CN117004637A

CN117004637A - Application of AGPase small subunit in improving yield of root crops

Info

Publication number: CN117004637A
Application number: CN202210463547.XA
Authority: CN
Inventors: 杨俊�; 王红霞; 范维娟
Original assignee: SHANGHAI CHENSHAN BOTANICAL GARDEN
Current assignee: SHANGHAI CHENSHAN BOTANICAL GARDEN
Priority date: 2022-04-28
Filing date: 2022-04-28
Publication date: 2023-11-07

Abstract

The application provides an effect of small subunit of AGPase in improving the yield trait or plant type trait of root crops. The application discloses a novel regulation mechanism of AGPase small subunit for root crops, which prepares root crops with variable characters and has important significance for genetic improvement of the characters of the root crops.

Description

Application of AGPase small subunit in improving yield of root crops

Technical Field

The application belongs to the field of biotechnology and botanics, and in particular relates to application of small subunit of AGPase in improving the yield of root crops.

Background

Root crops are a type of terrestrial plants (crops) with an enlarged root system, the root of which is formed by local enlargement of lateral or adventitious roots. A plurality of tuberous roots can be formed on a root crop, the tuber crop is composed of a part without hypocotyl and stem, and is completely composed of roots, and the tuberous roots of sweet potato and polygonum multiflorum belong to the same category. The sweet potato tubers have irregular shapes, about 20-30 days after planting, wherein some adventitious roots begin to expand to form tubers. The main components in the root tuber are starch and sugar, and the root tuber is a storage root, wherein the root tuber contains a large amount of water and a small amount of protein.

Sweet potato is used as a common root tuber crop, has the characteristics of high light, heat and water resource utilization efficiency, high biomass per unit area, high starch content, suitability for being planted in arid barren lands without competing with grains for the lands and the like, and is the most promising energy crop at present. Sweet potato is an important grain, feed and industrial raw crop in the world, and has important effects in the aspects of ensuring biomass energy, grain safety and the like. The sweet potato belongs to the family Convolvulaceae, the genus sweet potato and the species sweet potato are vining herbaceous plants. Sweet potato plants can be divided into root, stem, leaf, flower, fruit, seed, etc. Sweet potato is not only an important grain crop, but also an important raw material for the food processing industry, and has rich nutritive value. Therefore, the sweet potato variety optimization and research on cultivation and regeneration technology have important significance. Common plants with root tuber structure like sweet potato also: cassava, polygonum multiflorum, and the like.

Storage roots of root crops are important energy storage organs, and development of the storage roots is a complex biological process including expansion initiation, subsequent thickening and the like. These processes are not only regulated by endogenous hormones and genes, but also by the external environment. However, little is known about the molecular mechanisms that regulate the development of storage root expansion.

Meanwhile, the starch processing industry using plant tubers as raw materials is in a development stage, but the processing of various products puts diversified demands on the starch quality of the raw materials (such as the content ratio of amylose and amylopectin). The traditional breeding is relied on to change the quality of starch, so that the time consumption is long, a large amount of manpower and material resources are required, and the urgent requirements of the starch processing industry are difficult to meet. The search for proteins related to starch production has been of industrial interest in attempts by those skilled in the art to regulate the composition and content of starch in plants by regulating the major genes of starch synthesis.

In view of the above, there is a need in the art to develop superior genes capable of controlling tuberous root storage in tuberous root crops, thereby providing a new approach for plant improvement.

Disclosure of Invention

The application aims to provide an application of small subunit of AGPase in improving the yield of root crops.

In a first aspect of the application there is provided a method of improving (optimising) the yield or plant type trait of a root crop or preparing a root crop with improved yield or plant type trait comprising: up-regulating the expression or activity of small subunit of AGPase in root crops.

In one or more embodiments, the improved root crop yield traits are: increasing the biomass or yield of the root tuber, increasing the starch content in the root tuber and/or increasing the biomass of the aerial parts.

In one or more embodiments, the plant type traits of the improved root crop are: promote plant type thickening (increased stem thickness), reduce the internode spacing of the stems, and/or increase leaf area.

In one or more embodiments, the up-regulating the expression or activity of a small subunit of AGPase comprises: transferring the coding gene of the AGPase small subunit or an expression construct or a vector containing the coding gene into root crops;

performing functional acquisition mutation on the small subunit of AGPase; promoting the expression of the small subunit of AGPase with an expression-enhanced promoter or a tissue-specific promoter; or to promote expression of small subunits of AGPase with enhancers.

In another aspect of the application there is provided the use of a small subunit of AGPase, or an upregulation thereof, for: improving (optimizing) the yield or plant type character of the root crops or preparing the root crops with improved yield or plant type character.

In one or more embodiments, the small subunit AGPase upregulators include: exogenous AGPase small subunit coding gene or expression construct or vector containing the coding gene.

In one or more embodiments, the expression construct includes an enhanced promoter, a tissue-specific promoter, or an enhancer; or, an agent that performs a functional point mutation on a small subunit of AGPase; preferably, the agent reverts the mutant to the wild-type small subunit of AGPase in root crops in which the mutation of small subunit of AGPase has occurred.

In one or more embodiments, the term up-regulation, promotion, increase or enhancement means significant up-regulation, promotion, increase or enhancement, up-regulation, promotion, increase or enhancement by 20%, 40%, 60%, 80%, 90% or more.

In one or more embodiments, the term reduced indicates a significant reduction, such as a 20%, 40%, 60%, 80%, 90% or less reduction.

In one or more embodiments, the small subunit of AGPase includes homologs thereof (e.g., root crops other than sweet potato, genes/proteins having sequence homology and functionally identical to the small subunit of AGPase).

In one or more embodiments, the root crop is a plant containing a small subunit of AGPase or a homologue thereof.

In one or more embodiments, the root crops include (but are not limited to): sweet potato, cassava, potato, yam, taro, kudzuvine root, konjak, jerusalem artichoke, yacon, pseudo-ginseng and fleece-flower root.

