pressure agarose electrophoresis for 15min.

In FIG. 4, the upper part of A is the result of conditional knockout identification of Gm20541, WT represents the wild-type control, and the size of the band is 223 bp; het represents heterozygote, and two bands are 223bp and 358 bp; SixKO represents homozygote, and the band size is 358 bp. In FIG. 4, the result of Six3-Cre identification is shown below A. The size of Six3-cre is 200 bp. From the results of A in FIG. 4, it is shown that the employed identification method can effectively identify the genotype of the newborn mouse. The Gm20541 gene knockout homozygote mouse can be used as a retinal pigment degeneration disease model (SixKO or cKO is used for representing the Gm20541 gene knockout homozygote mouse; Ctr is a wild type; Het is a heterozygote) and relevant phenotype verification is carried out.

(5) The RT-PCR experiment analyzes the gene knockout efficiency verification in the retina of the Six3-cre knockout mouse, and the method comprises the following steps:

(a) separating the wild type and mutant mouse retina tissues respectively, placing the tissues in a 1.5ml centrifuge tube, adding 1ml Trizol extracting solution, and keeping the temperature at room temperature for 20 minutes;

(b) adding 200 mul chloroform, fully and uniformly mixing, and standing for 10 minutes at room temperature;

(c) placing the sample in a 4-degree centrifuge, centrifuging for 15 minutes at 10000 revolutions;

(d) carefully sucking the supernatant, adding isopropanol with the same volume, fully and uniformly mixing, centrifuging at 10000 rpm to precipitate RNA;

(e) washing the total RNA separated out by 75% ethanol, centrifuging, precipitating again, then airing and adding DEPC water for dissolving;

(f) the extracted total RNA was used to synthesize cDNA using a cDNA synthesis kit (Invitrogen, Waltham, MA, USA). Primers were designed based on the cDNA sequence of Gm 20541:

Gm20541-cDNA-F：5’-TCGGTCTCATCTTCATTCCC-3'；

Gm20541-cDNA-R：5’-GGAAGGCTCTGTTCCGGTAT-3'；

(g) RT-PCR was performed using the extracted cDNA as a template. After amplification, electrophoresis was performed.

The results are shown in B in FIG. 4, and it can be seen that the expression level of Gm20541 in the retina of a Gm20541 gene knockout homozygous mouse is significantly reduced by RT-PCR detection. Ctrl in B of FIG. 4 refers to wild-type control, SixKO refers to Gm20541 knock-out homozygote mouse; gm20541 RNA level means that the RNA expression level is relatively changed, and the wild type expression level is 1.

Example 3

ERG visual acuity test was performed on 4-month-old Gm20541 knockout homozygous mice:

1 dark adaptation animals should adapt dark overnight, and the environment should be absolutely free of light;

anesthesia is performed for 2 days: weighing, and injecting in an abdominal cavity; deep anesthesia is suitable;

animal fixation and mydriasis: after completion of anesthesia, mice were taped in front of the animal test platform under dark red light illumination: the mouse needs to be ensured to lie prone, namely, the height of two eyes is consistent relative to the stimulating port of the flash stimulator, the eyes are fully exposed, and the mydriatic agent is dripped.

4, electrode installation: preheating an electroretinograph (Espion Visual Electrophysiology System, diagnosllc, Littleton, MA, USA), coating conductive paste on the ear clip electrode, clipping the tail, and inserting the amplifier "ground" interface; the double-ended needle electrode is inserted into the nape skin (approximately in the middle of the ears) and simultaneously connected with the negative interfaces of the two channels; the gold ring electrode was clamped to the electrode holder of the animal experiment platform and carefully angled to slightly contact the central apex of the cornea. One channel anode is connected with the right eye, and the two channel anode is connected with the left eye. The needle tube is used for dripping physiological saline on the eyes, so that the contact effect of the gold ring electrode and the cornea is improved. The two gold ring electrodes are ensured to contact the same position of the central positive end of the cornea of two eyes in the same angle and mode.

And 5, after the oscillography signal is recorded to confirm that the oscillography signal is correct, the dark red light is turned off. The dark adaptive light intensity of 0.003 cd.s/m can be recorded by first trying²The ERG detection of (a), confirms the quality of the signal: if a large difference from the expected amplitude occurs in the amplitudes of both eyes, it is recommended to check the mounting position of the gold ring electrode again. Then the dark adaptive light intensity is recorded as 0.3/3.0/20.0 cd.s/m²Of the signal of (1). It should be noted that dark adaptation is performed at 20.0cd s/m²After the light intensity is detected, the system will automatically turn on the backlight. Similarly, a timer is started, and the light is adapted for 10-15 minutes and recorded again.

