CN114916502B - Construction method and application of retinal pigment degeneration disease model - Google Patents
Construction method and application of retinal pigment degeneration disease model Download PDFInfo
- Publication number
- CN114916502B CN114916502B CN202210802107.2A CN202210802107A CN114916502B CN 114916502 B CN114916502 B CN 114916502B CN 202210802107 A CN202210802107 A CN 202210802107A CN 114916502 B CN114916502 B CN 114916502B
- Authority
- CN
- China
- Prior art keywords
- gene
- ythdc2
- pigment degeneration
- retinal pigment
- degeneration disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knockout animals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
- A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a construction method and application of a retinal pigment degeneration disease model, and relates to the technical field of medical engineering. It comprises the following steps: knocking out Ythdc2 gene sequences in the genome of the target non-human mammal retina rod cells to obtain a model of the retinal pigment degeneration disease. The disease model exhibits characteristics associated with retinal pigment degeneration disease. Such as rod cell death, is mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer retinal nuclear layer until disappearance, and corresponding pathological changes in the outer retinal network and other relevant cell layers. Therefore, the animals with the Ythdc2 gene knocked out in the retina rod cells can be used as a retina pigment degeneration disease model, can be used in the fields of retina pigment degeneration disease research and the like, and provides a new model for research of the disease such as pathogenesis, mechanism and screening of related preventive or therapeutic drugs.
Description
Technical Field
The invention relates to the technical field of medical engineering, in particular to a construction method and application of a retinal pigment degeneration disease model.
Background
Retinitis Pigmentosa (RP) is a progressive, inherited, dystrophic retinal degeneration. RP as a hereditary blinding fundus disease can be divided into two categories according to clinical phenotype: typical RP patients show a general impairment of rod cells, accounting for about 80% -90% of RP patients; but only accounts for 10-20% of atypical RP of RP patients, mainly vision cone cells are damaged. Typical RP patients develop night blindness and progressive visual field impairment, which develop tubular vision, at the earliest, due to defects in rod cell function, until blindness. In pathology, typical RP affects mainly rod cells, causing rod cell death and secondary cone cell death, manifested by photoreceptor cell damage, degeneration, progressive thinning of the outer nuclear layer of the retina until disappearance, with corresponding pathological changes in other related cell layers of the retina.
RP has incidence rate as high as 1/3500 in Chinese population. At present, diagnosis and treatment of RP still face a plurality of difficulties mainly due to high heterogeneity in clinical phenotype and genetics, and insufficient systematic research on the pathogenesis of RP, so that the specific molecular mechanism of RP is not clear, which brings great impediment to the clinical diagnosis and treatment of RP, and therefore, a new disease model is necessary to be developed, and detailed pathogenesis of RP is studied intensively. At present, a corresponding RP disease model is lacking.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a construction method and application of a retinal pigment degeneration disease model to solve the technical problems.
The invention is realized in the following way:
the invention provides a construction method of a retinal pigment degeneration disease model, which comprises the following steps: knocking out the Ythdc2 gene sequence in the genome of the retina rod cell of the non-human target mammal.
YTDDC 2 (YTDOMAInContaining 2, MGI: 2448561) located on mouse chromosome 18 at 44961521-45022787bp and having a total length of 61.26kb, and cDNA having a total length of 6299bp, comprising 30 exons.
YTDDC 2 acts as a reading protein for m6A methylation in RNA, recognizes the methylation site of RNA and performs further regulation, and is widely distributed in various tissue cells. m6A methylation is a dynamic reversible process, the formation process mainly comprises a methyltransferase complex (METTL 3, METTL14, WTAP and the like), the demethylation process is completed by demethylase (FTO and ALKBH 5), and reading proteins (YTHDF 1-3, YTHDC1/2, IGF2BP1-3 and the like) are mainly responsible for identifying methylation sites and performing dynamic regulation and are closely related to gene expression regulation. Second, m6A may be involved in biological processes such as mRNA transcription, selective cleavage, nuclear transport, translation, and degradation, resulting in RNA dysfunction, which in turn affects a range of animal vital activities. The current research on YTHDC2 protein functions is gradually increased, including influences on tumorigenesis, organism development and the like, but the detailed action mechanism and the biological functions thereof in retina are not clear, so that the development and application of the YTHDC2 protein are limited. Therefore, the intensive research on the treatment and etiology of the retinal pigment degeneration disease by YTHDC2 has great potential.
The inventor researches and discovers that the Ythdc2 gene in the visual rod cells of the target animal is knocked out, so that the target animal can show the characteristics related to the retinal pigment degeneration disease. Such as rod cell death, is mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer retinal nuclear layer until disappearance, and corresponding pathological changes in the outer retinal network and other relevant cell layers. Therefore, the animals with the Ythdc2 gene knocked out in the retina rod cells can be used as a retina pigment degeneration disease model, can be used in the fields of retina pigment degeneration disease research and the like, and provides a new model for research of the disease such as pathogenesis, mechanism and screening of related medicines.