In one or more embodiments, the amino acid sequence of the small subunit of AGPase is selected from the group consisting of:

(i) A polypeptide of the amino acid sequence shown in SEQ ID NO. 2;

(ii) The polypeptide which is formed by substituting, deleting or adding one or a plurality of (such as 1-30, 1-20, 1-10, 1-5, 1-3) amino acid residues of the amino acid sequence shown as SEQ ID NO. 2, has the regulatory character function and is derived from (i);

(iii) The homology of the amino acid sequence with the amino acid sequence shown in SEQ ID NO. 2 is more than or equal to 80 percent (preferably more than or equal to 85 percent, more than or equal to 90 percent, more than or equal to 95 percent or more than or equal to 98 percent), and the polypeptide has the function of regulating and controlling the characters;

(iv) An active fragment of a polypeptide of the amino acid sequence shown in SEQ ID NO. 2; or (b)

(v) A tag sequence or an enzyme cleavage site sequence is added to the N-terminus or the C-terminus of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2, or a signal peptide sequence is added to the N-terminus thereof.

In another aspect of the application there is provided the use of a small subunit of AGPase (including a gene or protein) as a molecular marker for identifying the traits of root crops; the traits include: yield or plant type traits.

In one or more embodiments, the yield trait is: biomass or yield of tuberous root, starch content in tuberous root, biomass of overground part; or, the plant type trait is: stem thickness, pitch spacing of stems, and/or leaf area.

In one or more embodiments, the trait of a plant is identified by analyzing the expression level of small subunits of AGPase in the plant; if the expression level of the small subunit of AGPase in the plant to be detected is equal to or higher than the average expression level of the small subunit of AGPase in the plant, the biomass or the yield of the tuberous root is improved, the starch content in the tuberous root is improved and/or the biomass of the overground part is increased; or, its plant type is strong (stem thickness increases), the internode spacing of the stems decreases, and/or the leaf area increases.

In one or more embodiments, the trait is undesirable if the amount of expression of the small subunit of AGPase in the plant to be tested is equal to or less than the average amount of expression of the small subunit of AGPase in that plant.

In another aspect of the application, there is provided a method of directionally selecting or identifying root crops, the method comprising: identifying expression or sequence characteristics of small subunits of AGPase in the root crop of the test tuberous crop; if the AGPase small subunit of the root crop is tested to be expressed in high degree, the root crop is a plant with high yield; if the AGPase small subunit of the test root crop is expressed low or not, it is a plant with low yield.

In one or more embodiments, the high expression or activity includes a statistically significant increase in expression or activity as compared to the average value of expression or activity of a similar or identical root crop.

In one or more embodiments, the low expression or activity includes a statistically significant reduction in expression or activity as compared to the average value of expression or activity of a similar or identical root crop.

In another aspect of the application, there is provided a method of screening for substances (potential substances) that enhance yield traits in root crops, comprising: (1) Adding a candidate substance into a system for expressing small subunits of AGPase; (2) The system is tested for expression or activity of small subunits of AGPase, and if the expression or activity is increased, the candidate substance is a substance which can be used for improving the yield traits of root crops.

In one or more embodiments, the method further comprises providing a control group to specifically identify differences in AGPase small subunit expression or activity in the test group from the control group.

In one or more embodiments, the candidate substance includes (but is not limited to): regulatory molecules designed against small subunits of AGPase or genes encoding them or their upstream or downstream proteins or genes (e.g., modulators, small molecule compound gene editing constructs, etc.).

In one or more embodiments, the system is selected from, but is not limited to: plant cell systems (or cell culture systems), subcellular systems (or subcellular culture systems), solution systems, tissue systems, organ systems, and the like.

In another aspect of the application, there is provided a plant cell, tissue or organ, which expresses an exogenous small subunit of AGPase or a homologue thereof; preferably, the expression cassette comprises: a promoter, a gene encoding a small subunit of AGPase or a homologue thereof, a terminator; preferably, the expression cassette is comprised in a construct or expression vector.

In one or more embodiments, the plant cell, tissue or organ is a non-plant propagation material, or it does not regenerate into a living plant.

Other aspects of the application will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, manhattan diagram of small subunit of AGPase (IbAGPS).

FIG. 2, construction of a binary gene expression cassette integrated in a pCAMBIA1301 vector, with the upper over-expression vector and the lower RNAi vector.

FIG. 3, transgenic plant gene expression (upper) and AGPase enzyme activity assay (lower).

FIG. 4, change in growth of aerial parts of transgenic plants after 1 month of greenhouse growth.

FIG. 5 leaf growth of transgenic plants changed after 1 month of greenhouse growth.

FIG. 6, root growth variation of transgenic plants after 2 months of greenhouse growth.

FIG. 7, root tuber yield and lignin and starch content of transgenic plants varied after 3 months of greenhouse growth.

Detailed Description

The inventors of the present application have conducted intensive studies to reveal the role of small subunit of AGPase (AGPS) in regulating the yield traits or plant type traits of root crops. The application discloses a novel mechanism participated by small subunit of AGPase, which has important significance for genetic improvement of root crop traits.

Target point of target regulation and control

As used herein, unless otherwise indicated, the small subunit of AGPase refers to a polypeptide having the sequence shown in SEQ ID NO. 2 or a gene encoding the same, and includes variants of the sequence having the same function as the small subunit of AGPase. The coding gene can be gDNA or cDNA, and can also comprise a promoter.

Such variant forms of small subunits of AGPase include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually 30 or less, preferably 20 or 10 or less, for example 5, 3 or 2 or less) amino acids at the C-terminus and/or the N-terminus. Any polypeptide having a high homology (e.g., a homology of 70% or more to the polypeptide sequence shown in SEQ ID NO: 2) with the small subunit of AGPase; preferably the homology is 80% or more; more preferably, a protein having homology of 90% or more, such as homology of 95%,98% or 99%) and having the same function as the small subunit of AGPase is also included in the present application. Polypeptides derived from other species than sweetpotato that have higher homology to the polypeptide sequence of the sequence shown in SEQ ID NO. 2, or that exert the same or similar effect in the same or similar regulatory pathways, are also encompassed by the present application.