6 after the optical adaptation, the optical adaptation of 3.0 cd.s/m is recorded in sequence²And 20.0cd · s/m²The waveform under the light intensity is finally recorded as 20.0cd s/m²The retina evoked potential flickers under light intensity.

Results it was found that at 4 months, compared to Ctrl (control) mice, cKO (Gm20541 knockout homozygous mice) mice had a and b waves significantly reduced under both dark and light acclimation conditions, indicating impaired vision following Gm20541 knockout (see fig. 5 and 6).

Example 4

Retinal paraffin sections H & E staining:

the retinas of 4-month-old mice were subjected to paraffin sectioning and staining by hematoxylin-eosin staining (H & E staining method) as follows:

1) quickly taking eyeball tissues of the mouse, and placing the eyeball tissues in a stationary liquid for fixation for 24 hours;

2) embedding in paraffin, and slicing to obtain slices with a thickness of 4 μm;

3) the slices were dewaxed conventionally with xylene, washed with multi-stage ethanol to water: xylene (I)5min → xylene (II) 5min → 100% ethanol 2min → 95% ethanol 1min → 80% ethanol 1min → 75% ethanol 1min → distilled water washing 2 min;

4) hematoxylin staining for 5 minutes and washing with tap water;

5) ethanol hydrochloride is differentiated for 30 seconds;

6) soaking in tap water for 15 minutes;

7) placing in eosin solution for 2 minutes.

8) Conventional dehydration, transparency, mounting: 95% ethanol (I)1min → 95% ethanol (II) 1min → 100% ethanol (I)1min → 100% ethanol (II) 1min → xylenecarbonate (3: 1) 1min → xylene (I)1min → xylene (II) 1min → neutral resin sealing.

9) Take pictures under microscope.

The results found that at 4 months, the outer nuclear layer of the retina of SixKO mice had begun to thin, indicating photoreceptor cell death, compared to Ctrl (control) mice (fig. 7).

Example 5

Immunostaining of frozen retinal sections: after 4-month-old mice with the Gm20541 gene knockout homozygote obtained in example 2 were sacrificed at the neck, the eyeballs were quickly removed and placed in 4% PFA, fixed on ice for 15min, and then the cornea was cut and fixed on ice. After 2h, washing with PBS buffer solution for 3 times, then placing the eyeball in 30% sucrose solution for dehydration for 2h, then cutting off cornea and crystal under a dissecting mirror, embedding with OCT, and rapidly placing in a refrigerator at-80 ℃ for freezing. After about 10min, the OCT embedded eyeball is taken out and placed in a freezing microtome to be balanced at-25 ℃ for about 30min, and then the section can be obtained. The slice thickness was 12 μm.

After the slicing was completed, the higher quality slices were selected and placed in an oven at 37 ℃ for 30min, then an immunohistochemical pen was circled in the area with retinal tissue, washed three times with PBS to remove OCT, then blocked with 5% NDS (containing 0.25% Triton) for permeation for 2h, incubated primary antibody at 4 ℃ overnight. On the following day, after three washes with PBS, the corresponding fluorescent secondary antibody was incubated, then washed three more times with PBS, mounted, and observed.

The results are shown in fig. 8, and at the age of 4 months, after the mice are stained by retina frozen tissue sections with outer segment antibody Rhodopsin and inner segment antibody NaK-Atpase, the Gm20541 knockout homozygote mice (SixKO in the figure) have obviously shortened retina outer segments compared with wild-type mice, and show obvious degeneration characterization.

In conclusion, in the embodiment of the invention, a mouse is taken as an example, the Gm20541 gene is specifically knocked out in a mouse retina precursor cell by a Cre-loxP gene knocking-out technology, and the mouse shows typical characteristics of retinal pigment degeneration diseases such as impaired vision, short and degenerated outer segment of an optic cell, lost optic cell and the like. It is fully demonstrated that the target animal can express a retinal pigment degeneration disease by knocking out the Gm20541 gene in retinal precursor cells. The retina precursor cell knockout Gm20541 gene animal can be used as a retinal pigment degeneration disease model. The disease model can be used in the fields of research on retinal pigment degeneration diseases and the like, and provides a new model for the research on the diseases, such as the pathogenesis process, mechanism and screening of related medicines.