The construction of the disease model is beneficial to providing a new target for the treatment or prevention of the retinal pigment degeneration disease.
The inventor researches out that: YTDDC 2 protein has important functions in retina, and can recognize mRNA methylation site to regulate gene expression, so as to influence retina function, directly or indirectly influence photoreceptor cell survival, and cause retinitis pigmentosa. However, the specific pathogenic molecular mechanism is not clear, and the research is worth further.
The sequences of the Ythdc2 gene in the above-described knocked-out retinal rod cell genome include, but are not limited to: full-length sequence and partial sequence of Ythdc2 gene. The sequence of the Ythdc2 gene is knocked out, and the invention belongs to the protection scope as long as the sequence can silence the expression of the Ythdc2 gene in the video rod cell and can enable the non-human target mammal to show the relevant characteristics of the retinal pigment degeneration disease. Such as rod cell death, is mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer retinal nuclear layer until disappearance, and corresponding pathological changes in the outer retinal network and other relevant cell layers.
In a preferred embodiment of the invention, the exon sequence of the Ythdc2 gene is knocked out from the genome of a human target mammalian retinal rod cell. Including, but not limited to, any one or more of the exon 1 to exon 30 of the Ythdc2 gene.
In a preferred embodiment of the invention, the exon 3 sequence of the Ythdc2 gene is knocked out; or knockout of exon 3 of the Ythdc2 gene, and knockout of at least one of exons 1 to 2 and exons 4 to 30.
The inventors found that, after knocking out the exon 3 sequence of the Ythdc2 gene, the non-human target mammal showed characteristics related to retinal pigment degeneration diseases, such as rod cell death, mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer nuclear layer of the retina until disappearance, and corresponding pathological changes of the outer retinal layer and other related cell layers.
In other embodiments, exon 3 and at least one other exon sequence of the Ythdc2 gene may be deleted simultaneously or separately to obtain a non-human target mammal having characteristics associated with a retinal pigment degeneration disease.
For example, the 3 rd and 4 th exons of the Ythdc2 gene are knocked out simultaneously, and the 3 rd and 2 nd exons of the Ythdc2 gene are knocked out simultaneously.
In a preferred embodiment of the invention, the knockout uses a gene editing technique selected from the group consisting of: at least one of CRISPR/Cas9 technology, artificial nuclease-mediated zinc finger nuclease technology (ZFN), transcription activator-like effector nuclease technology (transceription activator-like effector nucleases, TALEN), and Cre-loxp gene knockout technology.
In a preferred embodiment of the invention, the gene editing technique employed for knockout is selected from the group consisting of Cre-loxp gene knockout technique and CRISPR/Cas9 technique.
In a preferred embodiment of the present invention, the construction method includes:
mating and breeding the Ythdc2 gene Flox heterozygote non-human target mammal to obtain the Ythdc2 gene Flox homozygous non-human target mammal;
and then mating the Ythdc2 gene Flox homozygote non-human target mammal with the Rod-Cre gene transferred non-human target mammal to obtain the retina Rod cell knockout Ythdc2 gene non-human target mammal.
In a preferred embodiment of the invention, the non-human target mammal is selected from any one of mice, rats, horses, cattle, sheep, rabbits, dogs, pigs, monkeys, apes, and gorillas.
The target animal according to the present invention is not limited to the above-described animal. Any animal can be selected as long as the animal has the Ythdc2 gene, the animal can be used as a target animal in the construction method of the invention, the Ythdc2 gene is knocked out in a video rod cell of the animal to enable the animal to show the characteristics of the retinitis pigmentosa disease, and the animal can be used as a retinitis pigmentosa disease model and belongs to the protection scope of the invention in the field of retinitis pigmentosa disease research.
In a preferred embodiment of the invention, the non-human target mammal is selected from mice. For example, the Ythdc2 gene Flox mouse (C57 BL/6-Ythdc2em1 (Flox) Smoc, available from Shanghai southwest model Biotech Co., ltd.) with loxP site inserted upstream and downstream of exon 3 of the Ythdc2 gene; the obtained Ythdc2 gene Flox heterozygote mice were bred by mating with each other to obtain Ythdc2 gene Flox homozygous mice (Ythdc 2) flox/flox ) The method comprises the steps of carrying out a first treatment on the surface of the Then, the obtained Ythdc2 gene Flox homozygote mice were combined with Rod-Cre gene-transferred mice (B6. Cg-Pde6b + Tg (Rho-ice) 1Ck/Boc, purchased from Jackson laboratories, USA, MGI: 4417915) mate, rod drives Cre gene to specifically express in retinal Rod cells, so as to obtain mice with the Ythdc2 gene knocked out by retinal Rod cells, and after identification, the mice with correct identification result are used as retinal pigment degeneration disease models.
The application of the retinal pigment degeneration disease model constructed by the construction method of the retinal pigment degeneration disease model in screening medicines for preventing or treating retinal pigment degeneration diseases.
The vision of the model of the retinitis pigmentosa disease is improved after administration of the candidate drug compared to prior to administration of the candidate drug; the candidate drug is indicated as a drug for preventing or treating a retinal pigment degeneration disease.
