CN117106045A

CN117106045A - Rumex japonicus effector protein and application thereof in resisting Rumex japonicus

Info

Publication number: CN117106045A
Application number: CN202311368513.3A
Authority: CN
Inventors: 王晓杰; 王晓东; 汤春蕾; 王建锋; 康振生; 王宁
Original assignee: Shenzhen Research Institute Of Northwest University Of Agriculture And Forestry Science And Technology
Current assignee: Shenzhen Research Institute Of Northwest University Of Agriculture And Forestry Science And Technology
Priority date: 2023-10-23
Filing date: 2023-10-23
Publication date: 2023-11-24
Anticipated expiration: 2043-10-23
Also published as: CN117106045B

Abstract

The application belongs to the technical field of genetic engineering, and relates to a stripe rust effector protein and application thereof in stripe rust resistance. The nucleotide sequence of the secreted protein of the rust bacteria is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The stripe rust effector protein Pst_9 related in the application can induce the cell necrosis of the Nicotiana benthamiana. The nucleotide sequence of the stripe rust secreted protein provided by the application is introduced into wheat to obtain transgenic wheat which overexpresses Pst_9, and the resistance of the transgenic wheat which overexpresses Pst_9 to stripe rust is obviously improved. The application provides an anti-source material for wheat disease-resistant breeding and has important application value in agricultural production.

Description

Rumex japonicus effector protein and application thereof in resisting Rumex japonicus

Technical Field

The application belongs to the technical field of genetic engineering, and relates to a stripe rust effector protein and application thereof in stripe rust resistance.

Background

Wheat Stripe rust (strip rust) is one of major diseases which are harmful to wheat production, and pesticide control can reduce the harm caused by the Stripe rust to a certain extent, but consumes a large amount of financial resources and material resources, and is harmful to environmental safety and human health. The pathogenic bacteria rust of stripe rust is a stripe rust wheat specialization (Puccinia striiformis f.sp tritici, pst), which produces new pathogenic micro-species through frequent toxic variation, resulting in the loss of resistance of many newly cultivated superior varieties.

Effector proteins are important pathogenic factors secreted by pathogenic bacteria, and a large number of effector proteins can suppress immune responses of hosts, but some effector proteins can be recognized by cell membrane receptors of plants in apoplasts and stimulate plant immunity. Research on the effector proteins of stripe rust bacteria is relatively lagging with respect to bacteria, oomycetes, and other fungi, and particularly, the effector proteins with exciton functions are freshly reported. Therefore, the identification of effector protein with the activity of the exciton of the rust bacteria, the utilization of the exciton to improve the disease resistance of the wheat, and the method has important significance for realizing broad-spectrum and durable disease resistance breeding of the wheat.

Disclosure of Invention

The purpose of the present application is to improve the resistance of plants to rust.

Based on the above objects, the present application addresses this need in the art by providing a stricken effector protein and its use against stricken bacteria.

In one aspect, the application relates to a stripe rust effector protein, and a nucleotide sequence for encoding the stripe rust effector protein is shown as SEQ ID NO. 1.

Furthermore, in the stripe rust effector protein provided by the application, the amino acid sequence of the stripe rust effector protein is shown as SEQ ID NO. 2.

In another aspect, the application relates to an expression vector comprising a nucleotide sequence as described above encoding said Rhizoctonia effector protein. Specifically, the nucleotide sequence of the trichlamycin provided by the application is inserted into one of vectors pGR, pCambia1302 and pANIC 6E.

In another aspect, the application relates to a recombinant bacterium comprising the expression vector described above.

In another aspect, the application relates to a recombinant agrobacterium comprising the expression vector described above.

In another aspect, the application relates to the use of a stripe rust effector protein in the improvement of a stripe rust resistant plant variety comprising: the nucleotide sequence encoding the rust effector protein is introduced into a recipient plant.

In another aspect, the application relates to the use of the expression vector described above for the improvement of a rust resistant plant variety.