In the present application, the "small subunit of AGPase" also includes homologues thereof. It should be understood that while the small subunit of AGPase obtained from sweet potato of a particular species is preferably studied in the present application, other polypeptides or genes obtained from other species that are highly homologous (e.g., have more than 60%, such as 70%,80%,85%, 90%, 95%, even 98% sequence identity) to the small subunit of AGPase are also within the contemplation of the present application.

The polynucleotide (gene) encoding the small subunit of AGPase may be a natural gene from plants or may be a degenerate sequence thereof.

Vectors comprising the coding sequences and host cells genetically engineered with the vectors or polypeptide coding sequences are also included in the application. Methods well known to those skilled in the art can be used to construct vectors containing suitable expression.

The host cell is typically a plant cell. Generally, the transformed plants may be transformed by Agrobacterium transformation or gene gun transformation, for example, leaf disk method; preferred is the Agrobacterium method. Plants can be regenerated from the transformed plant cells, tissues or organs by conventional methods to obtain plants with altered traits relative to the wild type.

Method for improving root crops

As used herein, the term "crop" or "plant" includes plants expressing small subunits of AGPase, as well as homologues of small subunits of AGPase. According to the knowledge in the art, plants exist with small subunits of AGPase, the inherent mechanism of action of which is as claimed in the present application, which can achieve the technical effects as claimed in the present application. In some preferred embodiments, the plant is a root crop (crop). Preferably, the root crops may include (but are not limited to): sweet potato, cassava, potato, yam, taro, kudzuvine root, konjak, jerusalem artichoke, yacon, pseudo-ginseng, fleece-flower root and the like.

In the work of the present inventors, it was identified that the small subunit of AGPase (IbAGPS) was associated with root tuber yield by GWAS analysis of the sweet potato hybrid population.

Further studies showed that transgenic plants with down-regulated small subunits of AGPase had significantly increased stem length, significantly increased internodes, significantly attenuated diameter, elongated plants, reduced dry matter content, and increased lignin content. And the stem length of the AGPase small subunit over-expressed plant is obviously shortened, the internode is also obviously shortened, the diameter is obviously thickened, the plant is thickened, and the dry matter content is increased.

Further studies showed that the leaves of transgenic plants with down-regulated small subunits of AGPase decreased, the measured leaf area decreased, the starch content significantly decreased, the sucrose content increased, and the fructose and glucose content decreased. And the leaf blade of the AGPase small subunit over-expression plant is increased, the measured leaf area is obviously increased, and the starch content is obviously increased.

Further studies have shown that the root system of transgenic plants with down-regulated small subunits of AGPase is not enlarged, the root tuber yield is significantly reduced, the lignin content is significantly increased, and the starch content is significantly reduced. And the root tuber yield of the AGPase small subunit over-expressed plant is obviously improved (comprising volume increase and weight increase), the lignin content is not obviously changed, and the starch content is obviously increased.

The above results show that small subunits of AGPase are necessary for the yield of root crops, and that small subunits of AGPase can increase the yield of root crops.

Based on the new findings of the present inventors, the present application provides a method of improving a plant, the method comprising: the expression or activity of the small subunit of AGPase in the plant body is improved, the yield property of the root crops is further improved, and the yield of the root crops is promoted.

As used herein, the term "improving (or enhancing) a root crop yield trait" includes: increasing the biomass or yield of the root tuber, increasing the starch content in the root tuber and/or increasing the biomass of the aerial parts.

As used herein, the "plant type traits of the improved root crops" include: promote plant type thickening (increased stem thickness), reduce the internode spacing of the stems, and/or increase leaf area.

As used herein, the term "aerial part" also referred to as "aerial part" refers to a part of the tissue of a plant that is located on the ground or above the surface of the culture medium when the plant is planted in the ground or cultured in the culture medium. In the application, the height of the overground part is the same as the plant height.

It will be appreciated that after the function of the small subunit of AGPase is known, various methods well known to those skilled in the art may be employed to modulate the expression or activity of the small subunit of AGPase. For example, the small subunit of AGPase may be overexpressed by a variety of methods well known to those skilled in the art.

In the application, the up-regulator of the AGPase small subunit or the coding gene thereof comprises an accelerator, an agonist and an activator. The "up-regulation", "promotion" includes "up-regulation", "promotion" of protein activity or "up-regulation", "promotion" of protein expression, and they are "up-regulation", "promotion" of protein activity in a statistical sense. Any substance that can increase the activity of the small subunit of AGPase, increase the stability of the small subunit of AGPase, up-regulate the expression of the small subunit gene of AGPase, increase the effective duration of the small subunit of AGPase, increase the phosphorylation/activation level of the respective protein can be used in the present application as a substance useful for up-regulating the small subunit of AGPase. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecules may be nucleic acid-level (including DNA, RNA) or protein-level.

The application also provides a method for up-regulating the expression of small subunits of AGPase in plants, which comprises the following steps: and transferring the coding gene of the AGPase small subunit or an expression construct or a vector containing the coding gene into plants.

In root tuber plants, it is possible to find a class of proteins that interact with the small subunit of AGPase to inhibit the action of the small subunit of AGPase, and down-regulating such proteins or genes encoding them is beneficial to up-regulating the expression or activity of the small subunit of AGPase. Methods of down-regulating such proteins or genes encoding them in plants include, but are not limited to: targeted mutation, gene editing or gene recombination is performed, thereby achieving down-regulation. For example, a method of down-regulating expression of a particular protein or gene encoding the same in a plant comprises: (1) Transferring the interfering molecules interfering with expression into plant cells, tissues, organs or seeds to obtain the plant cells, tissues, organs or seeds transferred into the interfering molecules; (2) Regenerating a plant from the plant cell, tissue, organ or seed obtained in step (1) into which the interfering molecule has been introduced. Preferably, the method further comprises: (3) Selecting a plant cell, tissue or organ into which the vector has been transferred; and (4) regenerating the plant cells, tissues or organs of step (3) into a plant.

