CN117143914A

CN117143914A - Efficient cell line gene knockout method

Info

Publication number: CN117143914A
Application number: CN202310785079.2A
Authority: CN
Inventors: 黄秋凤; 郑虹; 郑丹丹; 何英幸
Original assignee: Guangzhou Yuanjing Biotechnology Co ltd
Current assignee: Guangzhou Yuanjing Biotechnology Co ltd
Priority date: 2023-06-29
Filing date: 2023-06-29
Publication date: 2023-12-01

Abstract

The invention discloses a high-efficiency cell line gene knockout method, and relates to the technical field of genetic engineering. The efficient cell line gene knockout method comprises the following steps: vector construction, plasmid preparation, cell transfection, drug screening, pool gene editing efficiency detection, preparation of monoclonal and monoclonal genotype identification. According to the invention, through optimizing the vector skeleton and optimizing each step, the fragment knockout efficiency can be obviously improved, the gene knockout period can be shortened, meanwhile, the positive clone primary screening is carried out through PCR gel electrophoresis in the genotype identification, the sequencing cost and the effort for reading the sequencing result are reduced, and the problems of lower gene knockout efficiency, long period, high sequencing cost and time and labor waste for sequencing result in the process of cell line gene knockout in the prior art are solved.

Description

Efficient cell line gene knockout method

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a high-efficiency cell line gene knockout method.

Background

The CRISPR/Cas9 gene editing technology is a third generation gene editing technology, has the advantages of high editing efficiency, simple operation and low cost, and is the most mainstream gene editing system at present. At present, the application scale of the technology in the model animal field is very huge, the construction process is basically standardized and normalized, and the success rate of the project is also higher. The reason why the CRISPR/Cas9 gene editing technology has high success rate in the field of model animals is mainly that: on one hand, the model animals have few species, the operation flow is basically consistent, and the inbred strains (such as C57BL/6 and BALB/C) are basically used, so that the genetic background is highly consistent, and the gene editing difficulty is relatively low; on the other hand, when the model animal is used as an independent individual, the model animal can be subjected to gene knockout without one step, namely, homozygote can be obtained without one-time editing, and the homozygote can be screened by only obtaining heterozygote F0 with a knockout genotype and crossing with the WT (wild type) and then selfing.

Compared with the field of model animals, the cell line gene knockout is much more complicated, hundreds of common cell lines have large difference of different cell line characteristics, and the optimal experimental method and accumulation parameters need to be searched, wherein the monoclonal formation capability and the preparation method are particularly important, and are the technical bottlenecks of the cell gene knockout; in addition, the karyotype of the cells is also a key factor influencing the success rate, the cell line cannot be obtained as a mouse for heterozygosis and then mating, and the cells must be screened for homozygosity at one time, so that if the karyotype of the cells is complex (such as supertriploid), the difficulty of obtaining homozygosity by gene editing is greater.

The prior art has the following problems when carrying out gene knockout of cell lines:

(1) The gene knockout efficiency is low, and hundreds of monoclonal antibodies are usually required to be cultured and identified so as to screen homozygotes;

(2) Genotyping can be performed too late because the current methods require a large number of cells for genome extraction, resulting in monoclonal cells that need to be passaged from 96-well to 48/24-well and then to 6-well, and sufficient cells can be obtained, resulting in long cycle times, low efficiency and high workload.

(3) The genotyping strategy has limitation, the base transformation of the frame-shifted DNA (usually less than 10 bp) needs to be carried out through sequencing, the sample size is large, the sequencing cost is high, and the sequencing result is time-consuming and labor-consuming.

Disclosure of Invention

Aiming at the problems of the prior art, the invention aims to provide a high-efficiency cell line gene knockout method which has the effects of high gene knockout efficiency, short period, low sequencing cost and simple sequencing result reading, and solves the problems of low gene knockout efficiency, long period, high sequencing cost and time and labor waste in sequencing result reading in the prior art when the cell line gene knockout is carried out.

To achieve the purpose, the invention adopts the following technical scheme:

a high efficiency cell line gene knockout method comprising the steps of:

(1) Vector construction and plasmid preparation: the method comprises the steps of vector construction and plasmid preparation, namely sequentially comprising eight steps of gRNA primer synthesis, PCR amplification, skeleton linearization, vector splicing reaction, heat shock conversion, colony PCR identification and sequencing identification, plasmid extraction and sequencing and plasmid big lifting, so as to prepare knockout plasmid; the knockout plasmid adopts YKO-RP003 as a vector skeleton, and deletes the vector skeleton as shown in SEQ ID NO:1, a sequence shown in seq id no; an insert sequence is added between the CMV promoter and the tag of the vector backbone, which insert sequence is: tctgtttaactaga; filling the double gRNAs in the same vector skeleton to obtain knockout plasmids;

(2) Cell transfection and drug screening: delivering the knocked-out plasmid into a cell to be knocked out for transfection, and screening the drug after the transfection is completed;

(3) pool gene editing efficiency detection: lysing the pool cells collected in the step (2) by using a monoclonal identification kit, performing PCR (polymerase chain reaction) amplification and sequencing on the lysate, and analyzing a sequencing result by using a red cotton genotype analysis system to obtain a pool cell cutting efficiency value, genotypes contained in the pool cells and the proportion of each genotype;

(4) Preparation of monoclonal: preparing single-cell suspension from the cells after the medicine screen, inoculating the single-cell suspension into a multi-pore plate, adding a culture solution, and placing the cells into an incubator for static culture; observation is performed during the culture, and wells containing the monoclonal are labeled and counted as well as the monoclonal that survived successfully;

(5) Identification of monoclonal genotypes: and (3) splitting the monoclonal obtained in the step (4) by using a monoclonal identification kit, performing PCR amplification on the splitting product, performing electrophoresis detection on the amplification product, performing primary screening according to an electrophoresis strip, sequencing the clones positive to the primary screening, analyzing the sequencing result by a red cotton genotype analysis system, and judging whether the genotype accords with the knockout standard.

Furthermore, the efficient cell line gene knockout method further comprises a project difficulty assessment step before the vector construction and plasmid preparation in the step (1), wherein the project difficulty assessment step comprises gene assessment (the gene assessment comprises gene lethality assessment and gene expression level assessment), gene targeting scheme design, and cell pre-experiment and difficulty assessment.

Further, combining a red cotton gene risk assessment system and an expression level assessment system, determining whether the gene to be knocked out has a lethal risk and an expression condition in a target cell line, and if the assessment is passed, normally performing scheme design;

the method for designing the gene targeting scheme comprises the following steps: designing a knockout scheme in a red cotton crispr gene editing system, and screening gRNA with a knockout fragment size of 50-500 bp;

the cell pre-experiment and the difficulty evaluation are that the multiplication time, the passage proportion, the optimal transfection method, the transfection efficiency, the drug tolerance condition, the drug screening concentration, the monoclonal proliferation capacity and the optimal plating gradient of the cell to be knocked out are known by carrying out the pre-experiment; when the transfection efficiency and the monoclonal proliferation capacity meet the requirements, the project can be normally carried out, otherwise, the cells are required to be replaced or target products are required to be regulated.

Further, in the step (1), the synthesis method of the gRNA primer is as follows: the first base of the target sequence is G, an additional base is added at the head of the target sequence, CACC is added at the head of the forward primer, AAAC is added at the head of the reverse primer, and a primer F and a primer R are obtained;

the PCR amplification is to amplify the primer F and the primer R to obtain the double gRNA amplified fragment.

Further, in the step (1), the operation flow of the skeleton linearization is as follows: placing the prepared skeleton linearization system into a constant-temperature metal bath for enzyme digestion, adding a loading buffer solution after enzyme digestion is completed, carrying out electrophoresis, and cutting glue for recovery to obtain a linearization skeleton YKO-RP003; wherein the skeleton linearization system comprises 4 mug of skeleton plasmid, 1.5-3.0 mug of enzyme, 5 mug L, ddH of reaction buffer solution ₂ O was replenished to 50 μl;

the operation flow of the carrier splicing reaction is as follows: take out from the refrigerator at-20 DEG CDissolving HiFi DNA Assembly Cloning Kit reagent on ice for use; amplification of fragments using double gRNA, linearization of the scaffold YKO-RP003,/i>HiFi DNA Assembly Cloning Kit reagent and ddH ₂ O, preparing a carrier splicing reaction system; and (3) placing the carrier splicing reaction system in a PCR instrument, and reacting for 1h at 50 ℃ to obtain a splicing product.