If the drug candidate is administered, the extraretinal nucleus layer thickness is thicker or has a tendency to thicken compared to before administration of the drug candidate; the candidate drug is indicated as a drug for preventing or treating a retinal pigment degeneration disease.
If the epiretinal node increases after administration of the candidate drug, the degradation characterizes weakening or disappearance as compared to prior to administration of the candidate drug; the candidate drug is indicated as a drug for preventing or treating a retinal pigment degeneration disease.
The application of the retinal pigment degeneration disease model constructed by the construction method of the retinal pigment degeneration disease model in the research of the retinal pigment degeneration disease is aimed at diagnosis or treatment of non-diseases.
The disease model obtained by the construction method has typical characteristics of the retinal pigment degeneration disease, has very wide application prospect, and for example, the disease model is used for researching the pathogenesis of the retinal pigment degeneration disease, thereby providing a foundation for deep understanding of the research of the retinal pigment degeneration disease. Or it can be used for screening drugs for preventing or treating retinal pigment-modified diseases, evaluating the efficacy or prognosis of drugs, etc.
The invention has the following beneficial effects:
the inventors found that: the Ythdc2 gene in the target animal visual rod cell is knocked out, so that the target animal can show the characteristics related to the retinal pigment degeneration disease. Such as rod cell death, is mainly manifested by photoreceptor damage, degeneration, progressive thinning of the outer retinal nuclear layer until disappearance, and corresponding pathological changes in the outer retinal network and other relevant cell layers. Therefore, the animals with the Ythdc2 gene knocked out in the retina rod cells can be used as a retina pigment degeneration disease model, can be used in the fields of retina pigment degeneration disease research and the like, and provides a new model for research of the disease such as pathogenesis, mechanism and screening of related medicines.
The construction of the disease model is beneficial to providing a new target for the treatment or prevention of the retinal pigment degeneration disease.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows a mouse (Ythdc 2) with a specific knockout of Ythdc2 gene from Rod cells (Rod) of retina RKO ) Is selected from the construction and identification result diagram of the same nest Ythdc2 flox/flox The mice were control mice (Ythdc 2) f/f ) The method comprises the steps of carrying out a first treatment on the surface of the A: a construction strategy of Ythdc2 gene knockout mice, wherein the construction strategy comprises the steps of (A) determining the genotype identification result of the Ythdc2 gene knockout mice;
FIG. 2 is a graph showing the results of Ythdc2 gene knockout efficiency test;
FIG. 3 is a diagram of Electroretinogram (ERG) test results;
FIG. 4 is a graph showing the results of immunohistochemical staining of retinal sections from mice with specific knocked-out Ythdc2 gene on rods of the retina;
FIG. 5 is a graph showing IHC staining results of mice with Ythdc2 gene knocked out by retinal rod cells (inner and outer rod segments, DAPI counterstained nuclei were labeled with NaK and Rhodopsin antibodies, respectively);
fig. 6 is a graph showing IHC staining results of mice with specific knockdown of the Ythdc2 gene from rods of retinal visual column (labeling muller glia cells in the retina with GFAP antibody, DAPI counterstaining nuclei).
Detailed Description
Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.
Unless otherwise indicated, practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of a person skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); animal cell culture (Animal Cell Culture) (r.i. freshney, 1987); methods of enzymology (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M.Weir and C.C.Blackwell, inc.), gene transfer vectors for mammalian cells (Gene Transfer Vectors for Mammalian Cells) (J.M.Miller and M.P.calos, inc., 1987), methods of contemporary molecular biology (Current Protocols in Molecular Biology) (F.M.Ausubel et al, inc., 1987), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction, inc., 1994), and methods of contemporary immunology (Current Protocols in Immunology) (J.E.Coligan et al, 1991), each of which is expressly incorporated herein by reference.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
In this example, a mouse was used as a target animal, and the method for constructing a model of retinitis pigmentosa disease according to the present invention was described, and the path of the Ythdc2 gene knockout was shown in FIG. 1A.
Ythdc2 Gene Flox mice (C57 BL/6-Ythdc2em1 (Flox) Smoc) were purchased from Shanghai, nannon model Biotech Co. The 3 rd exon of the mouse Ythdc2 gene was inserted with loxP site at the upstream and downstream.
The obtained Ythdc2 gene Flox heterozygote mice were bred by mating with each other to obtain Ythdc2 gene Flox homozygous mice (Ythdc 2) flox/flox ) The method comprises the steps of carrying out a first treatment on the surface of the Then, the obtained Ythdc2 gene Flox homozygote mice were combined with Rod-Cre gene-transferred mice (B6. Cg-Pde6b + Tg (Rho-ice) 1Ck/Boc, available from Jackson laboratories, USA, MGI: 4417915) mate, and Rod drives specific expression of Cre gene in retinal Rod cells to obtain a retinal Rod cell knockout Ythdc2 gene mouse (Ythdc 2) RKO )。
Example 2
Offspring mice involved in the process of constructing the model of retinal pigment degeneration disease of example 1 were genotyped as follows:
1) Cutting a small amount of tissue samples from the tail tips of the mice, and placing the small tissue samples into a clean 1.5ml centrifuge tube;
2) 100 μl of lysate (40mM NaOH,0.2mM EDTA solution) was added to the centrifuge tube and heated at 100deg.C in the metal bath for 1h;
3) After taking out the centrifuge tube and cooling to room temperature, 100. Mu.l of a neutralization solution (40 mM Tris-HCl, pH 5.5) was added, 10000g was centrifuged for 2min, and the supernatant was used for genotyping of mice.