On the other hand, the application relates to the application of the recombinant bacterium in the cultivation of the rust-resisting plant variety.

In another aspect, the application relates to the use of the recombinant Agrobacterium described above in the cultivation of a rust resistant plant variety.

Specifically, the receptor plant is a dicotyledon or a monocotyledon; the dicotyledonous plant is Nicotiana benthamiana or Arabidopsis thaliana; the monocot is wheat.

Compared with the prior art, the application has the following beneficial effects or advantages:

(1) The application discloses the functions of the stripe rust effector protein Pst_9 in the interaction process with plants for the first time, is an effector protein with the activity of an exciton, improves the disease resistance of plants by utilizing the effector protein, and has important significance for realizing the breeding of stripe rust resistant plants and improving the broad-spectrum and durable disease resistance of the plants against stripe rust bacteria.

(2) The encoding gene of the stripe rust effector protein Pst_9 is introduced into recombinant bacteria to infect a receptor plant, so that the stripe rust resistance of the receptor plant can be improved.

(3) The application has great significance in breeding the wheat anti-stripe rust strain. After transgenic cultivation, the application provides that the stripe rust effector protein Pst_9 is overexpressed in wheat leaves, so that the resistance of wheat to stripe rust can be obviously enhanced.

Drawings

In order to more clearly illustrate the embodiments of the application or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the application, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows necrosis of the leaf of Benshi tobacco after injection of different plasmids. pst_9-pGR106 is a recombinant vector with pst_9 ligated to the pGR106 plasmid; GFP-pGR is a recombinant vector in which the coding frame sequence fused to the GFP sequence of pst_9 is ligated to the pGR106 plasmid; pst_9SP-GFP-pGR106 is a recombinant vector in which the coding box sequence fused to the GFP sequence was ligated to the pGR plasmid with the Pst_9 ligation signal peptide; pst_9-nosp-pGR106 is a recombinant vector in which the coding frame sequence of the Pst_9 removed signal peptide was ligated to the pGR plasmid.

FIG. 2 shows the identification of Pst_9 overexpressing wheat positive plants by GUS staining technique. WT means wild type wheat variety Fielder without genetic modification; pst_9-OE represents transgenic wheat overexpressing Pst_9.

FIG. 3 shows the phenotype of Pst_9 overexpressed wheat and wild-type wheat inoculated with Rhizoctonia cerealis CYR 32. WT means wild type wheat variety Fielder without genetic modification; pst_9-OE represents transgenic wheat overexpressing Pst_9; l1 represents the strain Line1 of Pst_9-OE transgenic wheat; l2 represents the strain Line2 of Pst_9-OE transgenic wheat.

FIG. 4 shows the immune response of Pst_9 overexpressing wheat and wild-type wheat after inoculation with Rhizoctonia cerealis CYR 32. WT means wild type wheat variety Fielder without genetic modification; l1 represents the strain Line1 of Pst_9-OE transgenic wheat; l2 represents the strain Line2 of Pst_9-OE transgenic wheat; taPR1 represents a disease course-related gene 1 in wheat; taPR2 represents disease course related gene 2 in wheat; * Represents P <0.05, and P <0.01.

Detailed Description

The following description of the embodiments of the present application will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present application, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

The experimental methods and the detection methods in the following embodiments are all conventional methods unless otherwise specified; the medicaments and materials are commercially available unless specified; the index data are all conventional measurement methods unless specified.

Example 1

This example provides a test for induction of plant immunity and cell necrosis by the Rhizoctonia solani effector protein (Pst_9) provided by the present application.

The full-length coding frame sequences of Pst_9 and GFP, the coding frame sequence of Pst_9 signal peptide sequence (1-60 bp) fused with GFP, and the coding frame sequence of Pst_9 removed signal peptide (61-726 bp) were obtained by PCR using NotI and ClaI restriction endonuclease double-digested pGR plasmids, respectively. The coding frame sequences obtained by PCR were ligated into the NotI, claI double digested pGR plasmid. See Thermo Scientific for specific recombination procedures. The recombinant plasmid is transformed into escherichia coli DH5 alpha, and the cloning with positive and correct sequencing is identified by PCR, thus obtaining the expression vector containing the target gene.