Further, in the step (1), the operation flow of the heat shock conversion is as follows: thawing competent cells, adding splice products into the competent cells after thawing, and ice-bathing for 30min; placing the ice bath in a water bath kettle at 42 ℃ after the ice bath is finished, and carrying out heat shock for 60 seconds; ice bath for 2min after heat shock; adding 350 μL of SOC, and culturing at 250rpm at 37deg.C for 1 hr; coating the bacterial liquid obtained in the above way, placing a flat plate in a biochemical incubator at 37 ℃ for inverted culture to obtain transformed competent cells;

The operational flow of colony PCR identification and sequencing identification steps is as follows: 2 xTaq master Mix is taken and inserted into ice surface for freeze thawing, and the primer is taken and dissolved at room temperature; in an ultra clean bench, 50 mu L of LB culture medium is added into a PCR 8 joint tube, 10 mu L of gun heads are clamped by forceps, and single colonies in the transformed competent cells are picked; preparing a colony PCR identification reaction system, setting a colony PCR identification reaction program, placing the colony PCR identification reaction system in a PCR instrument for reaction, and carrying out electrophoresis on a PCR product to obtain a positive bacterial liquid containing the target plasmid.

Further, in the step (1), the operational procedure of plasmid extraction and sequencing is as follows: inoculating 5mL of the positive bacterial liquid containing the target plasmid into a culture medium, and culturing at 37 ℃ by shaking overnight; extracting plasmids by using a root DP103-3 plasmid small extraction kit; sequencing by using JP-ori-F, and conforming the sequence result to the theoretical sequence to obtain qualified sequence;

the operational procedure for plasmid preparation is as follows: inoculating 5mL of bacterial liquid in the culture medium, and culturing for 6-8 h at 37 ℃; 200 mu L of the bacterial liquid is sucked and inoculated into a conical flask containing 200ml of LB culture medium, and the bacterial liquid is cultured at 37 ℃ overnight; and carrying out plasmid large extraction operation according to the instruction by using a large extraction kit to obtain the knockout plasmid.

Further, the operation flow of preparing the monoclonal in the step (4) is as follows:

(4.1) preparing single-cell suspension from the cells obtained in the step (3), diluting the cell suspension according to the optimal monoclonal inoculation amount obtained in the preliminary experiment, pouring the cell suspension into a sample adding groove, inoculating the cell suspension to 60 holes in the middle of a 96-well plate by using a multi-channel pipettor, sealing the whole volume of each hole with 100 mu L of culture solution, and placing the cells in an incubator for static culture by using 150 mu L of culture medium for the outermost circle;

(4.2) after 7 days of culture, observing whether the cells have a proliferation tendency and form cell clusters, labelling wells containing the monoclonal, and then continuing to observe every 2-3 days, labelling the successfully surviving monoclonal;

(4.3) continuing culturing, and performing half-liquid exchange every 7-10 days according to the cell proliferation condition until the cell confluence in the 96-well plate reaches 20-25%;

(4.4) aspiration of the culture medium from each well containing the monoclonal, rinsing with 100. Mu.L of PBS, aspiration, and addition of 20. Mu.L of LTrypLE ^TM The Express digests the cells into single cell suspension, then 200 mu L of complete culture medium is added, and after being evenly mixed, the cells are evenly distributed into 2 holes of a 96-well plate, so that the positions of the holes are in one-to-one correspondence;

(4.5) continuing the culture until the single-split clone grows to a confluence of more than 25%, selecting a plate for primary screening, and setting the number of single-split clones to be X, wherein X=the number of homozygote clones to be required/(pool effective) Genotype duty cycle ^{The highest copy number of chromosome nuclei of this cell} X the passage rate of the cell re-examination).

Further, in said step (3) and said step (5), the monoclonal identification kit used is selected from the group consisting of source well organisms, and the monoclonal identification kit under the designation YK-MV-1000.

Furthermore, the efficient cell line gene knockout method is suitable for gene knockout of cell lines of mammals which can be passaged indefinitely, including tumor cell lines, immortalized cell lines and stem cells.

The technical scheme has the following beneficial effects: according to the technical scheme, in the step (1), transfection is easier to realize and positive clones are more conveniently screened by optimizing a vector skeleton, the fragment knockout efficiency can be remarkably improved, and the number of monoclonal culture and identification is reduced; in the step (3), the editing efficiency of pool cells is effectively analyzed, accurate quantification is carried out, and the number of the monoclonal cells which need to be cultured and identified is determined according to different editing efficiencies, so that manpower and material resources can be saved, the cost is reduced, and the material waste is reduced; optimizing a genotype identification scheme in the step (5), and performing positive clone preliminary screening through PCR gel electrophoresis, so that the sequencing cost and the effort for reading the sequencing result are reduced; meanwhile, the technical scheme can shorten the project period, shorten the project period by 2-3 weeks, screen positive clones in advance and reduce unnecessary negative clone culture and passage work through optimization measures of each step. Therefore, the cell line gene knockout method adopting the technical scheme solves the problems of lower gene knockout efficiency, long period, high sequencing cost and time and labor waste for sequencing results in the prior art when the cell line gene knockout is carried out.

Drawings

FIG. 1 is a graph showing the risk assessment results of the high-efficiency BAG2 gene knockout in Hela cells according to example 1 of the present invention;

FIG. 2 is a graph showing the results of evaluation of the expression level of BAG2 gene of example 1 of the present invention in Hela cells;

FIG. 3 is a design drawing of a gene targeting protocol used in the efficient knockout of BAG2 gene in Hela cells according to example 1 of the present invention;

FIG. 4 is a graph showing the results of the sequence complexity evaluation and the GC content evaluation in example 1 (wherein, (a) is a graph showing the effect of the sequence complexity evaluation, and (b) is a graph showing the result of the GC content evaluation);

FIG. 5 shows the cell morphology (low density) of Hela cells in example 1;

FIG. 6 shows the cell morphology (high density) of Hela cells in example 1;

FIG. 7 is a transfection picture of example 1 cell pre-experiment (cell status diagram under bright field);

FIG. 8 is a transfection photograph of example 1 cell pre-experiment (in situ intracellular green fluorescence profile);

FIG. 9 is a first example of the Hela cell karyotype 1;

FIG. 10 is a diagram of Hela cell type II of example 1;

FIG. 11 is a graph showing the effect of cell transfection in example 1 (under bright field);

FIG. 12 is a graph showing the effect of cell transfection in example 1 (in situ, green fluorescence in cells);

FIG. 13 is a diagram showing an identification scheme in the pool gene editing efficiency test of example 1;

FIG. 14 is a graph showing the results of the pool gene editing efficiency test of example 1;

FIG. 15 is a monoclonal image obtained in the monoclonal preparation of example 1;

FIG. 16 is a gel diagram of PCR at the time of the identification of the monoclonal genotype of example 1;

FIG. 17 is a graph showing the sequencing results of the 1 st primary screening homozygous positive clone of FIG. 14;

FIG. 18 is a plot of the sequencing results of the 2 nd primary screening homozygous positive of FIG. 14;

FIG. 19 is a vector map of a knockout plasmid of the present invention;

FIG. 20 is a map of a carrier backbone according to one embodiment of the invention.

Detailed Description

The technical scheme of the invention is further described below with reference to the accompanying drawings 1-20 and the detailed description.

A high efficiency cell line gene knockout method comprising the steps of:

(1) Vector construction and plasmid preparation: the method comprises the steps of vector construction and plasmid preparation, namely sequentially comprising eight steps of gRNA primer synthesis, PCR amplification, skeleton linearization, vector splicing reaction, heat shock conversion, colony PCR identification and sequencing identification, plasmid extraction and sequencing and plasmid big lifting, so as to prepare knockout plasmid; the knockout plasmid adopts YKO-RP003 as a vector skeleton, and the vector skeleton is deleted as shown in SEQ ID NO:1, a sequence shown in seq id no; an insert sequence is added between the CMV promoter and the tag of the vector backbone, and the insert sequence is as follows: tctgtttaactaga; filling the double gRNAs in the same vector skeleton to obtain knockout plasmids;

(3) pool gene editing efficiency detection: lysing the pool cells collected in the step (2) by using a monoclonal identification kit, (the pool cells are the cells after the medicine screening in the step (2), part of the cells after the medicine screening in the step (2) are used for detecting the pool efficiency, after the detection is qualified, the rest cells are prepared into monoclonal) and performing PCR (polymerase chain reaction) amplification and sequencing, and sequencing results are analyzed by a red cotton genotype analysis system to obtain a pool cell cutting efficiency value, genotypes contained in the pool cells and the proportion of each genotype;

(5) Identification of monoclonal genotypes: and (3) cracking the monoclonal obtained in the step (4) by using a monoclonal identification kit, carrying out PCR amplification on a cracking product, carrying out electrophoresis detection on an amplification product, carrying out primary screening according to an electrophoresis strip, sequencing the clones positive to the primary screening, analyzing a sequencing result by an online tool red cotton genotype analysis system, and judging whether the genotype accords with a knockout standard.