4) And (3) PCR amplification: the PCR reaction system was configured as follows
2×Taq Mix 10μL
Tail tissue lysate 4. Mu.L
Primer 1 (Ythdc 2-loxP-Forward or Rod-Cre-F), 1. Mu.L (concentration: 10 mM)
Primer 2 (Ythdc 2-loxP-Reverse or Rod-Cre-R), 1. Mu.L (concentration: 10 mM)
ddH 2 O 4μL。
The primer sequences were as follows:
ythdc2-loxP-Forward sequence:
5’-GAACAGCCAGCCATCACC-3’；
ythdc2-loxP-Reverse sequence:
5’-AAAAATAGAGCAGTCCAAAGAGTA-3’；
Rod-Cre-F：TCAGTGCCTGGAGTTGCGCTGTGG；
Rod-Cre-R：CTTAAAGGCCAGGGCCTGCTTGGC。
amplification procedure:
after the PCR reaction system is prepared, the template DNA is fully denatured by preheating for 5 minutes at 95 ℃ on a PCR instrument, and then the amplification cycle is carried out. In each cycle, the template is denatured prior to maintaining at 95 ℃ for 30 seconds, then the temperature is reduced to the renaturation temperature of 60 ℃ for 30 seconds, and the primer and the template are fully annealed; the reaction was kept at 72℃for 45 seconds, and primers were allowed to extend on the template to synthesize DNA, thereby completing one cycle. This cycle was repeated 25 times to accumulate a large amount of amplified DNA fragments. Finally, the product was left to extend intact at 72℃for 5 minutes and stored at 4 ℃.
5) Gel electrophoresis
1g of agarose was weighed and placed in 100ml of TAE buffer, and melted in a microwave oven to prepare 1% agarose gel. 10ul of the PCR product was taken in the wells and subjected to 120V constant pressure agarose electrophoresis for 15min. Imaging was performed with a gel imaging system.
FIG. 1B shows the electrophoresis results, and FIG. 1B shows the upper panel of the case where the wild-type control mice (Ythdc 2 +/+ ) Heterozygote mouse (Ythdc 2) flox/+ The method comprises the steps of carrying out a first treatment on the surface of the Rho-Cre) and homozygote mice (Ythdc 2) flox / flox The method comprises the steps of carrying out a first treatment on the surface of the Rod-Cre) for PCR amplification detection. The lower panel of FIG. 1B shows the results of the amplification of wild-type control mice (Ythdc 2 using the upstream and downstream primers of Rod-Cre, respectively +/+ ) Heterozygote mouse (Ythdc 2) flox/+ The method comprises the steps of carrying out a first treatment on the surface of the Rho-Cre) and homozygote mice (Ythdc 2) flox / flox The method comprises the steps of carrying out a first treatment on the surface of the Rod-Cre) for PCR amplification detection.
WT represents a wild-type control with a band size of 244bp; het represents a heterozygote with two bands of 244bp and 278bp; KO represents homozygote and the band size is 278bp.
From the results of fig. 1B, it was shown that the identification method employed can effectively identify the genotype of the newborn mice for subsequent study.
Example 3
In this example, the knockout efficiency of genes in the retina of the Rod-Cre knockout mouse was analyzed by immunoblotting (Western blot) experiment.
The analysis method is as follows:
1) Obtaining control mice Ythdc2 respectively f/f And knockout mouse Ythdc2 RKO After sufficient grinding, 200. Mu.l of protein lysate RIPA was added.
2) After sonicating the cells, they were lysed on ice for 20min.
3) After centrifugation at 16000g for 10min at 4℃the supernatant was transferred to another clean centrifuge tube, 50. Mu.l of protein loading solution was added and mixed well and heated at 95℃for 5min.
4) After the sample was cooled, 20. Mu.l of each sample was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) at 160V to separate proteins.
5) After SDS-PAGE is finished, cutting a nitrocellulose membrane with proper size according to the requirement, paving filter paper, glue, the nitrocellulose membrane and the filter paper in sequence, removing bubbles, putting the membrane transferring groove into an ice-water bath, and transferring the membrane by adopting a constant current of 0.28A for 2 hours.
6) After the transfer of the film is finished, the nitrocellulose film is washed once by pure water, dried and marked. Then blocked with 8% skim milk for 2h.
7) After blocking was completed, a certain amount of primary antibody diluted in blocking solution in a certain proportion (according to the instructions for antibody use) was added and incubated overnight at 4 ℃.