Plasmids of pst_9-pGR106, GFP-pGR106, pst_9SP-GFP-pGR106, pst_9-nosp-pGR106 were transformed into agrobacterium strain GV3101, respectively, positive monoclonal was identified by PCR, picked up in an ultra clean bench into LB medium containing kanamycin and rifampicin, placed in a shaker, and incubated overnight at 220rpm, 28 ℃ to od600=1.0.

Pst_9-pGR106 is a recombinant vector with Pst_9 ligated to the pGR106 plasmid. GFP-pGR is a recombinant vector in which the coding frame sequence of pst_9 fused to the GFP sequence was ligated into the pGR106 plasmid. Pst_9SP-GFP-pGR106 is a recombinant vector in which the coding box sequence fused to the GFP sequence was ligated to the pGR plasmid with the Pst_9 ligation signal peptide. Pst_9-nosp-pGR106 is a recombinant vector in which the coding frame sequence of the Pst_9 removed signal peptide was ligated to the pGR plasmid.

The nucleotide sequence of the encoding effector protein Pst_9 is shown in SEQ ID NO. 1. The nucleotide sequence of Pst_9SP-GFP is shown as SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 4. The nucleotide sequence of Pst_9-nosp is shown as SEQ ID NO.5, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 6. The Signal Peptide (SP) sequence of pst_9 is:

“ATGATTAAAGCTTCAGTAGTCGCCTTGTGCATGTTCTTGCTAGGGTCAAGCGTTTCCGCC”。

agrobacterium cells were collected by centrifugation at 4000 rpm and 10 mM MgCl was used ₂ The cells were resuspended, centrifuged again, resuspended in AS buffer and the concentration was adjusted to od600=0.3. After the treated agrobacterium was left in the dark for 1h, the bacterial liquid was injected into 3 weeks of tobacco leaves using a syringe. The necrosis of the injection site of tobacco leaf was observed 3 days after injection, and photographed, and the photographing result is shown in fig. 1. In FIG. 1, the upper left corner of the leaf is the injection of the plasmid Agrobacterium containing Pst_9-pGR, the upper right corner of the leaf is the injection of the plasmid Agrobacterium containing GFP-pGR, the lower left corner of the leaf is the injection of the plasmid Agrobacterium containing Pst_9SP-GFP-pGR, and the lower right corner of the leaf is the injection of the plasmid Agrobacterium containing Pst_9-nosp-pGR.

As can be seen from FIG. 1, the leaf site injected with the plasmid Agrobacterium containing Pst_9-pGR produced necrosis, whereas the leaf site injected with the control with the plasmid Agrobacterium containing GFP-pGR did not produce cell necrosis, indicating that Pst_9 was able to cause tobacco cell necrosis.

Example 2

This example provides the generation of pst_9 gene over-expressed transgenic wheat and disease resistance identification assays.

The full-length coding frame sequence of the Pst_9 gene is obtained by utilizing a PCR technology, and the obtained full-length coding frame sequence of the Pst_9 gene is connected to an intermediate vector pDONR221 by utilizing a Gateway beta-BP close enzyme II enzyme. The constructed Pst_9-pDONR221 vector was linearized with restriction endonuclease NruI, and the linearized Pst_9-pDONR221 sequence was ligated to the pANIC6E vector, which is the target vector, using gateway_9-pDONR 221 enzyme, see restriction endonuclease from Thermo Scientific and Gateway BP Clonase II, gateway LR Clonase II instructions. The recombinant plasmid is transformed into escherichia coli DH5 alpha, and the PCR identification is positive and the clone with correct sequencing is the overexpression vector containing the pst_9 gene.

The wheat variety Filler immature embryo callus is used as a transformation receptor, an agrobacterium-mediated method is adopted to introduce a pst_9 gene over-expression vector into a receptor material, and after co-culture with agrobacterium EHA105, the steps of screening, regenerating, rooting and the like of glufosinate-ammonium resistant callus are carried out to generate T0 generation transgenic plants.

Tender fragments of about 2cm were collected from wheat two leaves, soaked in GUS staining solution purchased from Beijing Cool Lei technology Co., ltd., -100 pka was air-extracted for 15 minutes, incubated overnight at 37℃in the dark, and decolorized 2-3 times in 70% ethanol until the negative control material was white, and positive lines were selected, and GUS staining results are shown in FIG. 2.

And (3) generating offspring by selfing the T0 generation transgenic plant, and selecting two independent pst_9 overexpression transgenic lines for rice blast resistance identification. The T3 generation pst_9 over-expressed transgenic material is sown in holes in 15 multiplied by 15cm flowerpots, 9 seeds are sown in each hole, meanwhile, the wild variety Fielder is sown, and the wild variety Fielder is placed at 16 ℃ and grown to the two-leaf stage under 16 h light/8 h dark conditions.

Fresh leaf of wheat was inoculated with a wheat second leaf with a wheat virulent race CYR32, moisturized for 24 hours at 12℃in the dark, then transferred to 16℃and cultured at 16 h light/8 h in the dark, investigated for the onset of rust after fourteen days, photographed, and the photographing results are shown in FIG. 3.

As can be seen from FIG. 3, pst_9 overexpresses the rust on the transgenic wheat leaves with significantly less summer spore pile than the wild-type plants.

Wheat leaf RNA of 24h after inoculation is extracted, and a first strand of cDNA is synthesized by reverse transcription with HiScript of Novain company (see reverse transcriptase specification for method), wherein the cDNA is used as a template, and TaEF is used as an internal reference gene (TaEF amplification primer is: taEF-F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3'; taEF-R: 5'-ACTCATGGTGCATCTCAACGGACT-3'). The immune response in wheat was analyzed by RT-qPCR using plant immune related genes TaPR1 (amplification primers TaPR1-F: 5'-GAGAATGCAGACGCCCAAGC-3'; taPR1-R: 5'-CTGGAGCTTGCAGTCGTTGATC-3') and TaPR2 (amplification primers TaPR2-F: 5'-AGGATGTTGCTTCCATGTTTGCCG-3'; taPR2-R: 5'-AAGTAGATGCGCATGCCGTTGATG-3') as primers, and the test results are shown in FIG. 4.

As shown in FIG. 4, the expression level of TaPR1 and TaPR2 in the Pst_9 over-expressed transgenic wheat is significantly higher than that of the wild wheat, and the result shows that the Pst_9 over-expression can enhance the resistance of the wheat to the stripe rust.

The present application may be better implemented as described above, and the above examples are merely illustrative of preferred embodiments of the present application and not intended to limit the scope of the present application, and various changes and modifications made by those skilled in the art to the technical solution of the present application should fall within the scope of protection defined by the present application without departing from the spirit of the design of the present application.

Claims

1. The application of the stripe rust effector protein Pst_9 in the improvement of stripe rust resistant wheat varieties is characterized in that the amino acid sequence of the stripe rust effector protein Pst_9 is shown as SEQ ID NO.2, and the nucleotide sequence of the encoding stripe rust effector protein Pst_9 is shown as SEQ ID NO. 1;

the stripe rust effector protein Pst_9 can induce cell necrosis of the Nicotiana benthamiana;

overexpression of the stripe rust effector protein pst_9 increases wheat resistance to stripe rust.

2. The application of the nucleotide sequence for encoding the stripe rust effector protein Pst_9 in the improvement of stripe rust resistant wheat varieties is characterized in that the amino acid sequence of the stripe rust effector protein Pst_9 is shown as SEQ ID NO. 2.

3. A method for improving a wheat variety resistant to stripe rust comprising overexpressing the stripe rust effector protein pst_9 of claim 1 in a wheat plant.