It is worth to be noted that, in the technical scheme, transfection is easier to realize and positive clones are more easily screened by optimizing a vector skeleton in the step (1), fragment knockout efficiency can be remarkably improved, and the number of monoclonal culture and identification is reduced; in the step (3), the editing efficiency of pool cells is effectively analyzed, accurate quantification is carried out, and the number of the monoclonal cells which need to be cultured and identified is determined according to different editing efficiencies, so that manpower and material resources can be saved, the cost is reduced, and the material waste is reduced; optimizing a genotype identification scheme in the step (5), and performing positive clone preliminary screening through PCR gel electrophoresis, so that the sequencing cost and the effort for reading the sequencing result are reduced; meanwhile, the technical scheme can shorten the project period, shorten the project period by 2-3 weeks, screen positive clones in advance and reduce unnecessary negative clone culture and passage work through optimization measures of each step. Therefore, the cell line gene knockout method adopting the technical scheme solves the problems of lower gene knockout efficiency, long period, high sequencing cost and time and labor waste for sequencing results in the prior art when the cell line gene knockout is carried out.

Specifically, in the technical scheme, the carrier framework is optimized in the step (1), and the carrier framework is deleted as shown in SEQ ID NO:1, the skeleton becomes smaller and more compact, and the double gRNA is only about 10000bp after being assembled, thus being easier to transfect. Meanwhile, as shown in figure 19, in order to knock out the vector map of the plasmid according to the technical scheme, an insert sequence tctgtttaactaga is added between the CMV promoter (CMVprotomoter) and the tag (EGFP/P2A/Puror) of the vector, so that the expression of fluorescence and resistance can be enhanced, and positive clones can be screened more conveniently. In addition, according to the technical scheme, the double gRNAs are arranged on the same carrier skeleton, and the two gRNAs are expressed simultaneously, so that the fragment knockout efficiency can be remarkably improved.

In step (2), the knocked-out plasmid is delivered into the cell to be knocked out for transfection, wherein the transfection method comprises any one of an electrotransfer method, a lentivirus method and a liposome method, wherein an instrument used by the electrotransfer method is NEON transfection system, a lentivirus is a third-generation packaging system, and instruments used by the liposome are lipo2000 and lipo3000. And (3) observing the transfection efficiency through fluorescence after 24-48 h, wherein the transfection efficiency is higher than 40%, and then carrying out drug screening according to the resistance carried on the carrier framework to remove untransfected cells, and collecting part of cells for efficiency verification after screening.

In the step (3) of detecting the gene editing efficiency of the pool cells, the monoclonal identification kit (product number: YK-MV-1000) of the source well organisms is used for carrying out the pyrolysis of the collected pool cells, the pyrolysis products are subjected to PCR amplification and sequencing, the sequencing result is analyzed by a red cotton genotype analysis system (https:// www.rc-crispr. Com/tools/gas. Html), the sequencing files of the wild type cells and the pool cells are required to be respectively poured, gRNA information is input, and the pool cell cutting efficiency value and genotypes contained in the pool cells and the duty ratio of various genotypes can be obtained by clicking and submitting. According to the technical scheme, a monoclonal identification kit with a source well organism and a cargo number of YK-MV-1000 is adopted, genome DNA of cells can be directly released by lysing pool cells, multi-step extraction and purification treatment is not needed, the kit can be directly used for genotyping of pool cells, genomes of hundreds of cells can be rapidly extracted in batches, the throughput of the genotyping link is 10-100 times expanded, high-throughput identification can be realized, the identification time is greatly shortened, high-throughput identification is realized, and the whole project period is realized. It is worth noting that the monoclonal identification kit used in the technical scheme can be directly purchased in the market.

Meanwhile, the method is the same as the step (3), and in the step (5), the monoclonal identification kit (product number: YK-MV-1000) of the source well organism is used for carrying out the cleavage and the genotype identification, so that the genotype of the monoclonal can be obtained rapidly and effectively, and the identification time is shortened greatly. Meanwhile, the positive clone preliminary screening is carried out by PCR gel electrophoresis in the step (5), so that the sequencing cost and the effort for reading the sequencing result can be reduced.

Further, the sequencing results in the step (3) and the step (5) in the technical scheme are analyzed by a red cotton genotype analysis system, and the pool cell cutting efficiency value, the genotypes contained in the pool cells and the proportion of the genotypes can be directly obtained in the step (3). Meanwhile, in the step (5), the monoclonal genotypes and the duty ratio of each genotype can be directly obtained, so as to judge whether the genotypes meet the knockout standard. The website of the red cotton genotyping system used in the technical scheme is ht tps:// www.rc-crispr.

Further described, the efficient cell line gene knockout method further comprises a project difficulty assessment step before the vector construction and plasmid preparation in the step (1), wherein the project difficulty assessment step comprises gene assessment (the gene assessment comprises gene lethality assessment and gene expression level assessment), gene targeting scheme design, cell pre-experiment and difficulty assessment.

It is worth to say that, by establishing the project difficulty evaluation system for cell gene editing, the technical scheme can improve the project success rate, avoid invalid repeated experiments, further improve the gene knockout efficiency of the cell line, reduce the number of monoclonal culture and identification, and further shorten the project period.

The further flow is as follows:

gene risk assessment system: in conjunction with the Red Cotton Gene Risk assessment System (https:// www.rc-crispr. Com/tools/gene_risk_assessment. Html), it was determined whether the gene to be knocked out had a lethal risk.

Gene expression level evaluation system: TPM values were calculated quantitatively by STAR alignment and RSEM transcripts (Transcripts Per Kilobase Million) and scored into 4 grades for value in guiding development of cellular gene editing programs.

If the evaluation passes, the scheme design is normally performed.

the cell pre-experiment and the difficulty evaluation are that the multiplication time, the passage proportion, the optimal transfection method, the transfection efficiency, the drug tolerance condition, the drug screening concentration, the monoclonal proliferation capacity and the optimal plating gradient of the cell to be knocked out are known by carrying out the pre-experiment; when the transfection efficiency and the monoclonal proliferation capacity meet the requirements, the project (the project refers to the operation process of the step (1) to the step (5) in the technical scheme) can be normally carried out, otherwise, the cells need to be replaced or target products need to be regulated.

Specifically, gene lethality assessment: and combining a red cotton gene risk assessment system to determine whether the gene to be knocked out has a lethal risk.

If the evaluation passes, the scheme design is normally performed.

The method for designing the gene targeting scheme comprises the following steps: the design of the knockout scheme is carried out on a red cotton crispr gene editing system (https:// www.rc-crispr. Com /), and the design content of the scheme comprises: transcript selection, knockout region selection, selection of targeting sequences (guide RNAs), sequence complexity assessment, GC content assessment, ease of identification assessment. Wherein the screening of the targeting sequence comprises: the positions, forward and reverse directions, specificity scores and cutting scores of the gRNAs are selected, the preferred scheme is a pair of gRNAs, the size of the knocked-out fragments is 50-500 bp, so that the knocked-out efficiency can be remarkably improved, and the subsequent identification is facilitated.

The red cotton CRISPR gene editing system used in the above was designed as an online tool for CRISPR/Cas9 protocol design for cells and common bacteria developed for source well organisms, where cell knockout protocol design and parameter sources are Zhang Feng website (http:// crispor. Tefor. Net /), CCTOP (https:// CCTOP. Cos. Uni-heidelberg. De /), ensemblel (http:// asia. Ensembl org/index. Html) and MGI http://www.informatics.jax.org /), and the like.

The method for cell pre-experiment and difficulty assessment is as follows: for a new cell line, STR identification is first required to verify the "identity" of the cell. The preliminary experiments were then arranged to understand the doubling time, passaging ratio, optimal transfection method and transfection efficiency, drug tolerance and drug screening concentration, and also cell monoclonal formation capacity and optimal plating gradient, if both transfection efficiency and monoclonal proliferation capacity were passed, the project could proceed normally, otherwise the cells would need to be replaced or the target product (such as pool cells delivered) adjusted. Finally, the cell characteristics are related to the success rate of the project, namely the cell karyotype, and the number of clones to be cultured and identified can be calculated according to the chromosome number of the gene and the cutting efficiency of pool cells (refer to mixed cells after transfection and screening and before separation into single clones) by performing karyotype detection or referring to karyotype data disclosed by the cell line as a reference.

Specifically, the pre-experiments included the following items:

1. drug sieve concentration fumbling

(1) Cells in the logarithmic growth phase (i.e., knocked-out cells) were digested into single cell suspensions, inoculated into 12-well plates, and the total volume of the culture medium was 1ml. Placing the cells at 37deg.C and 5% CO ₂ The incubator continues to incubate for 24 hours.