8) The primary antibody was recovered, washed with 1 XTBE buffer 4 times for 10min each, and appropriate secondary antibody was selected depending on the source of primary antibody, and horseradish peroxidase (HRP) -labeled secondary antibody was diluted with 1 XTBE and incubated on a shaker at room temperature for 2h.
9) After the secondary antibody incubation was completed, the membrane was washed 3 times with 1 XTBST for 10min each, and the protein was detected with Thermo ELC luminescence kit using a Bio-Rad chemiluminescent gel imaging system.
The results are shown in FIG. 2. Western blot experiment analysis of gene knockout efficiency in Ythdc2 knockout mouse retina, and statistical result shows that Ythdc2 is not expressed in knockout mouse retina rod cell any more in 2 months of age of mouse, indicating that Ythdc2 is knocked out.
Example 4
This example shows a Ythdc2 gene knock at 9 months of ageExcept mouse Ythdc2 RKO Performing ERG vision test:
1) Dark adaptation animals should adapt overnight, and the environment should be absolutely clear;
2) The next day of anesthesia: weighing and injecting into abdominal cavity; deep anesthesia is preferred;
3) Animal fixation and mydriasis: after anesthesia was completed, mice were fixed with tape in front of animal test platform under dark red light: the mice are required to be ensured to lie on the ground, namely, the eyes are consistent in height relative to the stimulation port of the flash stimulator, and are fully exposed, and mydriatic agent is dripped.
4) Electrode installation: preheating a retinogram instrument (Espion Visual Electrophysiology System, diagnosyllc, lt-tleton, MA, USA), coating conductive paste on the electrode, clamping the tail of a mouse, and inserting the mouse into an amplifier ground interface; the double-ended needle electrode is inserted into the back cervical skin (approximately in the middle of two ears) and is simultaneously connected with the negative interfaces of the two channels; the gold ring electrode was clamped on the electrode holder of the animal experiment platform, the angle was carefully adjusted, and the center tip of the cornea was slightly contacted. One channel positive electrode is connected with the right eye, and the two channel positive electrodes are connected with the left eye. The contact effect of the gold ring electrode and cornea is improved by dropping normal saline to eyes through the needle tube. The two gold ring electrodes are ensured to contact the same position of the center positive end of the cornea of two eyes at the same angle and in the same mode.
5) And closing the dark red light after the record oscillographic signal confirms no error. It can be tried to record the dark adaptation light intensity of 0.003 cd/s.m 2 And (2) confirming the quality of the following signal: if the amplitude of the eyes is greatly different from that expected, it is recommended to check the mounting position of the gold ring electrode again. Then sequentially recording dark adaptation light intensity of 3.0/10.0 cd/s.m 2 After recording the system will automatically turn on the backlight.
6) Continuously recording the light adaptation light intensity of 3.0 cd/s.m 2 Is a signal of (a).
Results referring to FIG. 3, A, B, ythdc2 wild type and Ythdc2 knockout mice in dark adaptation electroretinogram waveforms at different light intensities; c: dark adaptation 3.0 and 10.0 and light adaptation 10.0 a-wave and b-wave statistics, C in fig. 3 indicates a significant drop in knockout mouse rod cell function; d, E, photo-adapting to the electroretinogram waveforms of Ythdc2 wild type and Ythdc2 gene knockout mice under 3.0; f: light adaptation 3.0 a-wave, b-wave and Flicker amplitude statistics, F in fig. 3 shows that knockdown mice had slightly decreased cone cell function, but the a-b-wave amplitude differences were statistically not significant (P < 0.05).
The results of this example show that at 9 months, both a-wave and b-wave of the knockout mice are significantly reduced under dark adaptation conditions compared to wild mice, indicating that Ythdc2 results in impaired vision after rod cell knockout.
Example 5
The retinas were paraffin sectioned and H & E stained in this example. Retinas of 9 month old mice were stained by paraffin section, hematoxylin-eosin staining (H & E staining method) as follows:
1) Quickly taking eyeball tissues of a mouse, and placing the eyeball tissues in a fixing solution for fixing for 24 hours;
2) Embedding paraffin, slicing with thickness of 4 μm;
3) Slices were conventionally dewaxed with xylene, washed with multi-stage ethanol to water: xylene (I) 5 min- & gt xylene (II) 5 min- & gt 100% ethanol 2 min- & gt 95% ethanol 1 min- & gt 80% ethanol 1 min- & gt 75% ethanol 1 min- & gt distilled water washing 2min;
4) Hematoxylin staining for 5 minutes, washing with tap water;
5) Ethanol hydrochloride differentiation for 30 seconds;
6) Soaking in tap water for 15 minutes;
7) And (5) placing eosin solution for 2 minutes.
8) Conventional dehydration, transparency and sealing sheet: 95% ethanol (I) 1min, 95% ethanol (II) 1min, 100% ethanol (I) 1min, 100% ethanol (II) 1min, xylenol carbonic acid (3:1) 1min, xylene (I) 1min, xylene (II) 1min, and neutral resin sealing.