The technical scheme of the application can be applied to molecular design breeding for various ways.

The application also provides genetically engineered host cells, tissues or organs that express an expression cassette for an exogenous small subunit of AGPase or a homolog thereof; preferably, the expression cassette comprises: a promoter, a gene encoding a small subunit of AGPase or a homologue thereof, a terminator; preferably, the expression cassette is comprised in a construct or expression vector. Generally, agrobacterium transformation, gene gun transformation, or the like can be used for transforming plants.

Molecular marker or targeting screening

In previous studies in the field, the function of the small subunit of AGPase in regulating the yield trait/plant type trait of root tuber plants was not analyzed and studied, and the inventors discovered this regulation effect of the small subunit of AGPase for the first time. Based on this finding by the inventors, the present application also relates to the use of small subunits of AGPase as molecular markers, which can be used as tracking markers for the offspring of genetically transformed plants. The application also includes methods for early determination of drought tolerance in plants by detecting expression or activity of small subunits of AGPase in plants.

After the function of the small subunit of AGPase is known, the small subunit of AGPase can be used as a molecular marker for the directional screening of root crops. Substances or potential substances that directionally regulate the yield traits of root crops by modulating this mechanism can also be screened based on this new discovery.

On this basis, the application provides a method for directionally selecting or identifying root crops, which comprises the following steps: identifying expression or sequence characteristics of small subunits of AGPase in the test plants; if the test plant is highly expressed in the small subunit of AGPase (as compared to control plants), it is a plant that can be used to enhance the yield traits of the root crop.

As used herein and as will be appreciated by those skilled in the art, selection of an appropriate "control plant" is a routine part of an experimental design and may include a corresponding wild-type plant or a corresponding transgenic plant without the gene of interest. The control plants are generally of the same plant species or even varieties which are identical to or belong to the same class as the plants to be evaluated. The control plant may also be an individual who has lost the transgenic plant due to isolation. Control plants as used herein refer not only to whole plants, but also to plant parts, such as root tuber parts.

The application provides a method for adjusting the yield traits of root crops, which comprises the following steps: (1) Adding a candidate substance into a system for expressing small subunits of AGPase; (2) The system is tested for expression or activity of small subunits of AGPase, and if the expression or activity is increased, the candidate substance is indicated to be useful for increasing the yield of root crops.

Methods for screening for substances that act on a target site, either on a protein or on a gene or on a specific region thereof, are well known to those skilled in the art and can be used in the present application. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the person skilled in the art how to select a suitable screening method.

Through large-scale screening, a potential substance which specifically acts on small subunits of AGPase and has a regulating effect on the yield traits of root crops can be obtained.

The application will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental procedures, which are not specifically noted in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, or according to the manufacturer's recommendations.

Materials and methods

1. Experimental method

1. Sweet potato GWAS analysis

And carrying out large-scale investigation, genetic positioning and GWAS analysis on various agronomic characters (leaf shape, leaf color, root tuber quantity, root tuber yield, root bark color and the like) and gene expression quantity data of the sweet potato hybrid population. Through research analysis, the inventors identified genetic loci and candidate genes that control these traits, wherein the small subunit of AGPase located on chromosome 13 (IbAGPS) is closely related to root tuber yield, and conducted further agronomic trait regulatory studies on the small subunit gene of AGPase.

2. Vector construction

The sweetpotato leaf cDNA is used as a template, the target gene IbAGPS is obtained through PCR amplification, the full-length gene is inserted into a pCAMBIA1301 vector to construct a binary over-expression vector, and an RNAi binary expression vector is constructed.

3. Genetic transformation of sweet potato

Adopts an agrobacterium-mediated embryogenic suspension cell genetic transformation system, and obtains the transgenic sweet potato through an embryo regeneration way. Agrobacterium tumefaciens containing binary vector is cultured to OD in liquid YEB containing corresponding antibiotic ₆₀₀ After centrifugation at 6000rpm at 4℃for 10min to collect the cells, the same volume of LCP-AS was resuspended and washed, and centrifuged again, the pellet was suspended in 1/2 volume of LCP-AS to adjust OD ₆₀₀ To 1.0 for use. Washing the embryogenic callus of sweet potato with LCP, soaking in the prepared dyeing solution, vacuumizing for 10-20min, and dryingThe dye solution is transferred to sterilized filter paper (spread on SBM-AS), and cultured in an illumination incubator for 4 days, the parameters are set to 25 ℃ and 50% relative humidity, 16h illumination, 8h darkness, and the light intensity is about 50 mu mol m ^-2 s ^-1 。

Washing the co-cultured callus three times with sterile water, washing 200mg/L of cephalosporin twice, transferring to a hygromycin-containing culture medium for screening and regeneration, culturing for 1-2 months, transferring the obtained resistant embryoid to a hygromycin-free culture medium, and continuously culturing and germinating to form sweet potato plantlets.

4. Real-time PCR detection

1. Mu.g of total RNA was synthesized under the action of reverse transcriptase ReverTraace (TRT-101, TOYOBO, shanghai) in a 20. Mu.L reaction system and used for Real-time PCR detection.

The PCR reaction was performed on a Bio-Rad CFX96 fluorescent quantitative PCR apparatus, and a 20. Mu.L system comprising 2 XSYBR Master Mix (cat. No. QPK-201, TOYOBO, shanghai) 10. Mu.L, cDNA 50ng,Forward Primer and Reverse Primer each 400nmol L-1.

The reaction conditions are as follows: denaturation at 95℃for 1min; denaturation at 95℃for 15sec, annealing at 60℃for 30sec,40-50 cycles; the action gene is used as an internal reference.

Three replicates per sample, the relative expression of the detected genes was calculated from the relative Ct values, and the relative expression of each gene in a single sample was calculated as:

ΔCt＝Ct(Target gene)-Ct(Actin)。

the calculation formula of the relative expression quantity of the specific gene in two samples is as follows:

ΔΔCt＝ΔCt(Sample 1)-ΔCt(Sample 2)。

5. greenhouse phenotype assay

The sweet potato vine obtained by cultivating seedlings in a greenhouse or cultivating the seedlings by using the seed potatoes is cut into stem segments (about 20cm in length) containing 2-3 lateral buds to be used as seedlings, and the sources of the seedlings are kept consistent in the same land, and the quality is equivalent.