(2) When the confluence reached about 50%, the culture medium was changed to a drug sieve culture medium containing Puromycin at different concentrations, the concentration gradient was: 0,1,1.5,2,3,4. Mu.g/mL.

(3) Cells were observed under a 2-3 day back mirror and the lowest total lethal concentration of cells was selected as the drug screening concentration for subsequent experiments.

And (5) qualification standard: the method has no drug resistance, is sensitive to the drug, and selects the lowest concentration of total cell death as the drug screening concentration of the subsequent experiment.

2. Monoclonal formation fumbling

(1) Cells in the logarithmic growth phase were digested into single cell suspensions and cell counts were performed.

(2) A certain amount of cell suspension was taken, diluted and inoculated into a 96-well plate, and the total volume of the culture solution per well was 100 μl. Placing the cells at 37deg.C and 5% CO ₂ And (5) standing and culturing in an incubator.

(3) After 7-10 days, the cells were observed under a mirror for a tendency to proliferate and form cell clusters, and the number of monoclonal antibodies in each group was counted.

And (5) qualification standard: the monoclonal formation rate is more than 16%, and meets the project development requirement.

3. Target sequencing

(1) Genomic DNA of cells was extracted using a blood/cell/tissue genomic DNA extraction kit.

(2) PCR amplification of the targeting region, PCR reaction System comprising 25. Mu.L of 2 XTaq Master Mix 25, 1. Mu.L of primer Forward (10. Mu.M), 1. Mu.L of primer Reverse (10. Mu.M), 22. Mu.L of ddH ₂ O, 1. Mu.L Template.

(3) And (3) performing agarose gel electrophoresis on the PCR product, and sequencing the PCR product if the band size of the PCR product is consistent with the theory.

(4) And comparing the sequencing result with a theoretical sequence to confirm the correctness of the sequence of the gRNA targeting site.

And (5) qualification standard: the sequence of the gRNA targeting site is consistent with theory.

4. Cell transfection

The methods of cell transfection include lipo, electrotransfection and lentiviral methods, and the three methods of cell transfection are performed as follows.

The lipo process is operated as follows:

(1) The cells are inoculated to a 12-hole plate and can be used for carrying out experiments after the cells grow to 60-80% fusion degree;

(2) The transfection systems were separately prepared in 1.5mL centrifuge tubes:

(1) 100 mu L of Opti-MEM, a certain amount of plasmid DNA is added, gently stirred and mixed uniformly, and the mixture is kept stand for 5 minutes at room temperature;

(2) 100 mu L of Opti-MEM, a certain amount of Lipofectamine 2000 is added, gently beaten and mixed evenly, and the mixture is kept stand for 5 minutes at room temperature; three groups were performed, group 1 being 1 μg of plasmid, lipofectamine 2000 2.5 μl; group 2 was plasmid 1. Mu.g, lipofectamine 2000. Mu.L; group 3 was 2. Mu.g of plasmid, lipofectamine 2000. Mu.L;

(3) Dropwise adding the step (2) into the step (1), lightly blowing and uniformly mixing, and standing at room temperature for 20-30 minutes;

(4) Dropwise adding the transfection mixture into a 12-hole plate, shaking uniformly in a cross manner, and continuously culturing in an incubator for 4-6 hours;

(5) Replacing 1mL of fresh complete culture solution, and placing the culture solution in an incubator for continuous culture;

(6) Observing the fluorescence expression quantity and the cell state of the cells 24-48 hours after transfection, and taking 40x and 100x photographs for reservation; the transfection conditions with highest EGFP fluorescence and optimal cell status were recorded.

The operation method of the electric transfer method is as follows:

(1) When the cell proliferation reaches 80-90% confluence and the cell state is good, digestion and termination are carried out according to the conventional cell passage mode, and then centrifugation is carried out for 4 minutes at 300 Xg, and the supernatant is discarded;

(2) Cell counting is carried out by using 1-2 mLPBS to re-suspend cells, a proper amount of cells are taken into a 1.5mL centrifuge tube according to the electrotransformation parameters given by Neon, 300 Xg is centrifuged for 4 minutes, and the supernatant is discarded;

(3) Resuspension cells with 100 μLBuffer R, adjusting cell density to that recommended by Neon electrotransformation parameters, adding 5 μg of plasmid of interest and 5 μg of transposase, and mixing;

(4) Setting an electric rotating parameter, and completing electric rotating operation according to the use instruction of an electric rotating instrument:

(5) Adding the cell suspension in the electrokinetic transfer gun head into a 6-hole plate containing a culture medium, and placing the cell suspension into an incubator for continuous culture;

(6) After 24 hours of transfection, the efficiency was observed under a microscope and 40x or 100x photographs were taken for retention, the normal complete broth was replaced, incubation was continued for 24 hours, and 40x or 100x photographs were again observed and taken for retention. And comprehensively evaluating transfection efficiency and cell viability, and selecting an optimal scheme as an electrotransformation scheme of a formal experiment.

The lentivirus method is operated as follows:

(1) Inoculating the cells to a 12 or 6-hole plate, and carrying out experiments until the cell reaches 30-50% fusion degree;

(2) Taking 2 holes, performing cell count after digestion by using pancreatin, and calculating the average cell quantity N of each hole;

(3) The viral volumes required for each MOI were calculated from the viral titer T (TU/mL) and the cell mass N as follows: v (μl) =1000×moi×n/T. Assuming a moi=10, a cell number=200000, a viral titer of 3×108TU/mL, the viral volume is 6.7 μl. MOI fumbling experiments generally design 4-5 gradients;

(4) Uniformly shaking the cross, overwriting MOI and date on the plate, and putting the plate back into the incubator for culturing;

(5) After 24 hours of transfection, fresh complete broth was replaced;

(6) Observing the fluorescence expression quantity and the cell state of the cells after 48-72 hours of transfection, and taking 40x and 100x photographs for reservation; the MOI with the highest EGFP fluorescence was recorded as the MOI of the final experiment without affecting the cell status.

And (5) qualification standard: the transfection efficiency is more than 40 percent, and meets the project development requirement.

The STR is Short Tandem Repeat, the short tandem repeat is a microsatellite, the length of the repeat unit is 2 to 7 base pairs, and the number of the repeats is different from person to person, so that different individuals of human beings or cell lines derived from different individuals can be effectively identified by using STR analysis.

Further illustratively, in step (1), the method of synthesis of the gRNA primer is as follows: the first base of the target sequence is G, an additional base is added at the head of the target sequence, CACC is added at the head of the forward primer, AAAC is added at the head of the reverse primer, and a primer F and a primer R are obtained;

It should be noted that, in the synthesis of the gRNA primer, the primer synthesis needs to add an additional base at the head of the target sequence, the forward primer adds CACC, the reverse primer adds AAAC, and special attention needs to be paid that the first base of the target sequence is G, and if the first base of the selected target sequence is not G, a G can be added before the target sequence.

The reagents and consumables used for PCR amplification in step (1) are as follows:

reagent: primer F, primer R (10 pmol/. Mu.L), template (20-100 ng plasmid or PCR fragment), primeSTAR HS DNAPolymeras (a DNA polymerase, commercially available);

consumable: PCR tube, EP tube rack, ice box;

the PCR amplification operation flow is as follows:

diluting the primer, preparing a PCR tube and marking;

the PCR system was configured according to table 1 below, with the exception of primers and templates, other components could be first mixed for flux manipulation;

TABLE 1PCR System

After all the components are added, the components are gently blown and evenly beaten and are quickly and lightly thrown on a centrifugal machine, so that all the components are converged at the bottom of the pipe and are prevented from remaining on the pipe wall;

on the machine, the samples were placed in a PCR instrument for reaction, and the procedure is shown in table 2 below:

TABLE 2PCR reaction procedure

After the reaction is finished, the mixture is taken out and directly electrophoretically recovered or stored in a refrigerator at the temperature of minus 20 ℃.

Further describing, in step (1), the operational procedure of the skeleton linearization is as follows: placing the prepared skeleton linearization system into a constant-temperature metal bath for enzyme digestion, adding a loading buffer solution after enzyme digestion is completed, carrying out electrophoresis, and cutting glue for recovery to obtain a linearization skeleton YKO-RP003; wherein the skeleton linearization system comprises 4 mug skeleton plasmid, 1.5-3.0 mug enzyme, 5 mug reaction buffer solution L, ddH ₂ O was replenished to 50 μl;

the operation flow of the carrier splicing reaction is as follows: take out from the refrigerator at-20 DEG CDissolving HiFi DNA Assembly Cloning Kit reagent on ice for use; adopts double gRNA amplified fragments, linearization skeleton YKO-RP003,HiFi DNA Assembly Cloning Kit reagent and ddH ₂ O, preparing a carrier splicing reaction system; placing the carrier splicing reaction system in a PCR instrument, and reacting at 50 DEG CAnd (3) 1h, and obtaining a spliced product.