9) And photographing under a microscope.
As a result, it was found that at 9 months, compared with Ythdc2 f/f (control) mice, ythdc2 RKO The extraretinal nuclear layer thickness of (knocked out) mice was significantly thinner, indicating photoreceptor cell death (fig. 4).
Fig. 4 a: the retinal rod cells were specifically knocked out by Ythdc2 gene mice and stained for H & E in retinal paraffin sections, with thinning of the Outer Nuclear Layer (ONL) and Inner Nuclear Layer (INL).
B in fig. 4: outer nuclear layer thickness statistics for different distances of the Ythdc2 knockout mouse retina from the Optic Nerve (ON).
Example 6
The retinas were cryo-sectioned and immunostained in this example: after the retina rod cells constructed in the example 1 with the age of 9 months are taken to specifically knock out the broken neck of the Ythdc2 gene mouse and are killed, the eyeballs are quickly taken and put into 4% PFA, the eyeballs are fixed on ice for 15min, then the eyeballs are cut on the cornea, and then the fixation on ice is continued. After 2h, PBS buffer was washed 3 times, then the eyeball was dehydrated in 30% sucrose solution for 2h, then the cornea and crystals were cut off under a dissecting scope, OCT was embedded and rapidly frozen in a refrigerator at-80 ℃. After about 10min, the OCT embedded eyeball is taken out, and the eyeball is placed in a frozen microtome for balancing at the temperature of minus 25 ℃ for about 30min, and then the eyeball can be sectioned. The slice thickness was 12. Mu.m.
After slicing, the higher quality pieces were selected and placed in an oven at 37 ℃ for 30min, then the immunohistochemical pen was circled around the retinal tissue, washed three times with PBS to remove OCT, then 5% NDS (containing 0.25% triton) were blocked through for 2h, primary antibodies (NaK and Rhodopsin antibodies) were incubated overnight at 4 ℃. The following day, after three times of PBS washing, the corresponding fluorescent secondary antibodies are incubated, and then three times of PBS washing are carried out, and the plates are sealed and observed.
The results are shown in FIG. 5. At 9 months of age, the inner and outer antibodies Nak and Rhodopsin were stained by frozen tissue sections of the retina, as compared to Ythdc2 f/f (control) mice, ythdc2 RKO The outer segments of the retinas of (knockdown) mice were significantly shortened and a significant degeneration characterization occurred.
Example 7
Immunostaining of frozen sections of retina: after the retina rod cells constructed in the example 1 with the age of 9 months are taken to specifically knock out the broken neck of the Ythdc2 gene mouse and are killed, the eyeballs are quickly taken and put into 4% PFA, the eyeballs are fixed on ice for 15min, then the eyeballs are cut on the cornea, and then the fixation on ice is continued. After 2h, PBS buffer was washed 3 times, then the eyeball was dehydrated in 30% sucrose solution for 2h, then the cornea and crystals were cut off under a dissecting scope, OCT was embedded and rapidly frozen in a refrigerator at-80 ℃. After about 10min, the OCT embedded eyeball is taken out, and the eyeball is placed in a frozen microtome for balancing at the temperature of minus 25 ℃ for about 30min, and then the eyeball can be sectioned. The slice thickness was 12. Mu.m.
After slicing, higher quality pieces were selected and placed in an oven at 37 ℃ for 30min, then an immunohistochemical pen was circled around the retinal tissue, washed three times with PBS to remove OCT, then 5% NDS (containing 0.25% triton) was blocked for 2h, primary antibody (GFAP antibody) was incubated, and overnight at 4 ℃. The following day, after three times of PBS washing, the corresponding fluorescent secondary antibodies are incubated, and then three times of PBS washing are carried out, and the plates are sealed and observed.
The results are shown in FIG. 6. At 9 months of age, after the muller glia cell marker GFAP is frozen and tissue-sectioned through the retina, compared with a wild type mouse, the retina of the knockout mouse has obvious gliosis, and the inflammatory response is enhanced, so that the retinal injury is shown. I.e., the constructed animal model exhibits characteristics of a retinal pigment-modified disease.
In summary, it can be seen that, in the embodiment of the invention, by taking a mouse as an example, the Ythdc2 gene is specifically knocked out in the retina rod cells by using a CRISPER/Cas9 knocking-out technology, so that the mouse shows typical characterization of the retinal pigment degeneration diseases such as visual impairment, shortening and degradation of the outer segments of the retina cells, loss of the retina cells and the like. Thus, it was fully demonstrated that conditional knockdown of the Ythdc2 gene in the rod cells of the retina can cause the target animal to exhibit a retinitis pigmentosa disease. Animals with the Ythdc2 gene conditionally knocked out by the retina rod cells can be used as a model of the retinal pigment degeneration disease. The disease model can be used in the fields of research of retinal pigment degeneration diseases and the like, and provides a new model for research of the diseases such as pathogenesis, mechanism and screening of related medicines.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (8)
1. A method for constructing a model of a retinal pigment degeneration disease, comprising: knocking out the 3 rd exon sequence of Ythdc2 gene in the genome of the target mammal retina rod cell; or knockout of exon 3 of the Ythdc2 gene, and knockout of at least one of exons 1 to 2 and exons 4 to 30.