6. Determination of sweet potato tissue main monosaccharide

Completely drying the collected fresh sweet potato tubers at 80 ℃, grinding the fresh sweet potato tubers fully by using a mortar, weighing 30mg of samples, putting the samples into a 2.0mL EP tube, rapidly adding 700 mu L of 80% ethanol, fully shaking and uniformly mixing, shaking for 2 hours at 70 ℃, and centrifuging for 3 minutes at 14000 g; transferring the supernatant into a clean centrifuge tube, adding 700 mu L of pure water, and centrifuging at 1200rpm for 5 minutes; 1ml of the supernatant was placed in a new centrifuge tube, and 700. Mu.L of chloroform was added thereto at 12000rpm for 10 minutes. Repeating the extraction once to remove pigment.

Samples were separated on an HPLC1260-RI system using Agilent technologies HPLC column (ZORBAX Carbohydrate column; 4.6X105 mm, 5. Mu.M) and 10. Mu.L of sample was taken, 75% acetonitrile as mobile phase, 0.8 ml per minute at 35℃separation temperature, and 80% ethanol as blank.

7. Determination of starch content in sweet potato tissue

According to the Total Starch kit (K-TSTA, megazyme), firstly wetting the dried plant tissues with 50 mu L of 75% ethanol, shaking and uniformly mixing to form a sample, repeatedly dispersing, preventing caking in the heating process, adding 1.5ml Alpha-amylase, incubating with boiling water for 12min, fully gelatinizing Starch in the plant tissues, and shaking and mixing for two minutes each time to prevent the sample from being sprayed out of an EP tube due to alcohol evaporation; transferring the EP tube into a water bath at 50 ℃, adding 50 mu L of amyloglucosidase, incubating for 30min, transferring all liquid in the EP tube into a 15mL test tube, fixing the volume to 10mL, taking about 100 mu L of sample, adding 3mL GOPOD, and incubating for 20min at 50 ℃; the blank was replaced with the same amount of water; the glucose control was 100. Mu.L glucose standard (1 mg/mL) +3mL GOPOD reagent.

All samples were assayed for absorbance at 510 nm.

Wherein: f=100 (glucose standard weight 100 μg)/100 μg glucose standard absorbance value;

FV: final volume (10 mL);

Δa: absorbance of the sample;

w: weight of sample (mg).

8. Lignin content determination

The fresh stems and tubers of the harvested sweet potatoes were dried to constant weight at 80℃and ground thoroughly with a mortar, and 1.0 mg of the dried samples were accurately weighed and analyzed for lignin content according to literature (Gui Jinshan et al 2020, fiber-specific regulation of lignin biosynthesis improves biomass quality in probes.New Phytologist, 226:1074-1087).

9. AGPase enzyme activity assay

About 0.1g of fresh sweet potato leaf tissue was weighed and assayed for AGPase activity using an adenosine diphosphate glucose pyrophosphorylase (AGP) activity assay kit.

10. Blade iodine dyeing

Chlorophyll was removed with 95% alcohol until the leaves became substantially white, followed by 1% Lugol's solution (3.75 g KI and 1.25. 1.25g I were accurately weighed ₂ Dissolved in 500mL of distilled water) was immersed in room temperature for 30 minutes, and the residual iodine solution was washed with water, observed and photographed.

Example 1 sweet potato hybrid population GWAS analysis

The inventor researches and analyzes genes of a wide variety of root crops, examines and genetically locates various agronomic characters (leaf shape, leaf color, root number, root yield, root bark color and the like) of a root crop hybridization group and gene expression quantity data, and combines experimental analysis to identify genetic loci and candidate genes capable of effectively controlling the characteristics of the root crops. Analysis found that the small subunit of AGPase (IbAGPS) located on chromosome 13 correlates with root yield (FIG. 1).

The cDNA sequence of the small subunit of AGPase is as follows (SEQ ID NO:1;1563 bp):

ATGGCGGCAGCAATCGGAGCTCCGAAGCTCGCCCCGTATACCTGCGCGGCGGAGAGGAACGACGGCTCTGCTCGGCGTGCTGCGAGGTTCAAGAGCCTCTCGTTCGCGTCTTCTAATCTCTCCGGCGACAAACTCGCGTCGTTAGTTTCTCGGCGCTGCAGCCGTTCCGGAGGGAAATCGTCGGAGAGGCGTAATGCTCCGATTATCGTTTCCCCTAAAGCTGTTTCCGACTCCCAGAATTCGCAGACTTGCCTCGATCCTGATGCTAGCCGAAGTGTCTTGGGAATTATTCTTGGAGGTGGAGCTGGGACCCGGCTCTACCCTCTAACAAAGAAGAGGGCAAAGCCAGCTGTTCCACTTGGAGCAAACTATCGTCTGATTGATATCCCTGTTAGCAATTGCTTGAACAGTAATGTTTCCAAGATCTATGTTCTTACACAGTTTAACTCTGCATCACTCAATCGTCACCTCTCACGGGCATATGCAAGTAACATGGGCGGTTACAAGAATGAAGGTTTCGTTGAAGTTCTTGCTGCTCAGCAAAGTCCAGAGAACCCTAATTGGTTCCAGGGTACTGCTGATGCTGTGAGGCAGTATCTATGGCTGTTTGAGGAACACAATGTTCTTGAATTCCTAGTTCTTGCTGGAGATCATTTGTACCGAATGGATTATGAGAGATTCATTCAAGCCCACAGAGAAACAGATGCTGATATTACTGTTGCTGCTCTGCCAATGGATGAGAAGCGTGCCACTGCATTTGGTCTCATGAAGATTGATGAAGAAGGGCGGATTATTGAATTTGCAGAGAAACCAAAAGGAGAACAGTTGAAAGCTATGAAGGTTGATACTACTATTTTAGGTCTTGATGATCAGAGAGCTAAAGAGTTGCCTTTTATTGCAAGTATGGGCATATATGTCATTAGCAAAAATGTGATGTTAAACCTACTTCGAGAAAAGTTCCCTGGAGCCAATGACTTTGGAAGTGAAGTCATTCCTGGTGCAACATCCATTGGAATGAGAGTTCAAGCTTATTTGTTTGACGGCTACTGGGAAGATATTGGTACAATTGAGGCTTTCTATAATGCCAACTTGGGGATCACAAAAAAGCCAGTGCCAGATTTCAGTTTCTATGACCGATCAGCTCCAATCTACACTCAGCCTCGATATTTACCTCCTTCTAAAATGCTTGATGCTGATGTCACGGACAGTGTTATTGGCGAAGTGCAGAACTGTAAAATTCACCATTCTGTGGTTGGGCTTAGATCATGTATATCAGAAGGTGCAATTATTGAAGATTCACTACTGATGGGAGCTGATTACTATGAGACTGATGCTGACAGGAGGCTTCTGGCAGCAAAGGGCAGCATCCCAATTGGCATTGGCAGGAACTCCCACATTAAAAGAGCAATCATTGACAAGAATGCCCGTATAGGGGACAATGTGAAGATCATTAATAGTGACGATGTTCAAGAAGCAGCTAGGGAAACTGATGGATATTTCATCAAGAGTGGAATCGTGACTGTCATCAAGGATGCATTGATCCCCAGCGGAACTGTAATATAA

the amino acid sequence of the small subunit of AGPase is as follows (SEQ ID NO:2;521 amino acids):

MAAAIGAPKLAPYTCAAERNDGSARRAARFKSLSFASSNLSGDKLASLVSRRCSRSGGKSSERRNAPIIVSPKAVSDSQNSQTCLDPDASRSVLGIILGGGAGTRLYPLTKKRAKPAVPLGANYRLIDIPVSNCLNSNVSKIYVLTQFNSASLNRHLSRAYASNMGGYKNEGFVEVLAAQQSPENPNWFQGTADAVRQYLWLFEEHNVLEFLVLAGDHLYRMDYERFIQAHRETDADITVAALPMDEKRATAFGLMKIDEEGRIIEFAEKPKGEQLKAMKVDTTILGLDDQRAKELPFIASMGIYVISKNVMLNLLREKFPGANDFGSEVIPGATSIGMRVQAYLFDGYWEDIGTIEAFYNANLGITKKPVPDFSFYDRSAPIYTQPRYLPPSKMLDADVTDSVIGEVQNCKIHHSVVGLRSCISEGAIIEDSLLMGADYYETDADRRLLAAKGSIPIGIGRNSHIKRAIIDKNARIGDNVKIINSDDVQEAARETDGYFIKSGIVTVIKDALIPSGTVI

example 2 preparation of overexpressing plants

1. Construction of plant expression vectors

According to the gene sequence of the small subunit of AGPase, the target gene IbAGPS is obtained by PCR amplification by taking the sweetpotato leaf cDNA as a template, and the full length 1563bp of the gene is inserted into a pCAMBIA1301 vector to construct an over-expression vector. Schematic representation of the major elements in the over-expression vector is shown in the upper panel of FIG. 2.

Preferably, the sequence fragment suitable for RNAi uses sweet potato leaf cDNA as a template, PCR amplification is carried out to obtain a sequence of 145-471 th bits of 327bp in IbAGPS, the sequence fragment is inserted into a PBS intermediate vector to construct a hairpin structure, and the hairpin structure is inserted into a multiple cloning site of a pCAMBIA1301 vector to obtain the RNAi vector. Schematic of the major elements in the RNAi vector is shown in the lower panel of FIG. 2.

The plant expression vector prepared above is used for transforming the sweet potato variety, namely the Ipomoea batatas Roxb 22.

2. Preparation of transgenic sweet potato and plant regeneration

The agrobacterium containing the binary vector is transformed into sweet potato embryogenic callus, and the transgenic plant is obtained through screening and regeneration.

3. Transgenic plant detection

The transgenic plants were tested as shown in FIG. 3.

The detection of IbAGPS gene expression in transgenic sweetpotato from molecular level by qRT-PCR showed that gene expression level was significantly up-regulated in the over-expressed transgenic plants (upper panel of fig. 3) and AGPase activity was also significantly enhanced (lower panel of fig. 3).

In RNAi plants, the expression level of IbAGPS gene was down-regulated (upper panel of FIG. 3), and AGPase activity was also significantly decreased (lower panel of FIG. 3).

Example 3, trait variation of transgenic plants: above ground part character

RNAi transgenic plants and over-expressed transgenic plants were grown in the greenhouse for one month and compared to wild type aerial forms of the same grown Dioscorea batatas 22.

The results show that the stem length of RNAi plants is obviously increased, internodes are also obviously increased, the diameter is obviously thinned, the plants become slender, the dry matter content is reduced, and the lignin content is increased. The over-expressed plants had significantly shorter stem lengths, significantly shorter internodes, significantly thicker diameters, thicker plants and higher dry matter content (fig. 4). This also means that there is a significant increase in the biomass of the aerial parts.

Example 4, trait variation of transgenic plants: leaf blade and starch character thereof

RNAi transgenic plants and over-expressed transgenic plants were compared to wild type of the same conditions grown from the wild type of the purple sweet potato 22 after one month of greenhouse growth for leaf and starch traits.

After the transgenic plants grow in the greenhouse for one month, compared with the wild type of the bradycardia 22, the leaves of the RNAi plants become smaller, the measured leaf areas are reduced, the coloration is shallower after iodine staining, the starch content is obviously reduced, the sucrose content is increased, and the fructose and glucose content is reduced. And the leaf of the over-expression plant is increased, the measured leaf area is obviously increased, the coloring is deeper after iodine staining, and the starch content is obviously increased (figure 5).

Example 5, trait variation of transgenic plants: root tuber character

RNAi transgenic plants and over-expressed transgenic plants were grown in the greenhouse for two months and compared to the wild type of the same condition grown Dioscorea batatas 22 for root tuber traits.

Compared with the wild type of the bradykarum 22, the RNAi plant has no expansion of root system, the diameter of the root is obviously reduced, the yield of the root is obviously reduced, and the diameter of the root tuber of the over-expression plant is increased, and the yield of the root tuber is obviously improved (figure 6).

After growing in the ground of the greenhouse for 3 months, the root system of the RNAi plant is not expanded, the root yield is obviously reduced, the lignin content is obviously increased, and the starch content is obviously reduced compared with the wild type of the bradycardia 22. Whereas the root tuber yield of the over-expressed plants was significantly improved (including volume increase, weight increase), lignin content was not significantly changed, and starch content was significantly increased (fig. 7).

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims. All documents referred to in this disclosure are incorporated by reference herein as if each was individually incorporated by reference.

Sequence listing

<110> Shanghai Chenshan Garden

<120> application of small subunit of AGPase in improving yield of root crops

<130> 222418

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1563

<212> DNA

<213> sweet potato (Ipomoea batatas (l.) lam.)

<400> 1

atggcggcag caatcggagc tccgaagctc gccccgtata cctgcgcggc ggagaggaac 60

gacggctctg ctcggcgtgc tgcgaggttc aagagcctct cgttcgcgtc ttctaatctc 120

tccggcgaca aactcgcgtc gttagtttct cggcgctgca gccgttccgg agggaaatcg 180

tcggagaggc gtaatgctcc gattatcgtt tcccctaaag ctgtttccga ctcccagaat 240

tcgcagactt gcctcgatcc tgatgctagc cgaagtgtct tgggaattat tcttggaggt 300

ggagctggga cccggctcta ccctctaaca aagaagaggg caaagccagc tgttccactt 360

ggagcaaact atcgtctgat tgatatccct gttagcaatt gcttgaacag taatgtttcc 420

aagatctatg ttcttacaca gtttaactct gcatcactca atcgtcacct ctcacgggca 480

tatgcaagta acatgggcgg ttacaagaat gaaggtttcg ttgaagttct tgctgctcag 540

caaagtccag agaaccctaa ttggttccag ggtactgctg atgctgtgag gcagtatcta 600

tggctgtttg aggaacacaa tgttcttgaa ttcctagttc ttgctggaga tcatttgtac 660

cgaatggatt atgagagatt cattcaagcc cacagagaaa cagatgctga tattactgtt 720

gctgctctgc caatggatga gaagcgtgcc actgcatttg gtctcatgaa gattgatgaa 780

gaagggcgga ttattgaatt tgcagagaaa ccaaaaggag aacagttgaa agctatgaag 840

gttgatacta ctattttagg tcttgatgat cagagagcta aagagttgcc ttttattgca 900

agtatgggca tatatgtcat tagcaaaaat gtgatgttaa acctacttcg agaaaagttc 960

cctggagcca atgactttgg aagtgaagtc attcctggtg caacatccat tggaatgaga 1020

gttcaagctt atttgtttga cggctactgg gaagatattg gtacaattga ggctttctat 1080

aatgccaact tggggatcac aaaaaagcca gtgccagatt tcagtttcta tgaccgatca 1140

gctccaatct acactcagcc tcgatattta cctccttcta aaatgcttga tgctgatgtc 1200

acggacagtg ttattggcga agtgcagaac tgtaaaattc accattctgt ggttgggctt 1260

agatcatgta tatcagaagg tgcaattatt gaagattcac tactgatggg agctgattac 1320

tatgagactg atgctgacag gaggcttctg gcagcaaagg gcagcatccc aattggcatt 1380

ggcaggaact cccacattaa aagagcaatc attgacaaga atgcccgtat aggggacaat 1440

gtgaagatca ttaatagtga cgatgttcaa gaagcagcta gggaaactga tggatatttc 1500

atcaagagtg gaatcgtgac tgtcatcaag gatgcattga tccccagcgg aactgtaata 1560

taa 1563

<210> 2

<211> 520

<212> PRT

<213> sweet potato (Ipomoea batatas (l.) lam.)

<400> 2

Met Ala Ala Ala Ile Gly Ala Pro Lys Leu Ala Pro Tyr Thr Cys Ala

1 5 10 15

Ala Glu Arg Asn Asp Gly Ser Ala Arg Arg Ala Ala Arg Phe Lys Ser

20 25 30

Leu Ser Phe Ala Ser Ser Asn Leu Ser Gly Asp Lys Leu Ala Ser Leu

35 40 45

Val Ser Arg Arg Cys Ser Arg Ser Gly Gly Lys Ser Ser Glu Arg Arg

50 55 60

Asn Ala Pro Ile Ile Val Ser Pro Lys Ala Val Ser Asp Ser Gln Asn

65 70 75 80

Ser Gln Thr Cys Leu Asp Pro Asp Ala Ser Arg Ser Val Leu Gly Ile

85 90 95

Ile Leu Gly Gly Gly Ala Gly Thr Arg Leu Tyr Pro Leu Thr Lys Lys

100 105 110

Arg Ala Lys Pro Ala Val Pro Leu Gly Ala Asn Tyr Arg Leu Ile Asp

115 120 125

Ile Pro Val Ser Asn Cys Leu Asn Ser Asn Val Ser Lys Ile Tyr Val

130 135 140

Leu Thr Gln Phe Asn Ser Ala Ser Leu Asn Arg His Leu Ser Arg Ala

145 150 155 160

Tyr Ala Ser Asn Met Gly Gly Tyr Lys Asn Glu Gly Phe Val Glu Val

165 170 175

Leu Ala Ala Gln Gln Ser Pro Glu Asn Pro Asn Trp Phe Gln Gly Thr

180 185 190

Ala Asp Ala Val Arg Gln Tyr Leu Trp Leu Phe Glu Glu His Asn Val

195 200 205

Leu Glu Phe Leu Val Leu Ala Gly Asp His Leu Tyr Arg Met Asp Tyr

210 215 220

Glu Arg Phe Ile Gln Ala His Arg Glu Thr Asp Ala Asp Ile Thr Val

225 230 235 240

Ala Ala Leu Pro Met Asp Glu Lys Arg Ala Thr Ala Phe Gly Leu Met

245 250 255

Lys Ile Asp Glu Glu Gly Arg Ile Ile Glu Phe Ala Glu Lys Pro Lys

260 265 270

Gly Glu Gln Leu Lys Ala Met Lys Val Asp Thr Thr Ile Leu Gly Leu

275 280 285

Asp Asp Gln Arg Ala Lys Glu Leu Pro Phe Ile Ala Ser Met Gly Ile

290 295 300

Tyr Val Ile Ser Lys Asn Val Met Leu Asn Leu Leu Arg Glu Lys Phe

305 310 315 320

Pro Gly Ala Asn Asp Phe Gly Ser Glu Val Ile Pro Gly Ala Thr Ser

325 330 335

Ile Gly Met Arg Val Gln Ala Tyr Leu Phe Asp Gly Tyr Trp Glu Asp

340 345 350

Ile Gly Thr Ile Glu Ala Phe Tyr Asn Ala Asn Leu Gly Ile Thr Lys

355 360 365

Lys Pro Val Pro Asp Phe Ser Phe Tyr Asp Arg Ser Ala Pro Ile Tyr

370 375 380

Thr Gln Pro Arg Tyr Leu Pro Pro Ser Lys Met Leu Asp Ala Asp Val

385 390 395 400

Thr Asp Ser Val Ile Gly Glu Val Gln Asn Cys Lys Ile His His Ser

405 410 415

Val Val Gly Leu Arg Ser Cys Ile Ser Glu Gly Ala Ile Ile Glu Asp

420 425 430

Ser Leu Leu Met Gly Ala Asp Tyr Tyr Glu Thr Asp Ala Asp Arg Arg

435 440 445

Leu Leu Ala Ala Lys Gly Ser Ile Pro Ile Gly Ile Gly Arg Asn Ser

450 455 460

His Ile Lys Arg Ala Ile Ile Asp Lys Asn Ala Arg Ile Gly Asp Asn

465 470 475 480

Val Lys Ile Ile Asn Ser Asp Asp Val Gln Glu Ala Ala Arg Glu Thr

485 490 495

Asp Gly Tyr Phe Ile Lys Ser Gly Ile Val Thr Val Ile Lys Asp Ala

500 505 510

Leu Ile Pro Ser Gly Thr Val Ile

515 520

Claims

1. A method of improving a root crop yield or plant type trait or preparing a root crop with improved yield or plant type trait comprising: up-regulating the expression or activity of small subunit of AGPase in root crops.

2. The method of claim 1, wherein the improved root crop yield traits are: increasing biomass or yield of the tuberous root, increasing starch content in the tuberous root and/or increasing biomass of the aerial parts; or (b)

The plant type characters of the improved root crops are as follows: promoting plant type thickening, reducing the internode spacing of stems and/or increasing leaf area.

3. The method of claim 1, wherein up-regulating the expression or activity of a small subunit of AGPase comprises:

transferring the coding gene of the AGPase small subunit or an expression construct or a vector containing the coding gene into root crops;

performing functional acquisition mutation on the small subunit of AGPase;

promoting the expression of the small subunit of AGPase with an expression-enhanced promoter or a tissue-specific promoter; or (b)

With enhancers to promote the expression of small subunits of AGPase.

4. Use of a small subunit of AGPase, or an upregulation thereof, for: improving the yield or plant type character of the root crops or preparing the root crops with improved yield or plant type character;

preferably, the improved root crop yield traits are: increasing biomass or yield of the tuberous root, increasing starch content in the tuberous root and/or increasing biomass of the aerial parts; or (b)

5. The use according to claim 4, wherein the small subunit of AGPase upregulators comprise: exogenous AGPase small subunit coding gene or expression construct or vector containing the coding gene; preferably, the expression construct comprises an enhanced promoter, a tissue specific promoter or an enhancer; or, an agent that performs a functional point mutation on a small subunit of AGPase; preferably, the agent reverts the mutant to the wild-type small subunit of AGPase in root crops in which the mutation of small subunit of AGPase has occurred.

6. The method or use according to any one of claims 1 to 5, wherein the root crop comprises: sweet potato, cassava, potato, yam, taro, kudzuvine root, konjak, jerusalem artichoke, yacon, pseudo-ginseng and fleece-flower root.

7. The method or use according to any one of claims 1 to 5, wherein the amino acid sequence of the small subunit of AGPase is selected from the group consisting of:

(i) A polypeptide of the amino acid sequence shown in SEQ ID NO. 2;

(ii) The polypeptide which is formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence shown as SEQ ID NO. 2, has the regulatory character function and is derived from (i);

(iii) The homology of the amino acid sequence with the amino acid sequence shown in SEQ ID NO. 2 is more than or equal to 80 percent, and the polypeptide has the function of regulating and controlling the characters;

8. Use of small subunits of AGPase as molecular markers for identifying the traits of root crops; the traits include: yield or plant type traits;

preferably, the yield traits are: biomass or yield of tuberous root, starch content in tuberous root, biomass of overground part; or, the plant type trait is: stem thickness, pitch spacing of stems, and/or leaf area.

9. A method of directionally selecting or identifying root crops, the method comprising: identifying expression or sequence characteristics of small subunits of AGPase in the root crop of the test tuberous crop; if the AGPase small subunit of the root crop is tested to be expressed in high degree, the root crop is a plant with high yield; if the AGPase small subunit of the test root crop is expressed low or not, it is a plant with low yield.

10. A method of screening for substances (potential substances) that enhance yield traits in root crops, comprising:

(1) Adding a candidate substance into a system for expressing small subunits of AGPase;

(2) The system is tested for expression or activity of small subunits of AGPase, and if the expression or activity is increased, the candidate substance is a substance which can be used for improving the yield traits of root crops.