Specifically, in the framework linearization, the carrier framework information is YKO-RP003-pro, and the carrier framework spectrogram 20 shows that reagents, consumables and instruments used for the framework linearization are as follows:

reagent: vector backbone (i.e., backbone plasmid), corresponding enzyme, buffer, sterile water;

consumable: a pipetting gun, a gun head, an EP pipe frame, an ice box and an EP pipe;

instrument: constant temperature metal bath (first set to enzyme reaction temperature)

The operation flow is as follows:

backbone linearization prepares an EP tube, making a label (backbone number + enzyme used + size of target band after linearization + date); formulation of the backbone linearization System according to Table 3 below

TABLE 3 skeleton linearization System

Note that: the total amount of linearized backbone cleavage in Table 3 above is up to 4. Mu.g (e.g., backbone plasmid concentration is 200 ng/. Mu.L, 20. Mu.L is added to the system); 1.5. Mu.L of each enzyme was added, and 1.5. Mu.L of each enzyme was added for double cleavage.

After all components are added, the components are gently blown and evenly thrown on a centrifugal machine, so that all components are converged at the bottom of the pipe, and the components are prevented from remaining on the pipe wall.

Placing an EP tube (a micro centrifuge tube) into a constant-temperature metal bath, timing for 1h, taking out after the reaction is finished, taking 2 mu L of a sample after the reaction, running electrophoresis, identifying whether the enzyme digestion is complete or not, if the enzyme digestion is not complete, placing the EP tube back into the constant-temperature metal bath, continuing the enzyme digestion for 30-60min, and identifying whether the enzyme digestion is complete or not; after complete enzyme digestion, 10 mu L of 6 Xloading Buffer is directly added, electrophoresis and gel digestion recovery are carried out, and a linearization skeleton YKO-RP003 is obtained.

Specifically, reagents, consumables and instruments used as shown in the vector splicing reaction are as follows:

reagent:HiFi DNA Assembly Cloning Kit (commercially available);

consumable: an ice bin;

instrument: PCR instrument, pipette.

The operation flow of the carrier splicing reaction is as follows:

take out from the refrigerator at-20 DEG CHiFi DNA Assembly Cloning Kit is put on ice to be dissolved for standby;

a carrier splicing reaction system was configured, and the reaction system is shown in table 4 below:

TABLE 4 vector splice reaction System

/>

Namely, in a carrier splicing system, the framework consumption is 40-50 ng, and the consumption of each fragment is 10ng added to each 100 bp.

Setting a PCR reaction program: 50 ℃ for 1h.

After the reaction was completed, 10. Mu.L of the reaction product (i.e., the splice product) was taken for conversion.

Further illustratively, in step (1), the thermal shock conversion operation is as follows: thawing competent cells, adding splice products into the competent cells after thawing, and ice-bathing for 30min; placing the ice bath in a water bath kettle at 42 ℃ after the ice bath is finished, and carrying out heat shock for 60 seconds; ice bath for 2min after heat shock; adding 350 μL of SOC, and culturing at 250rpm at 37deg.C for 1 hr; coating the bacterial liquid obtained in the above way, placing a flat plate in a biochemical incubator at 37 ℃ for inverted culture to obtain transformed competent cells;

The operational flow of colony PCR identification and sequencing identification steps is as follows: 2 xTaq master Mix is taken and inserted into ice surface for freeze thawing, and the primer is taken and dissolved at room temperature; in an ultra clean bench, 50. Mu.L of LB medium is added to a PCR 8-connected tube, 10. Mu.L of gun heads are clamped by forceps, and single colonies (single colonies in competent cells after transformation) are picked; preparing a colony PCR identification reaction system, setting a colony PCR identification reaction program, placing the colony PCR identification reaction system in a PCR instrument for reaction, and carrying out electrophoresis on a PCR product to obtain a positive bacterial liquid containing the target plasmid.

The reagents, consumables and instruments used for the heat shock conversion in the technical scheme are as follows:

reagent: competent cells, LB plates (containing the corresponding antibiotics), SOC medium;

consumable: ice box, float plate;

instrument: sterilizing the super clean bench for later use, preheating the water bath kettle to 42 ℃,

the operation flow of heat shock conversion is as follows:

taking out a sufficient amount of competent cells from a refrigerator at-80 ℃ and placing the competent cells on ice for thawing for about 5min, and marking according to the name of a sample to be converted;

in an ultra clean bench (not essential to an alcohol lamp), adding a sample to be converted into relative competence by a control mark, and carrying out ice bath for 30min;

placing the mixed solution into a water bath kettle with the temperature of 42 ℃, and carrying out heat shock for 60 seconds;

rapidly placing on ice after heat shock, and carrying out ice bath for 2min;

Adding 350 mu L of SOC culture medium into an ultra-clean bench, and culturing for 1h at a constant temperature of a shaking table at 37 ℃ and at 250 rpm;

a proper amount of bacterial liquid is taken for coating a plate; the plates were placed in a 37℃biochemical incubator for inverted culture, and competent cells after transformation.

Further describing, the operational flow of colony PCR identification and sequencing identification in the technical scheme is as follows:

2 xTaq master Mix is taken and inserted into ice surface for freeze thawing, and the primer is taken and dissolved at room temperature;

in an ultra-clean bench, 50 mu L of LB culture medium is added into a sterile PCR 8 joint tube, 10 mu L of gun heads are clamped by forceps, and single bacterial colonies are picked;

preparing a colony PCR identification reaction system according to Table 5, setting a colony PCR identification reaction program according to Table 6, placing the colony PCR identification reaction system in a PCR instrument for reaction, and carrying out electrophoresis on PCR products to obtain a positive bacterial liquid containing the target plasmid.

TABLE 5 colony PCR identification reaction System

Composition of the components	Dosage of
		Fungus liquid template	1μL
TaqMix	7.5μL
		Primer F (10 pmol/. Mu.L)	1μL
Primer R (10 pmol/. Mu.L)	1μL
		ddH ₂ O	Is added to 15 mu L
Total volume of	15μL

TABLE 6 colony PCR identification reaction procedure

The operation flow of electrophoresis of the PCR product is as follows:

agarose gel (for example, 1% identification gel of a plate is prepared)

1g of agarose is weighed and placed in a triangular flask, 110mLTAE electrophoresis buffer is weighed and mixed with the agarose;

Covering the cover, heating in a microwave oven, and boiling until agarose is completely dissolved (about 3-5 min);

cooling to about 60 ℃ by tap water;

pouring the cooled agarose into a beaker, adding 5 mu L of EB substitute, and uniformly mixing;

pouring the mixture into a gel making groove provided with a bottom plate and a comb, and cooling and solidifying the mixture for about 20 to 30 minutes at room temperature to obtain agarose gel.

(II) electrophoresis

Carefully withdraw the comb and place the gel along with the chassis in an electrophoresis tank containing 1 xTAE electrophoresis buffer;

DNA samples and 6×loading Buffer were mixed at a ratio of 5:1, and adding the mixed solution into a gel hole.

Adding 6 mu LDNAlader into one gel hole in each row;

setting proper (100-150V) voltage of the electrophoresis apparatus, and taking out the gel after running to a proper distance;

the gel is beaten, and the waste gel is placed in a yellow bag garbage can.

Further, in the step (1), both the plasmid extraction and the plasmid extraction are the plasmids, but the amounts and the concentrations of the plasmids obtained by the plasmid extraction and the plasmid extraction are different, wherein the plasmid extraction in the plasmid extraction and the sequencing is the small extraction, that is, the amount and the concentration of the plasmids obtained by the extraction are lower, mainly for sequencing, and the plasmid extraction is arranged after the sequencing is correct.

The plasmid extraction and sequencing operation flow is as follows: inoculating 5mL of the positive bacterial liquid containing the target plasmid into a culture medium, and culturing at 37 ℃ by shaking overnight; extracting plasmids by using a root DP103-3 plasmid small extraction kit; sequencing by using JP-ori-F, and carrying out plasmid large extraction after the sequence result is qualified after conforming to the theoretical sequence;

the operational procedure for plasmid preparation is as follows: inoculating 5mL of bacterial liquid in the culture medium, and culturing for 6-8h at 37 ℃; 200 mu L of the bacterial liquid is sucked and inoculated into a conical flask containing 200ml of LB culture medium, and the bacterial liquid is cultured at 37 ℃ overnight; and carrying out plasmid large extraction operation according to the instruction by using a large extraction kit to obtain the knockout plasmid.

Specifically, the operational procedure for plasmid preparation is as follows:

and (3) resuscitating and culturing bacteria:

1. placing glycerol bacteria on a dry ice box from a refrigerator at the temperature of minus 80 ℃, marking on a fungus shaking tube in an ultra-clean bench, pouring 2ml of LB culture medium, scraping glycerol bacteria blocks, inoculating the glycerol bacteria blocks in the fungus shaking tube, and resuscitating for 6-8h at the temperature of 37 ℃;

2. 200. Mu.L of the above-mentioned bacterial liquid was pipetted into a conical flask containing 200ml of LB medium and cultured overnight at 37 ℃.

And (3) thallus collection:

1. respectively pouring 200ml of bacterial liquid into 2 50ml centrifuge tubes, centrifuging at 4,400rpm for 10min, and discarding the waste liquid (repeating for one time);

2. And (5) reversely buckling the centrifuge tube on the water absorption paper, and airing the residual waste liquid.

Plasmid extraction:

1. taking 10ml of RES by using an electric pipettor, respectively adding 5ml of RES into two centrifuge tubes of the same strain, and mixing the suspension after full shaking and uniform mixing;

2. adding 10ml LYS, and mixing slowly and upside down for 2min;

3. adding 10ml NEU, rapidly mixing upside down until the solution is clear, centrifuging at 4 ℃ and 4,400rpm for 20min;

4. during the centrifugation, an adsorption column is placed on a pipe frame, and 15ml of EQU is added along a membrane;

5. pouring the supernatant after centrifugation into an adsorption column for passing through the column, and adding 5ml of FIL along the membrane after the completion of the centrifugation;

6. the tweezers clamp the adsorption film for discarding, and 35ml of ENDO is added;

7. adding 15ml Wash to remove impurities;

8. taking a new 50ml centrifuge tube, placing under an adsorption column, adding 5ml of preheated ELU for eluting, and measuring the concentration;

9. adding 0.7 times volume of isopropanol, mixing, centrifuging at 4deg.C and 6,000rpm for 20min;

10. the supernatant was discarded, 1ml of 70% ethanol was added, and the pellet was poured into a new 1.5ml centrifuge tube, centrifuged at 12,000rpm for 1min (repeated once);

11. and (3) opening a centrifugal tube cover in an ultra-clean bench, airing for 30min, adding TE with a corresponding volume according to the initial concentration, and placing in a refrigerator at 4 ℃ for overnight dissolution.

Further illustratively, the procedure for preparing the monoclonal in step (4) is as follows:

(4.1) preparing single-cell suspension from the cells obtained in the step (3), diluting the cell suspension according to the optimal monoclonal inoculation amount obtained in the preliminary experiment, pouring the cell suspension into a sample adding groove, inoculating the cell suspension to 60 holes in the middle of a 96-well plate by using a multi-channel pipettor, sealing the whole volume of each hole with 100 mu L of culture solution, and placing the cells in an incubator for static culture by using 150 mu L of culture medium for the outermost circle; ( Note that: the number of 96-well plates is determined by the pre-experimental monoclonal rate, and the number of 96-well plates is 80 to 100 monoclonal plates available in consideration of the factor of the positive rate. )

(4.3) continuing culturing, and performing half-liquid exchange every 7-10 days according to the cell proliferation condition until the cell confluence in the 96-well plate reaches 20-25%; (during the monoclonal culture, if the proliferation of cells is rapid, the culture can be carried out for 7-10 days, the liquid can be supplemented for 30-50. Mu.L, otherwise, the liquid supplementing time can be delayed to about 10-12 days;)

(4.4) aspiration of the culture medium from each well containing the monoclonal, rinsing with 100. Mu.L of PBS, aspiration, and addition of 20. Mu.L of LTrypLE ^TM The Express digests the cells into single cell suspension, then 200 mu L of complete culture medium is added, and after being evenly mixed, the cells are evenly distributed into 2 holes of a 96-well plate, so that the positions of the holes are in one-to-one correspondence; (TrypLE used in this step) ^TM Express is a non-animal derived recombinase suitable for dissociating various adherent mammalian cells, including CHO, HEK 293, A529. Primary human keratinocytes and embryonic stem cells. TrypLE ^TM Express cleaves peptide bonds at the C-terminus of lysine and arginine, directly replacing trypsin. The high purity improves specificity and reduces the possible damage to cells by other enzymes present in some trypsin extracts. )

(4.5) continuing the culture until the single-split clone grows to a confluence of more than 25%, selecting a plate for primary screening, and setting the number of single-split clones to be X, wherein X=the number of homozygote clones to be required/(pool effective genotype ratio) ^{The highest copy number of chromosome nuclei of this cell} X the passage rate of the cell re-examination).

Further illustratively, in step (3) and step (5), the monoclonal identification kit used is selected from the group consisting of source well organisms, and the monoclonal identification kit under the designation YK-MV-1000.

According to the technical scheme, a monoclonal identification kit with a source well organism and a product number of YK-MV-1000 is adopted, genomic DNA of cells can be directly released by lysing the cells, multi-step extraction and purification treatment is not needed, the kit can be directly used for genotyping of pool cells, genomes of hundreds of cells can be rapidly extracted in batches, the throughput of the genotyping link is 10-100 times expanded, high-throughput identification can be realized, the identification time is greatly shortened, high-throughput identification is realized, and the whole project period is shortened.

Further described, the efficient cell line gene knockout method is suitable for gene knockout of cell lines of infinitely passable mammals including tumor cell lines, immortalized cell lines and stem cells.

The present technology will be further described with reference to examples.

Example 1

The efficient cell line gene knockout method of the embodiment specifically relates to efficient BAG2 gene knockout in Hela cells, and comprises the following steps:

(1) Evaluation of Gene lethality

The red cotton gene risk assessment system is based on 3000 ten thousand CRISPR library knockout data, covers 1400 cells, displays the risk probability of knocking out the gene in the cells, inputs BAG2 genes and Hela cells, queries the gene risk by one key, and shows that the BAG2 genes are non-essential genes and have no lethal risk (figure 1);

(2) Gene expression level evaluation

The system covers 1400 multicellular RNA-seq data, divides the expression quantity according to TPM values, is used for guiding the value of cell gene editing project development, inputs BAG2 genes and HeLa cells, queries the gene expression quantity by one key, and shows that the BAG2 genes are high-expression genes in the HeLa cells (figure 2);

(3) Design of gene targeting scheme

The schematic diagram of the design of the gene targeting scheme in this example is shown in fig. 3 below, and the design of the knockout scheme is performed on a red cotton crispr gene editing system (https:// www.rc-crispr. Com /) for the BAG2 gene, the design of the knockout scheme includes selection of transcripts, selection of knockout regions, screening of targeting sequences (guide RNAs, grnas), sequence complexity evaluation, GC content evaluation and evaluation of identification difficulty, wherein the screening of the targeting sequences (grnas) includes positions, forward and reverse directions, specificity scores and cleavage scores of the grnas, and a pair of optimal gRNA sequences (g 1 and g 2) is selected by the design of the knockout scheme, and the obtained pair of gRNA sequences is shown as follows:

g1：TCAACGCTAAAGCCAACGAG GGG；

g2：TGACCGCTCCAGCCGCCTGC TGG；

wherein the size of the g1 and g2 knockout regions is 49bp; the knockout region is smaller, so that the knockout efficiency can be remarkably improved, and the subsequent identification is convenient.

Sequence complexity and GC content evaluation were evaluated as follows

As shown, by aligning the +800bp fragment of the target region with itself in fig. 4 (a), it was determined whether a complex sequence was present; as can be seen from FIG. 4 (b), in the +800bp region, the average content of gas chromatography was 43.68%, which is suitable for PCR screening or sequencing analysis. From fig. 4 (a) and 4 (b), it can be seen that the sequence complexity evaluation and GC content evaluation are conventional.

(4) Cell pre-experiment and difficulty assessment

The multiplication time, the passage proportion, the optimal transfection method and transfection efficiency, the drug tolerance condition, the drug screening concentration, the monoclonal proliferation capacity and the optimal plating gradient of the Hela cells are known through preliminary experiments. And determining the cell karyotype of the HeLa cells by referring to the karyotype data disclosed for the HeLa cells as a reference.

Among them, hela cell culture information is shown in table 7 below:

TABLE 7Hela cell culture information

The cell morphology of Hela cells is shown in fig. 5 and 6, wherein fig. 5 is a low-density cell morphology, and fig. 6 is a high-density cell morphology.

Parameters of Hela pre-experiments were as follows:

(1) neon electrical conversion parameters: 1320v,20ms,1pulse, transfection pictures are shown in FIG. 7 (cell status diagram under the indicated field) and FIG. 8 (green fluorescence case diagram in cells in situ), and electrotransfection efficiencies of 80% were calculated by FIGS. 7 and 8.

(2) Drug screening concentration: 1ug/ml;

(3) monoclonal formation rate: 30% -40%;

(4) cell nucleus type:

reference is made to the description of karyotype data for Hela cells in the ATCC database:

chromosome mode = 82; the range is 70-164.

98% of the cells have a small telomere chromosome.

100% of 1385 cells examined were aneuploidy.

Four typical HeLa-tagged chromosomes are reported in the literature.

HeLa marker chromosome: one copy of Ml, one copy of M2, four to five copies of M3, and two copies of M4. M1 is the rearrangement of the long arms and centromeres of chromosome 1 and chromosome 3. M2 is a combination of short chromosome 3 arm and long chromosome 5 arm. M3 is the short arm co-chromosome of chromosome 5. M4 consists of the long arm of chromosome 11 and the arm of chromosome 19.

The core pattern pictures are shown in fig. 9 and 10 below.

Specifically, according to the above-mentioned preliminary cell experiment data, it is known that the transfection efficiency of Hela cells is > 30% and the monoclonal formation rate is > 15% are both satisfactory, and a gene editing experiment can be performed, wherein the Hela karyotype is relatively complex, and the karyotype factor needs to be considered when calculating the number of clones to be identified.

(5) Vector construction and plasmid preparation

The vector construction and plasmid preparation comprises the steps of (1) gRNA sequence synthesis, (2) PCR amplification, (3) linearization skeleton, (4) vector splicing reaction, (5) heat shock conversion, (6) colony PCR identification and sequencing identification, (7) plasmid extraction and sequencing and (8) plasmid big extraction.

(1) gRNA sequence synthesis

Synthesizing a primer sequence according to the screened gRNA sequences (i.e. G1 and G2), wherein the first base of the target sequence is G, adding an additional base at the head of the target sequence, adding CACC at the head of the forward primer, and adding AAAC at the head of the reverse primer to obtain a primer F (i.e. CK21-202 b-F1) and a primer R (CK 21-202 b-R1);

CK21-202b-F1：

GAAAGGACGAAACACCgTCAACGCTAAAGCCAACGAGGTTTTAGAGCTAGAAATA GCAAGTTAA

CK21-202b-R1：

TTTCTAGCTCTAAAACGCAGGCGGCTGGAGCGGTCAcGGTGTTTCGTCCTTTCCACA AG

(2) PCR amplification

The PCR system was set up according to the following Table 8, and the above-mentioned CK21-202b-F1 and CK21-202b-R1 fragments (413 bp) were amplified.

TABLE 8 example 1PCR System

Specifically, primeSTAR in Table 8 refers to any other PCR enzyme having a strong 3 '. Fwdarw.5' exonuclease activity, which is superior in fidelity to Takara Bio; buffer is Buffer; the scaffold-U6 is a synthetic universal template, is a fixed part of the gRNA, can be combined with Cas9 protein, and is a part of the gRNA vector.

Specifically, when the PCR system is configured, after all components are added, the components are gently and uniformly blown and quickly thrown on a centrifugal machine, so that all the components are converged at the bottom of a pipe and are prevented from remaining on the pipe wall, and then the PCR amplification reaction is performed by referring to the following program set in Table 9.

TABLE 9 PCR procedure for example 1

The PCR amplification reaction was performed according to the PCR procedure of Table 3, and after the PCR amplification reaction was completed, the product was subjected to electrophoresis, gel-cut and recovered. The gel recovery was performed according to the instructions of QIAquick Gel Extraction Kit (gel recovery kit).

(3) Linearization framework

A linearization system was prepared according to Table 10 below, the reaction components were added to a 1.5mL EP tube according to Table 10, mixed well, placed in a metal bath, reacted at 37℃for 1-2 h, after complete digestion, 10. Mu.L of 6 Xloading Buffer (Loading Buffer) was directly added, and electrophoresis and gel cutting were performed. And after finishing the glue cutting, recovering the linearized framework according to the specification of the used glue recovery kit.

Table 10 example 1 linearization system

Component (A)	Volume of
		YKO-RP003 (backbone plasmid)	1μL
BpiI (restriction endonuclease)	2μL
		10x reaction Buffer	5μL
ddH ₂ O	42μL
		Total volume of	50μL

(4) Carrier splicing reaction

The double gRNA amplified fragment and the linearized backbone plasmid YKO-RP003 were prepared, a reaction system was prepared according to Table 11 below, and the mixture was placed in a PCR apparatus and reacted at 50℃for 1 hour.

Table 11 example Carrier Concatenation reaction System

Specifically, gibson Assembly MasterMix is commercially available as it is, gibson Assembly MasterMix is available from NEB company under the model E2611L.

(5) Heat shock conversion

After the carrier splicing reaction in the step (4) is finished, 10 mu L of reaction products are taken for heat shock conversion, and reagents, consumables and instruments used for the heat shock conversion are as follows:

reagent: competent cells, LB plates (containing corresponding antibiotics) and SOC medium;

Consumable: ice boxes and float plates;

instrument: sterilizing the super clean bench for later use, and preheating the water bath kettle to 42 ℃.

The operation flow of heat shock conversion is as follows:

taking out a sufficient amount of competent cells from a refrigerator at-80 ℃ and placing the competent cells on an ice box for thawing for about 5min;

adding the reaction product into competent cells in an ultra clean bench (not essential to an alcohol lamp), and ice-bathing for 30min;

placing the mixture of the reaction product and the competent cells into a water bath kettle at 42 ℃, and thermally exciting for 60 seconds;

rapidly placing on ice after heat shock, and carrying out ice bath for 2min;

adding 350 mu L of SOC into an ultra-clean bench, and culturing for 1h at a constant temperature of a shaking table at 37 ℃ and at 250 rpm;

200ul of bacteria liquid is coated on a plate, and the plate is placed in a biochemical incubator at 37 ℃ for inverted culture.

(6) Colony PCR identification and sequencing identification

2 xTaq master Mix (high purity thermostable DNA polymerase) was inserted into ice for freeze thawing, and the primers were dissolved at room temperature. In an ultra clean bench, 50. Mu.L of LB medium was added to a sterile PCR 8-tube, and a 10. Mu.L tip was gripped with forceps to pick up single colonies. A colony PCR identification reaction system was prepared according to Table 12 below and was on-line according to the colony PCR identification reaction program in Table 13.

Table 12 example 1 colony PCR identification reaction System

Note that: JP-ori-F: TAGTCCTGTCGGGTTTCGCC;

seq-CBh-R：GCCAAGTGGGCAGTTTACCG；

TABLE 13 example 1 colony PCR identification reaction procedure

The PCR product was subjected to electrophoresis, and a clone having a fragment size of 996bp was identified as a positive clone (positive clone No. P210910-01-C12).

(7) Plasmid extraction and sequencing

Specifically, the procedures for plasmid extraction and sequencing are as follows

Inoculating 5mL of bacterial liquid, and culturing at 37 ℃ by shaking overnight;

extracting plasmids by using a root DP103-3 plasmid small extraction kit;

sequencing by using JP-ori-F, and conforming the sequence to theory.

(8) Plasmid big lifter

The operational flow of the plasmid big extraction implementation is as follows:

inoculating 5mL of bacterial liquid, and culturing for 6-8 h at 37 ℃;

200 mu L of the bacterial liquid is sucked and inoculated into a conical flask containing 200ml of LB culture medium, and the bacterial liquid is cultured at 37 ℃ overnight;

plasmid lifting procedures were performed using the NucleoBond Xtra Midi EF (50) kit according to the instructions.

(6) Cell transfection and drug screening

According to the pre-experimental data of the cells, an electrotransformation method is selected to deliver the knocked-out plasmid into the cells, an instrument used by the electrotransformation method is NEON transfection system, the transfection efficiency is observed through fluorescence 24 hours after transfection, the transfection effect is shown in the following figure 11 (figure 11 is a bright field) and figure 12 (figure 12 is green fluorescence), and the transfection efficiency is about 70% and is higher than 40% by calculation.

And then carrying out drug screening according to the resistance carried on the carrier framework, wherein the antibiotic used in the drug screening is puromycin (Puro), the concentration of the drug screening is 1ug/ml, drug adding is started 24 hours after transfection, and the screening time is 3 days. After the screening is finished, part of cells are collected for efficiency verification.

(7) pool gene editing efficiency detection

The authentication scheme is shown in FIG. 13 below

The identification primers were as follows:

CK21-202-F1:CCCGTCGACCGATAGGAAC；

CK21-202-R1:CCGATAACGCCCTCACAGG；

CK21-202-F2:TCCATGGCTGACCGCTCCAG；

the collected pool cells are lysed by using a source well biological monoclonal identification kit (product number: YK-MV-1000), the lysate is subjected to PCR amplification and sequencing, the sequencing result is analyzed by a red cotton genotyping system (https:// www.rc-crispr. Com/tools/html), sequencing files of wild type cells and pool cells are required to be poured respectively, gRNA information is input, and the value of the pool cell cutting efficiency and the genotypes contained in the pool cells, the ratio of the genotypes, and the testing result are shown in FIG. 14. From FIG. 14, it can be seen that the genotype of the deletion 49bp is 98% according to the result of the intelligent sequencing peak diagram accurate analysis system, which shows that the editing efficiency is very high.

(8) Monoclonal preparation

Monoclonal formation rate according to pre-experimental hela: 30% -40%, and combining the pool efficiency with 98%, only a 96-well plate is required to be spread in a limiting dilution way, and 60 holes in the 96-well plate are selected for cell inoculation. The observation is carried out on the condition that the monoclonal grows for 6 days and 10 days, 22 monoclonal are grown, 25 polyclonal are grown, 13 polyclonal are grown, the observation is carried out after 10 days of growth, one of the monoclonal pictures is selected for observation, the monoclonal pictures are shown in fig. 15, the edge of the clone group is clear, the cell state is good, the number is about 500, and the clone group can be divided into two at the moment. The number of clones divided into two=2/(98% ≡5×0.9) ≡3 clones is required, the risk is high when the number of clones is small, and 5 clones are randomly selected for identification for insurance.

(9) Monoclonal genotyping

According to the operation instruction of a monoclonal identification kit (manufacturer: source well organism, product number: YK-MV-1000, which can be directly purchased in the market), cell samples are cracked to obtain crude DNA, PCR amplification is carried out according to designed primers, the amplified products run electrophoresis, preliminary screening is carried out according to electrophoresis bands, the clones positive to the preliminary screening are sent to first generation sequencing, the sequencing result is analyzed by a red cotton genotyping system (https:// www.rc-crispr. Com/tools/html), sequencing files of wild type cells and pool cells are required to be respectively poured, gRNA information is input, and the pool cell cutting efficiency value and genotypes contained in the pool cells can be obtained by clicking and submitting.

Clones positive for initial detection were further cultured to T75 cell flasks and cell cryopreserved using source well EZ-cro serum-free cryopreservation solution (cat# YK-CR-100).

Specifically, the PCR gel diagram for the single clone genotype identification is shown in FIG. 16, wherein M represents a marker, the front 1-6 are the products of amplification of 5 clones to be identified with one WT control using F1R1 primer, and the rear 1-6 are the products of amplification of 5 clones to be identified with one WT control using F2R 1. Wherein, the size of the F1R1 corresponding to the WT genotype product is 870bp, and the size of the F1R1 corresponding to the KO genotype product is 821bp; the F2R1 corresponds to 302bp of WT genotype product and the size of KO genotype product corresponds to 0bp.

As can be seen from the gel results of FIG. 16, the F1R1 bands of 4 and 5 are weak or absent, and may be the knockdown region is much larger than the theoretical region, resulting in primer amplification failure, insufficient genome cleavage or unsuccessful PCR, and 1 and 2 may be selected for sequencing verification based on the results 1, 2 and 3 being primary screening homozygous positive.

Sequencing results gave positive results for both 1 and 2, corresponding to cell clone numbers #a8 and #b1, respectively.

Among them, clone # A8 genotype (as shown in fig. 17): the deletion is 49bp. The deletion sequence is the underlined part, the lower case bases in the following sequence represent introns, the upper case bases represent exons, the sequence of clone #A8 is as follows:

of these, clone # B1 genotype (as shown in fig. 18): the deletion is 49bp. The deleted sequences are the following underlined parts:

according to the embodiment, the gene knockout method of the technical scheme improves the efficiency of cell gene editing, for example, the conventional editing efficiency of Hela cell pool is 30% -80%, and in the embodiment, according to the optimization measures of each link, the cutting effect of up to 98% can be achieved at the pool level. And only 5 clones were identified by culture, 2 KO homozygous cells were obtained. And the project period is shortened, the single clone is identified in advance by 2 weeks, the project speed is greatly improved, meanwhile, the material cost is reduced, only 5 clones are identified by precisely quantifying the pool cell cutting efficiency, and the labor and the material are greatly reduced.

The technical principle of the present invention is described above in connection with the specific embodiments. The description is made for the purpose of illustrating the general principles of the invention and should not be taken in any way as limiting the scope of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of this specification without undue burden.

Claims

1. A high efficiency cell line gene knockout method, comprising the steps of:

(1) Vector construction and plasmid preparation: the method comprises the steps of vector construction and plasmid preparation, namely sequentially comprising eight steps of gRNA primer synthesis, PCR amplification, skeleton linearization, vector splicing reaction, heat shock conversion, colony PCR identification and sequencing identification, plasmid extraction and sequencing and plasmid big lifting, so as to prepare knockout plasmid; the knockdown plasmid adopts YKO-RP003 as a vector skeleton, an insert sequence is added between a CMV promoter and a tag of the vector skeleton, and double gRNAs are arranged on the same vector skeleton to obtain the knockdown plasmid;

(3) pool gene editing efficiency detection: using a monoclonal identification kit to lyse the cells after the medicine screening in the step (2), carrying out PCR amplification and sequencing on the lysates, and analyzing the sequencing result by a red cotton genotype analysis system to obtain a pool cell cutting efficiency value, genotypes contained in the pool cells and the proportion of each genotype;

(5) Identification of monoclonal genotypes: and (3) splitting the monoclonal obtained in the step (4) by using a monoclonal identification kit, performing PCR amplification on the splitting product, performing electrophoresis detection on the amplification product, performing primary screening according to an electrophoresis strip, sequencing the clones positive to the primary screening, and analyzing the sequencing result by a red cotton genotype analysis system to judge whether the genotype accords with the knockout standard.

2. The efficient cell line gene knockout method according to claim 1, wherein the deletion of the sequence set forth in SEQ ID NO:1, and a sequence shown in 1.

3. The efficient cell line gene knockout method according to claim 1, wherein the insert sequence is: tctgtttaactaga.

4. The efficient cell line gene knockout method of claim 1, further comprising a project difficulty assessment step comprising gene assessment, gene targeting protocol design and cell pre-experiment and difficulty assessment prior to the vector construction and plasmid preparation of step (1).

5. The method of claim 4, wherein the gene evaluation is performed as follows: combining a red cotton gene risk assessment system and an expression level assessment system to determine whether the gene to be knocked out has a lethal risk and the expression condition in a target cell line, and if the assessment is passed, normally performing scheme design;

6. The method of claim 4, wherein the step (3) pool gene editing efficiency is measured by the following steps: and (3) using a monoclonal identification kit to lyse the collected pool cells, carrying out PCR amplification and sequencing on the lysate, analyzing the sequencing result through a red cotton genotype analysis system, introducing sequencing files of wild type cells and pool cells into the red cotton genotype analysis system, inputting gRNA information, and analyzing to obtain the cleavage efficiency value of the pool cells, the genotypes contained in the pool cells and the proportion of each genotype.

7. The method of claim 4, wherein the step (4) of preparing a monoclonal is performed as follows:

(4.4) aspiration of the culture medium from each well containing the monoclonal, rinsing with 100. Mu.L LPBS, aspiration, and addition of 20. Mu.L TrypLE ^TM The Express digests the cells into single cell suspension, then 200 mu L of complete culture medium is added, and after being evenly mixed, the cells are evenly distributed into 2 holes of a 96-well plate, so that the positions of the holes are in one-to-one correspondence;

(4.5) continuing culturing until the single-split monoclonal grows to more than 25% confluency, selecting a plate for primary screening, and setting the number of single-split clones to be X, wherein X=the number of homozygous clones to be required/(pool effective genotype ratio) ^{The highest copy number of chromosome karyotype of the cell} X the passage rate of the cell re-examination).

8. The method of claim 7, wherein the operation flow of the monoclonal genotyping in the step (5) is as follows: splitting the monoclonal obtained in the step (4) by using a monoclonal identification kit to obtain crude DNA, carrying out PCR amplification on the crude DNA according to a designed primer, carrying out electrophoresis detection on an amplified product, carrying out primary screening according to an electrophoresis strip, sequencing clones positive to the primary screening, analyzing a sequencing result by a red cotton genotype analysis system, and judging whether the genotype accords with a knockout standard; and (5) continuously culturing clones positive to the primary test to a T75 cell bottle, and performing cell cryopreservation by using serum-free cryopreservation liquid.

9. The method of claim 1, wherein in step (3) and step (5), the monoclonal assay kit used is selected from the group consisting of source well organisms, cat# YK-MV-1000.

10. The efficient cell line gene knockout method according to claim 1, wherein the efficient cell line gene knockout method is suitable for gene knockout of an infinitely passable mammalian cell line including tumor cell lines, immortalized cell lines and stem cells.