2. The method of claim 1, wherein the knockout employs a gene editing technique selected from the group consisting of: at least one of CRISPR/Cas9 technology, ZFN technology, TALEN technology, and Cre-loxp gene knockout technology.
3. The method of claim 2, wherein the knockout employs a gene editing technique selected from the group consisting of Cre-loxp gene knockout technique and CRISPR/Cas9 technique.
4. The construction method according to claim 2, characterized in that the construction method comprises:
mating and breeding the Ythdc2 gene Flox heterozygote non-human target mammal to obtain the Ythdc2 gene Flox homozygous non-human target mammal;
and then mating the Ythdc2 gene Flox homozygote non-human target mammal with the Rod-Cre gene transferred non-human target mammal to obtain the non-human target mammal with the Ythdc2 gene knocked out by the retina Rod cells.
5. The method of claim 1-4, wherein the non-human target mammal is selected from the group consisting of mice, rats, horses, cattle, sheep, rabbits, dogs, pigs, monkeys, apes, and chimpanzees.
6. The method of claim 1 to 4, wherein the non-human target mammal is selected from mice.
7. Use of a model of a retinal pigment degeneration disease constructed by the method of constructing a model of a retinal pigment degeneration disease according to any one of claims 1 to 6 for screening a drug for preventing or treating a retinal pigment degeneration disease.
8. Use of a model of a retinal pigment degeneration disease constructed by the method of constructing a model of a retinal pigment degeneration disease according to any one of claims 1 to 6 in a study of a retinal pigment degeneration disease, said study being aimed at diagnosis or treatment of a non-disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210802107.2A CN114916502B (en) | 2022-07-07 | 2022-07-07 | Construction method and application of retinal pigment degeneration disease model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210802107.2A CN114916502B (en) | 2022-07-07 | 2022-07-07 | Construction method and application of retinal pigment degeneration disease model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114916502A CN114916502A (en) | 2022-08-19 |
| CN114916502B true CN114916502B (en) | 2023-06-16 |
Family
ID=82815880
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210802107.2A Active CN114916502B (en) | 2022-07-07 | 2022-07-07 | Construction method and application of retinal pigment degeneration disease model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114916502B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116738352B (en) * | 2023-08-14 | 2023-12-22 | 武汉大学人民医院（湖北省人民医院） | Method and device for classifying abnormal rod cells of retinal vascular occlusion disease |
| CN117230077B (en) * | 2023-11-13 | 2024-02-23 | 四川省医学科学院·四川省人民医院 | Application of Hakai gene in RP disease model construction and construction method |
| CN117296799B (en) * | 2023-11-28 | 2024-02-02 | 四川省医学科学院·四川省人民医院 | Construction method and application of retinal pigment degeneration disease model |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002000826A2 (en) * | 2000-06-12 | 2002-01-03 | Biowindow Gene Development Inc. Shanghai | A novel polypeptide, a human dna methylation protein and the polynucleotide encoding the polypeptide |
| WO2016095037A1 (en) * | 2014-12-17 | 2016-06-23 | Blencowe Benjamin J | Modulation and detection of a neuronal alternative splicing regulatory network for treatment and diagnosis of neurological disorders |
| WO2019071054A1 (en) * | 2017-10-04 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| WO2019079360A1 (en) * | 2017-10-16 | 2019-04-25 | Massachusetts Institute Of Technology | Cell atlas of healthy and diseased tissues |
| WO2019213276A1 (en) * | 2018-05-02 | 2019-11-07 | Novartis Ag | Regulators of human pluripotent stem cells and uses thereof |
| CN113785058A (en) * | 2019-03-04 | 2021-12-10 | 得克萨斯A&M大学系统 | Methods of making and using amber-specific phage display libraries |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140242093A1 (en) * | 2011-07-29 | 2014-08-28 | Fred Hutchinson Cancer Research Center | Methods and compositions for modulating the innate immune response and/or myogenesis in a mammalian subject |
| EP3452101A2 (en) * | 2016-05-04 | 2019-03-13 | CureVac AG | Rna encoding a therapeutic protein |
| WO2018204764A1 (en) * | 2017-05-05 | 2018-11-08 | Camp4 Therapeutics Corporation | Identification and targeted modulation of gene signaling networks |
| BR112019028280A2 (en) * | 2017-07-04 | 2020-07-14 | Curevac Ag | nucleic acid molecules |
| EP3701042A4 (en) * | 2017-10-23 | 2021-08-11 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| CN108029638B (en) * | 2017-12-04 | 2020-04-21 | 四川省人民医院 | Construction method and application of animal model of retinitis pigmentosa disease |
| US11680109B2 (en) * | 2019-05-29 | 2023-06-20 | Duke University | Compositions and methods for detection and measurement of RNA modifications through targeted RNA editing |