Although the examples of the present invention only show the phenotype of the mouse with the knockout of the Gm20541 gene in the retinal precursor cells, it is easily understood by those skilled in the art that the mouse as a representative of mammals should have a similar phenotype with the knockout of the Gm20541 gene or its homologous gene in other mammals, which can also be used as a model of retinal pigment degeneration disease.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Hospital for people in Sichuan province

<120> method for constructing retinal pigment degeneration disease model by using Gm20541 gene and application

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1406

<212> DNA

<213> Artificial sequence

<400> 1

gaatgcagtg acctatgatg atgtgtgtgt gaacttcact ctggaagaat ggactttact 60

ggatccttca cagaagagtc tctacagaga tgtgatgcag gaaacctaca ggaatctcac 120

tgctataggc tacaattggg aagatgacaa tattgaagac tattttcaaa gttctagaag 180

acatggaagg catgaaagaa atcatagtgg agagaaacct tatgcttgta accaatgtga 240

taaagccttt tcatgtcatc atagtctcca aatacataaa agaagacata ctggagagaa 300

actctatgaa tgtaaccgtt gtaataaagg ctttccatat cccagtgctc tacaaataca 360

taaaaggata cacagtggag agaaacccta tgaatgtaaa caatgtggta aagcctttgc 420

atgtcacagt tctcttcaaa ggcatgaaag aatacatact ggtgagaaac cttatgaatg 480

tagccaatgt ggtaaagcct ttacacatca aaagagtctc caaatacata aaagaactca 540

cagtggagaa aaaccatatg ggtgtagtca gtgtggaaaa gactttgtaa gtcagagtcg 600

tcttctagaa cataaaagga cacatactgg agagaaaccc tatgaatgta accaatgtgg 660

taaagccttt gcatattcca acagtctcca aatacatcaa agaacacaca ctggagagaa 720

accctatgaa tgtaaccagt gtggtaaagc ctttgcatat cacaatagtc tccaaataca 780

taaaagtaca cacactggag agaaacccta taaatgtaac cagtgtggta aagcctttgc 840

atatcacatt actctccgaa cacataaagg aacacacact gaagagaaac cctatgaatg 900

taaccaatgt ggtaaagcct ttgcatattc caacagtctc caaatacatc aaagaacaca 960

cactggagag aaaccctatg aatgtaacca gtgtggtaaa gcctttgcat atcacaatag 1020

tctccaaata cataaaagta cacacactgg agagaaaccc tatgaatgta accagtgtgg 1080

taaagccttt gtatgtagca gtcattttca aaggcataaa aaaattcata ctggagagaa 1140

accctatgat tgtaaccagt gtggtaaagc ctttgcatat aaaagtaatc tccaaattca 1200

tgaaagaaaa cacactggag ggaaaccctc tgaatgtaat taatgtagta aagcttttgc 1260

atttcataat agtttccaaa tacataaaag aacacatagt gagagaaacc ctatgaatat 1320

aaccaatgtg gtaaaacatt tccatatctc agtggtctcc gcatttataa cagaacacat 1380

agtggagaga aaccctatgg atgtaa 1406

Claims (4)

1. A method for constructing a retinal pigment degeneration disease model by using a Gm20541 gene is characterized by comprising the following steps: knocking out the 3 rd exon sequence of the Gm20541 gene in the target animal retina precursor cell genome, wherein the target animal is a mouse.

2. The method according to claim 1, characterized in that it comprises: knocking out the 3 rd exon sequence on the Gm20541 gene by using a Cre-loxp gene knockout technology.

3. Use of the retinal pigment degeneration disease model obtained by the method according to any one of claims 1 to 2 for screening a medicament for preventing or treating retinal pigment degeneration disease.

4. The application according to claim 3, wherein the application comprises: administering a drug candidate to the retinal pigment degeneration disease model, indicating that the drug candidate may act as a drug for preventing or treating retinal pigment degeneration disease if the retinal pigment degeneration disease model undergoes at least one of the following changes before and after administration of the drug candidate:

(1) after administration of the drug candidate, the retinal pigment degeneration disease model has improved vision compared to before administration of the drug candidate;

(2) (ii) after administration of the drug candidate, the retinal outer nuclear layer of the retinal pigmented degenerative disease model is thickened compared to before administration of the drug candidate;

(3) after administration of the drug candidate, the retinal outer segment of the retinal pigmented degenerative disease model increases compared to before administration of the drug candidate.

Images