| CN111269945B (en) * | 2020-02-25 | 2021-04-02 | 四川省人民医院 | Method for constructing retinal pigment degeneration disease model by using Gm20541 gene and application |
| CN111500640B (en) * | 2020-04-17 | 2021-09-10 | 四川省人民医院 | Construction method and cultivation method of RP disease model |
| CN112715484B (en) * | 2020-12-29 | 2022-04-22 | 四川省人民医院 | Method for constructing retinal pigment degeneration disease model, application and breeding method |
| CN113621649B (en) * | 2021-09-14 | 2023-05-26 | 商丘市第一人民医院 | Construction method and application of retinal pigment degeneration disease model |
| CN113957074B (en) * | 2021-10-25 | 2023-08-04 | 电子科技大学 | Construction method and application of cerebellar ataxia disease model |
| CN114561408B (en) * | 2022-01-24 | 2023-04-21 | 四川省医学科学院·四川省人民医院 | Construction method and application of retinal pigment degeneration disease model |
-
2022
- 2022-07-07 CN CN202210802107.2A patent/CN114916502B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002000826A2 (en) * | 2000-06-12 | 2002-01-03 | Biowindow Gene Development Inc. Shanghai | A novel polypeptide, a human dna methylation protein and the polynucleotide encoding the polypeptide |
| WO2016095037A1 (en) * | 2014-12-17 | 2016-06-23 | Blencowe Benjamin J | Modulation and detection of a neuronal alternative splicing regulatory network for treatment and diagnosis of neurological disorders |
| WO2019071054A1 (en) * | 2017-10-04 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| WO2019079360A1 (en) * | 2017-10-16 | 2019-04-25 | Massachusetts Institute Of Technology | Cell atlas of healthy and diseased tissues |
| WO2019213276A1 (en) * | 2018-05-02 | 2019-11-07 | Novartis Ag | Regulators of human pluripotent stem cells and uses thereof |
| CN113785058A (en) * | 2019-03-04 | 2021-12-10 | 得克萨斯A&M大学系统 | Methods of making and using amber-specific phage display libraries |
Non-Patent Citations (2)
| Title |
|---|
| m6A修饰调控的LDB2抑制肺腺癌细胞增殖;翟东凤等;《南方医科大学学报》;第41卷(第3期);329-335 * |
| 蛋白修饰与炎症性肠病;赵娜;黄彪;吴巧凤;唐勇;余曙光;;世界华人消化杂志(第17期);12-18 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114916502A (en) | 2022-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114916502B (en) | Construction method and application of retinal pigment degeneration disease model | |
| CN113621649B (en) | Construction method and application of retinal pigment degeneration disease model | |
| CN114561408B (en) | Construction method and application of retinal pigment degeneration disease model | |
| CN112715484B (en) | Method for constructing retinal pigment degeneration disease model, application and breeding method | |
| Rachel et al. | Combining Cep290 and Mkks ciliopathy alleles in mice rescues sensory defects and restores ciliogenesis | |
| CN115176760B (en) | Method for constructing retinal pigment degeneration disease model, application and breeding method | |
| US8173861B2 (en) | Transgenic pig model for a hereditary neurodegenerative autosomal dominant disease | |
| CN111269945B (en) | Method for constructing retinal pigment degeneration disease model by using Gm20541 gene and application | |
| CN109182355B (en) | The construction method of retinal neovascularization disease model and application | |
| CN111500640B (en) | Construction method and cultivation method of RP disease model | |
| WO2019080667A1 (en) | Method for constructing ataxia animal model and application thereof | |
| CN111778281B (en) | Construction method and application of retina bipolar cytopathy model | |
| CN108315350B (en) | COX5A overexpression/BDNF low expression transgenic mouse model and construction method and application thereof | |
| CN108396036B (en) | Over-expression COX5A transgenic mouse model and construction method and application thereof | |
| CN117296799B (en) | Construction method and application of retinal pigment degeneration disease model | |
| CN117230077B (en) | Application of Hakai gene in RP disease model construction and construction method | |
| Bao et al. | Human RGR gene and associated features of age-related macular degeneration in models of retina-choriocapillaris atrophy | |
| Pandey et al. | Advances in Genetic Diagnosis and Treatment of Hearing Loss—A Thirst for Revolution | |
| CN117305364A (en) | Method for constructing retina degeneration disease model by using gene manipulation technology and application | |
| CN114255823A (en) | Construction method and application of retinal degenerative disease model | |
| CN117025673A (en) | Construction method and application of retina degeneration disease model | |
| Nonarath et al. | The USH3A causative gene clarin1 functions in Muller glia to maintain retinal photoreceptors | |
| Ghaseminejad Tafres | Development of novel models and CRISPR-based gene editing therapeutics for retinal degeneration in Xenopus laevis | |
| Ulrich et al. | 199--Chaf1b Protein in gef Mutant Zebrafish | |
| Krueger | Investigating the Role of Chd7 and Sox11 in Retinal Cell Development and the Ocular Complications of CHARGE Syndrome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |