CN109929851B

CN109929851B - Corn kernel starch synthesis regulation gene ZmDof36 and application thereof

Info

Publication number: CN109929851B
Application number: CN201910084497.2A
Authority: CN
Inventors: 武健东; 陈龙; 董庆; 江海洋; 程备久
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2019-01-29
Filing date: 2019-01-29
Publication date: 2020-08-14
Anticipated expiration: 2039-01-29
Also published as: CN109929851A

Abstract

The invention discloses a corn kernel starch synthesis regulation gene ZmDof36 and application thereof, belonging to the technical field of genetic engineering. The gene has a nucleotide sequence shown as SEQ ID NO.1, has a full length of 1056bp, and totally encodes 351 amino acids. The gene belongs to a DOF family transcription factor, the content of corn kernel starch can be improved by regulating and controlling the expression of a starch synthesis pathway gene, and the size of the kernel can be increased by the gene so as to increase the thousand kernel weight of the corn; the discovery of the gene provides a new way for the cross metabolic regulation and control of the quality and the yield of corn grains, and has important theoretical and practical guiding significance for the genetic improvement of crops and the cultivation of high-quality and high-yield corn materials; the material produced by the invention provides a new germplasm for the breeding of high-quality and high-yield corn.

Description

Corn kernel starch synthesis regulation gene ZmDof36 and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a corn kernel starch synthesis regulation gene ZmDof36 and application thereof.

Background

Corn (Zea maysL.) is an important crop for both food, feed and industrial raw materials, and is one of the major crops in China and the world. By 2012, the corn seeding area and total yield exceed those of rice, and the corn is the first large grain crop. Corn starch accounts for about 85% of the annual yield of starch in the world, and the corn starch is the starch with the best chemical components in various plant starches, has the characteristics of high purity (up to 99.5%), high extraction rate (up to 93% -96%), rich nutrient components, good economic benefits and the like, so that the improvement of the starch content in the corn has important social benefits and economic benefits.

Starch accounts for about 70% of the dry weight of the corn kernel, and is the main component and important quality character of the kernel. The content of amylose in common corn is about 25 percent, the content of amylopectin is about 75 percent, and how to adjust and improve the balance degree of amylose content and amylopectin content needs to be deeply researched on starch biological metabolic pathways. In addition, the process of grain weight increment is mainly the synthesis and accumulation process of starch, and the continuous improvement of the content of the corn starch can realize 'weight increment by quality'. Therefore, the deep research on the synthesis mechanism of the seed starch is very important for improving the quality and the yield of the corn, and has important theoretical and practical significance for genetic improvement of crops and cultivation of high-quality and high-yield corn materials.

In the corn, wheat and rice starch metabolic pathways, the major key enzymes controlling starch synthesis are ADP-glucose pyrophosphorylase (AGPas), granule-bound starch synthase (GBSS), Soluble Starch Synthase (SSS), Starch Branching Enzyme (SBE) and starch debranching enzyme (SDBE). At present, the coding genes of the key enzymes are cloned, and the expression of the key enzyme genes is controlled, so that the starch content and the grain size can be regulated. Maize SH2(shrunken2) and BT2(brittle2) encode the large and small subunits of the endosperm AGPase of seeds, respectively, and the grain weight and starch content of maize transgenic plants over-expressing BT2 or SH2 are increased; maize wx (waxy, encoding GBSS enzyme), endosperm starch lacking wx function consists mainly of amylopectin; wx mutants are also widely used in molecular breeding to produce high amylopectin; in the deletion mutant of the RSRI (Rice Starch regulator 1) gene, the expression level of the gene responsible for Starch synthesis is obviously increased, the amylose content in the seed is increased, the amylopectin structure is changed, the seed is enlarged, and the yield is increased; the FLO2(Floury endosperm 2) gene can regulate the size of rice grains and the content of starch; although there are a number of reports on the function of major genes in the starch synthesis pathway, how can these major genes be regulated and expressed? How does the molecular mechanism of regulation? These problems are not clear.

Disclosure of Invention

The invention aims to solve the technical problems and provides a ZmDof36 gene for regulating and controlling corn starch synthesis and application thereof, so as to provide a novel key gene capable of regulating and controlling corn starch synthesis, wherein the gene can change the content, structure and yield of seed starch.

The invention is realized by the following technical scheme:

the invention provides a corn starch synthesis regulation gene ZmDof36, which has a nucleotide sequence shown in SEQ ID NO.1, has a full length of 1056bp, and totally encodes 351 amino acids.

The invention also provides a coding protein of the corn starch synthesis regulatory gene ZmDof36, wherein the coding protein has an amino acid sequence shown in SEQ ID NO. 2.

The invention also provides the corn starch synthesis regulation gene ZmDof36, wherein the gene ZmDof36 is positioned in a cell nucleus for transcription regulation gene expression.

The invention also provides application of the corn starch synthesis regulation gene ZmDof36 in regulation of the content and structure of starch in corn grains, and particularly provides a positive regulation effect of the gene on the synthesis of starch, and the overexpression of the gene can improve the content of total starch and direct-connected starch.

The invention also provides application of the corn starch synthesis regulation gene ZmDof36 in regulation of the size of starch of corn grains, and particularly provides application of the gene in positive regulation of the size of starch of corn grains, wherein the overexpression of the gene can improve the width of the grains and increase the thousand kernel weight of the grains.

Compared with the prior art, the invention has the following advantages: the ZmDof36 gene can improve the content of the total starch of corn grains by regulating the expression of the starch synthesis pathway gene, change the structure of the starch and prove that the ZmDof36 gene plays a positive regulation role in starch expression. Meanwhile, the gene can increase the width of grains so as to increase the thousand seed weight of the corn; the discovery of the gene provides a new way for the cross metabolic regulation and control of the quality and the yield of corn grains, and has important theoretical and practical guiding significance for the genetic improvement of crops and the cultivation of high-quality and high-yield corn materials; the material produced by the invention provides a new germplasm for the breeding of high-quality and high-yield corn.

Drawings

FIG. 1 is a histogram of the results of the tissue expression pattern of ZmDof36 gene.

FIG. 2 is a vector map of pCAMBIA 1305.

FIG. 3 is a map of pZZ00005 vector.

FIG. 4 is a cell map of the ZmDof36 gene of the present invention; wherein, the picture A is a schematic diagram of vector construction, and the picture B is a schematic diagram of cell positioning.

FIG. 5 shows the results of the measurement of total starch content, amylose content and amylopectin blue value in ZmDof36 transgenic corn kernels (WT: control material ZZC 01; L3, L11, L16, L17: four transgenic lines).

FIG. 6 shows the scanning electron microscope analysis of ZmDof36 transgenic corn kernels (WT: control material ZZC 01; L11, L16: corn transgenic material).

FIG. 7 shows the ZmDof36 transgenic maize size (WT: control material ZZC 01; L3, L11, L16, L17: kernels from four transgenic maize strains) of the invention.

FIG. 8 shows the thousand kernel weight determination results of ZmDof36 transgenic maize of the present invention (WT: control material ZZC 01; L3, L11, L16, L17: kernels from four transgenic maize strains).

Detailed Description

The invention is described in further detail below with reference to the accompanying drawings:

1. material

The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.

2. Method and results

2.1 analysis of the tissue expression Pattern of the ZmDof36 Gene

The root (root), stem (stem) and leaf (leaf) of the maize B73 inbred line in the trefoil stage and the endosperm (endosperm) and embryo (embryo) of the male ear (tassel), the filament (filigent), the cluster (cluster) and the 12d, 14d, 16d, 18d and 20d after pollination in the seedling stage are respectively adopted. RNA extraction, RNA extraction procedures refer to E.Z.N.A.TM MagSi plant RNA extraction kit and the use of an automatic nucleic acid extractor. The Zmdof36 gene fluorescent quantitative PCR primer is F-CCCGACAACTGATCCAATGC; R-GCATAACCACCGTCGTCGTT, ZmTubulin (F: AGGCTTGTCTCCCAGGTCATC; R: GTTGGTCTGGAACTCGTTCACA) as reference gene, Roche quantitative kit for quantitative reaction, 25 μ L reaction system, 9.5 μ L dye mixture, 2 μ L cDNA template, 0 each upstream and downstream primer (10 μmol/L)5 μ L, and finally adding deionized water to 25 μ L. The PCR reaction parameters were as follows: at 95 ℃ for 10 min; 95 ℃ for 15 s; 60 ℃, 1min, total 40 cycles. By adopting 2-^ΔΔCT[ΔCT＝CT_{Target gene}–CT_{Internal reference gene}.ΔΔCT＝ΔCT_{After treatment}–ΔCT_Control]The method carries out data processing.

Three biological replicates were tested, and at least three experimental runs were performed, the results are shown in FIG. 1, where it can be seen that the Zmdof36 gene is mainly expressed in endosperm, and the expression increases with the number of pollination days.

2.2 cloning of ZmDof36 Gene

Selecting endosperm cDNA of 12d after pollination of corn B73 as a template, and combining a multiple cloning site of a cloning vector and an upstream enzyme cutting site according to a gene sequence published by a corn B73 database: upstream BamH I-GGATCC, downstream Xba I-TCTAGA, the following primers were designed:

Zmdof36-F：5’-CGGGATCCATGGACATGAACTCCAACGC-3'，

Zmdof36-R：5’-GCTCTAGACTACCCCTCTGCCCCGTCGC-3'；

the PCR amplification reaction takes endosperm cDNA of 12d after pollination of corn B73 as a template, and the reaction system is as follows:

PCR reaction procedure: pre-denaturation at 98 deg.C for 10 min; denaturation at 98 ℃ for 10 s; annealing at 60 ℃ for 5 s; extending for 1min at 72 ℃ for 30 cycles; renaturation at 72 deg.C for 10 min; storing at 10 deg.C.

The amplified product was run on a 2.0% agarose gel of 0.5. mu.g/mL ethidium bromide to detect the size of the band, the band was recovered, and the recovery procedure was referred to the Axygen gel recovery kit. Mixing the recovered fragment with pEASYT₁Cloning vector (all-grass Biotechnology Ltd.) was connected as follows:

the ligation product is named as T-Zmduf 36, then the T-Zmduf 36 is transformed into an escherichia coli competence Trans5 alpha cell, the extracted plasmid is used as a template for PCR amplification verification, and meanwhile, the plasmid is used for enzyme digestion detection to screen positive clones; the correct ligation fragment was determined preliminarily on the assay results and sent to sequencing (Huada Biometrics). The sequencing results were aligned using MEGA4.0 software and were consistent with the predictions (see gene sequence for details).

2.3 subcellular localization analysis of ZmDof36 Gene

In order to further understand the subcellular localization characteristics of the maize Zmdof36 gene, we constructed a subcellular fusion vector, as shown in FIG. 2, the Zmdof36 gene was connected to the GFP upstream of the modified pCAMBIA1305 vector, named as p1305-35S-Zmdof36-GFP, and when designing and constructing the Zmdof36 fragment primer on the p1305-35S-Zmdof36-GFP vector, the stop codon, upstream and downstream enzyme cutting sites of the Zmdof36 gene were removed: the primers were designed upstream Xba I (TCTAGA) and downstream BamHI (GGATCC) as follows:

ZmDof36-XbaI-F 5'-GCTCTAGAATGGACATGAACTCCAACGC-3'

ZmDof36-BamHI-R 5'-CGGGATCCCCCCTCTGCCCCGTCGCTGC-3'。

construction of correctly subcellular-positioned Agrobacterium transformed tobacco with fusion expression vector, preparation of LB liquid culture medium and treatment liquid (0.5M MES 200. mu.L; 1M MgCl) in advance when the transformed tobacco needs to grow to 3-4 leaves₂100 mu L of the solution; 10 mu L of 100mM Acetosyringone (AS), and the transformation steps are AS follows:

(1) simultaneously culturing Agrobacterium and p19 strain, and measuring OD₆₀₀A value;

(2) calculating the formula: v_construct＝n×V_final×0.5/OD₆₀₀

V₁₉＝n×V_final×0.3/OD₆₀₀

n: number of injection leaves; v_final：2mL

(3) Centrifuge at 5000rpm for 5min at room temperature, and discard the supernatant. Finally suspending the thalli by using the prepared treatment solution, and standing for 3 hours in a dark place;

(4) injecting the back of the blade by using an injector, keeping out of the sun for 48h after injection, and finally photographing and observing by using a confocal microscope.

As a result, the strain of p1305-35S-Zmdof36-GFP vector was transformed into a tobacco strain, as shown in FIG. 4. The fluorescent signal is localized in the nucleus, indicating that Zmdof36 is characteristic of transcriptional regulators.

2.4 production of ZmDof36 transgenic maize

Preparing an in-situ conversion solution: 1/4MS culture medium is added with 2% mass concentration sucrose, 0.05% mass concentration surfactant silwet-77, 2 mg/L6-BA, 1ng/L2, 4-D and 10mg/L acetosyringone. 4ml of Agrobacterium AG10 was added to 100ml of the medium and cultured at 28 ℃ and 250rpm for 24 hours.

The corn silk was cut off, and the inoculum was injected directly into the corn cob (material ZZC01) from the lower 1/3 part of the corn silk by using a 5ml syringe, preferably in such an amount that the inoculum exudes from the corn silk. After two months of growth, corn kernels are harvested.

Drying corn kernels in the sun, sowing, detecting BAR gene protein contained in an expression vector pZZ00005-ZmDof36 by using 0.01% (by mass) herbicide basta and a QuickStix PAT/BAR protein detection test strip (AS013LS) when seedlings grow to 3-4 leaf stages, and screening positive transgenic plants to obtain 20 corn seedlings with independent transformation events.

The specific method comprises the following steps:

1) amplification of a target gene: designing a primer according to a gene sequence of cDNA of corn B73, carrying out PCR amplification and gel recovery to obtain a ZmDof36 gene;

2) constructing a vector: transferring the ZmDof36 gene into pZZ00005 plasmid to construct pZZ00005-ZmDof36 over-expression vector;

3) introduction of the vector into the cell: introducing the pZZ00005-ZmDof36 overexpression vector in the step 2) into an agrobacterium AG10 competent cell by adopting a freeze thawing method to form an agrobacterium AG10 bacterial liquid;

4) preparing an in-situ conversion solution: adding the agrobacterium AG10 bacterial liquid into a culture medium, wherein the culture medium is 1/4MS culture medium added with 2% mass concentration of sucrose, 0.05% mass concentration of surfactant silwet-77, 2 mg/L6-BA, 1ng/L2, 4-D and 10mg/L acetosyringone, and culturing at 28 ℃ and 250rpm for 24 hours to obtain transformed bacterial liquid;

5) and (3) transformation: cutting corn stigma, directly injecting the transformed bacterium liquid into a corn cob from the 1/3 position at the lower part of the corn by using an injector, wherein the injection amount is suitable for the bacterium liquid seeping out from the corn stigma position, and harvesting corn kernels after two months of growth;

6) screening: drying corn kernels, sowing, detecting BAR gene protein contained in an expression vector AG10-Zmdof36 in corn, and then screening positive transgenic plants.

2.5 analysis of starch content and Structure of ZmDof36 transgenic maize

(1) Determination of ZmDof36 transgenic corn grain starch content

As shown in FIG. 5, the experiment uses corn ZZC01 as a blank control, and ZmDof36 transgenic corn kernel total starch content, amylose content and amylopectin blue value are measured.

From these, 4 independent transformation event transgenic strains were randomly selected for total starch content, amylose content and amylopectin blue value determination, which was repeated at least three times per experimental determination. The measurement method is as follows:

for total starch determination, the dried seeds were then dehulled and degermed, ground to a powder using a tissue grinder, dried overnight at 40 ℃ and sieved through a 0.5mm sieve (35 mesh). Total starch assay methods reference the Megazyme Total starch assay kit (K-TSTA). Add the milled sample (accurately weighed about 100mg) to a tube (16x120mm) to ensure that all the sample is at the bottom of the tube; add 0.2mL ethanol solution (80% v/v) and mix with a vortex mixer; placing into a stirring frame, adding 2mL of 2MKOH into each test tube, stirring in an ice water mixing bath for about 20min, re-suspending the powder and dissolving the resistant starch (note: not using a vortex apparatus for mixing uniformly, emulsifying the starch, ensuring that the test tubes are in a violent shaking state when KOH is added, so as to avoid that the starch is difficult to dissolve in a lump); while the tubes were stirred on a magnetic stirrer, 8mL of 1.2M sodium acetate buffer (pH3.8) was added to each tube. Immediately adding 0.1mL of thermostable alpha-amylase (kit formulation solution) and 0.1mL of amyloglucosidase (kit formulation solution), mixing well, and incubating at 50 ℃; incubating for 30min, and intermittently mixing; sample starch content > 10%: the entire solution was transferred to a 100mL volumetric flask, the tube was rinsed with a wash bottle and poured into the volumetric flask, and then the volume of the solution was adjusted to 100mL with distilled water and mixed well. Taking part of the solution and centrifuging (1800rpm, 10 min); transfer two diluted sample solutions (0.1mL) into round bottom tubes (16X 100 mm); add 3.0mL of GOPOD solution (kit formulation solution) to each tube (including glucose control and reagent blank) and incubate at 50 ℃ for 20 min; the glucose control included 0.1mL of glucose standard solution (1mg/mL) +3.0mL of LGOPOD solution. Reagent blank control: 0.1mL of distilled water +3.0mL of OPOD solution; the absorbance of each sample and glucose control was determined at 510nm relative to the reagent blank. The calculation formula is as follows:

Δ a ═ absorbance read relative to reagent blank

FV-total volume (e.g. 100mL or 10 mL); 0.1 ═ sample assay volume; 1/1000 ═ conversion from μ g to mg; 100/w is the ratio of starch by weight of dry powder; w is the dry powder weight; 162/180 converting D glucose to dehydroglucose; starch (% of dry matter) is% starch x 100/100-moisture content (%).

When the amylose is determined, firstly purifying starch in grains, soaking corn seeds which are dried and have hard shells and embryos removed in 0.4 mass percent of NaOH solution for 48 hours at room temperature, wherein the ratio of feed liquid (the sample to the 0.4 percent of NaOH solution) is 1:3, soaking the corn seeds in 0.4 percent of NaOH solution for 24 hours after washing, repeatedly washing the corn seeds with water until the surfaces of the corn seeds are not sticky and smooth any more, draining water, grinding the corn seeds by using a colloid mill, sieving starch milk (200 meshes), centrifuging the corn seeds (3000r/min and 20min), taking white precipitates as starch from a lower layer, repeatedly rinsing and centrifuging the starch, drying the starch by blowing at 40 ℃, grinding and sieving the starch (200 meshes) to obtain a pure starch product, and using the obtained starch for determination of the amylose, wherein the specific determination method refers to an amylose determination kit (K-AMYL).

When the blue value of the amylopectin is measured, firstly 0.5g of starch powder is weighed and then is dispersed in a 50ml centrifugal tube by absolute ethyl alcohol; then, the starch was denatured with 15ml of 0.5M NaOH, heated in a boiling water bath at 100 ℃ with stirring for 15min, cooled at room temperature, centrifuged at 4000rpm for 20min, and the supernatant was collected. The supernatant was then neutralized with 2M HCL and butanol was added: isoamyl alcohol (V: V ═ 1:1) is heated in a boiling water bath at 100 ℃ while stirring for 10min, then the mixture is cooled at room temperature, and the mixture is centrifuged at 3500rpm for 30min, so that the obtained supernatant is crude amylopectin. And finally, sequentially adding 1ml of octanol and 5ml of butanol into the crude amylopectin obtained in the previous step: and (3) heating isoamyl alcohol (V: V ═ 1:1) in boiling water at 100 ℃ while stirring, standing at room temperature for 3 hours after the isoamyl alcohol is heated, washing with ethanol for multiple times to obtain the amylopectin, and repeating the steps for three times. And (3) dissolving 0.005g of purified amylopectin in water, diluting to a constant volume, taking 5ml of purified amylopectin, adding 5mlI2-KI, reacting for 10 minutes at room temperature, and scanning a peak value of 500-700 nm by using an ultraviolet spectrophotometer, wherein a value at 680nm is a blue value.

The test uses corn ZZC01 material as a control, three biological repetitions are measured, at least three experimental operations are repeated, the measurement result is shown in figure 5, the total starch content, the amylose content and the amylopectin blue value of ZmDof36 transgenic corn grains are all increased, wherein the increase amplitude of the total starch content is 1.89-2.25%, the increase amplitude of the amylose content is 2.63-3.09%, and the blue values and the maximum absorption wavelength of four transgenic lines L3, L11, L16 and L17 with the amylopectin blue value are all larger than WT, which indicates that the number of long chains in the transgenic amylopectin is increased. The over-expression of the ZmDof36 gene increases the content of total starch, the content of amylose and the blue value of amylopectin in corn grains, and shows that the ZmDof36 gene can directly or indirectly influence the expression of starch-related genes in the starch synthesis process and has positive regulation and control effects on the starch expression.

(2) ZmDof36 scanning electron microscope observation of transgenic corn kernel starch particles

The specific experimental operation of the scanning electron microscope (FIG. 6) was carried out by taking ① sun-dried seeds, shelling, cutting the seeds into two halves from the middle with a sharp cutter, loading the halves into centrifuge tubes, labeling, adding ② glutaraldehyde solution 2.5% into centrifuge tubes, fixing overnight at 4 deg.C, pouring off the fixing solution, and then fixing with 0.1M pH7.0Rinsing seeds with phosphate buffer solution for 3 times, each time for 15min, fixing with 1% osmic acid solution, pouring off the fixing solution at room temperature for 1-2 h, rinsing seeds with 0.1M phosphate buffer solution with pH7.0 for 3 times, absorbing ③ phosphate buffer solution from the centrifuge tube, adding ethanol solution with gradient concentration to dehydrate seeds, wherein the gradient concentration of ethanol is 30%, 50%, 70%, 80% and 90%, each concentration is treated for 20min, eluting with pure ethanol for 2 times, each time for 20min, absorbing ④ pure ethanol from the centrifuge tube, treating seeds with mixed solution of ethanol and isoamyl acetate (v: 1) for 30min (shaking the solution at intervals), treating seeds with solution of isoamyl acetate for 1-2 h, ⑤ using a drying method, picking seeds from solution of isoamyl acetate into a sample cage, absorbing the solution at the periphery of the sample cage, transferring into a sample cup of the apparatus, covering the sample cup, and tightly (filling: before screwing, the power supply is turned on, the apparatus is turned on, the temperature is set to be 0-15 ℃ CO is set, the sample cage is opened, the sample cup is 10, and the solution at ⑥ is removed₂Air vent valve and air inlet valve of instrument, injecting liquid CO into sample cup₂When CO is present₂When the amount of the CO reaches 50% of that of the sample cup, closing an air inlet valve, standing for 15-20 min, ⑦ opening an exhaust flowmeter valve and the air inlet valve of the instrument again, closing an exhaust valve after 10min, and filling CO₂Closing the liquid inlet valve when the temperature of the sample reaches about 80% of the sample cup, heating ⑧ for replacement, adjusting the temperature of the instrument to 20 ℃, standing for 15-20 min, and adding CO in the cup₂Will gradually gasify, when the air pressure in the cup rises to about 7000Pa, the isoamyl acetate will react with CO₂Fully displacing, ⑨ gasifying, regulating the temperature to 35-40 deg.C, the CO in the cup₂Reaching critical point, when the pressure reaches 7134Pa, after 5min, opening the exhaust valve of the flow meter, exhausting at the speed of 1.0-1.51/min, after 45-60 min, finishing exhausting, reducing the pressure of the sample cup to 0, when the temperature is reduced to room temperature, taking out the sample, ⑩ coating, adhering the non-observation surface of the seed to the sample table by conductive adhesive, air drying the adhesive, and coatingA 2000V direct current voltage is applied between the anode and the cathode, and an arc discharge electric field is generated at the moment (under the action of the electric field, residual gas molecules in the vacuum cover are ionized into positive ions and electrons, the positive ions are attracted by the anode to bombard the gold target, gold particles and electrons are excited, and the positive ions are attracted by the anode to be attached to the surface of the seed to form a conductive film); and (5) observing under a scanning electron microscope, and taking a picture.

Analysis in a scanning electron microscope (figure 6) shows that the starch granules of the two transgenic plants are denser than the wild type and are polygonal, and the wild type is circular. The compactness and shape of ZmDof36 gene over-expression particles play an important role.

2.6 length, width, thickness and thousand kernel weight of ZmDof36 transgenic corn kernel

We selected T of transgenic lines of four independent transformation events₃And (4) measuring the length, width, thickness and thousand kernel weight of the corn kernel by using the kernel substitute. Weighing thousand grains by using an electronic balance, counting and weighing every thousand grains, and measuring T of four independent transformants ₃1000 seeds were selected and weighed, three times each.

The experimental result is shown in figure 7, the grain size of the transgenic corn is obviously larger than that of the control group, the experimental result is shown in figure 8, and the width and the thousand kernel weight are obviously higher than those of the control group.

It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.

The present invention is not limited to the above description of the embodiments, and those skilled in the art should, in light of the present disclosure, appreciate that many changes and modifications can be made without departing from the spirit and scope of the invention.

SEQUENCE LISTING

<110> agriculture university of Anhui

<120> corn kernel starch synthesis regulation gene ZmDof36 and application thereof

<130>2018/11/22

<160>2

<170>PatentIn version 3.5

<210>1

<211>1056

<212>DNA

<213>Pabellonia incrassata

<400>1

atggacatga actccaacgc caacaacagc actgccgcag cagcatcggc tcccatcaac 60

aaccagcagg aggctgtggt gtcatcccca accagaaagg agcaagccag gaaccccaag 120

aaggcgcggg cggcgccgca gcaggcgggc ggcagcgggg agcctaggcc gcggcctccg 180

ccggacgcgg cgcacagctg cccgcgctgc tcctccacca acacaaagtt ctgctactac 240

aacaactaca acctgacgca gccgcgctac ttctgcaaga cgtgccgccg ctactggaca 300

cacggcggca ccctccgcaa cgtccccgtc ggcggcggct gccgcaggaa caagcgcgcc 360

tccagctcct cgtccccgtt tccgggcccc tccagcaccg ccgccaccag cgccgcgatg 420

gagaagaccg tcagcacgcg gctgatgctg atggcgacca gcaccatggc gatgccctcc 480

ccgacggcag gcctgtttgt tcccgatgac atgtccccgg cattcacgcc gacgacgggc 540

ggtagcggct tcgacgacct cgccggcatg gacgagcagc accagcaggg cttcctgccc 600

ttctcgccgc tgtccctgtc cgaccaggcg ccggagctgg ctcctggagg agggggtgac 660

acgacgccgt ctttcctgga catgctgaca ggagggtatc tcgatggcgg cggctacggc 720

ggcatgagcg gtggcagcga tgcgatggac atgccgttct cgctgcctga gatggggccc 780

ccgacaactg atccaatgcc gtttcagctc cagtggacgt catcagagct tgacaactac 840

atcaacgacg acggtggtta tgcagcagga ccagccgccg gagtgcagca gcagcagcag 900

cagcagcagc agcagattaa tggtggtgat caccagaagc aggacgagaa caaagaggcg 960

gggaacggca aaggcaacga cgacggcggc ggcgggtcgt cgtcggtgta cagcttctgg 1020

atgaacacca gcggcagcga cggggcagag gggtag 1056

<210>2

<211>351

<212>PRT

<213>Pabellonia incrassata

<400>2

Met Asp Met Asn Ser Asn Ala Asn Asn Ser Thr Ala Ala Ala Ala Ser

1 5 10 15

Ala Pro Ile Asn Asn Gln Gln Glu Ala Val Val Ser Ser Pro Thr Arg

20 25 30

Lys Glu Gln Ala Arg Asn Pro Lys Lys Ala Arg Ala Ala Pro Gln Gln

35 40 45

Ala Gly Gly Ser Gly Glu Pro Arg Pro Arg Pro Pro Pro Asp Ala Ala

50 55 60

His Ser Cys Pro Arg Cys Ser Ser Thr Asn Thr Lys Phe Cys Tyr Tyr

65 70 75 80

Asn Asn Tyr Asn Leu Thr Gln Pro Arg Tyr Phe Cys Lys Thr Cys Arg

85 90 95

Arg Tyr Trp Thr His Gly Gly Thr Leu Arg Asn Val Pro Val Gly Gly

100 105 110

Gly Cys Arg Arg Asn Lys Arg Ala Ser Ser Ser Ser Ser Pro Phe Pro

115 120 125

Gly Pro Ser Ser Thr Ala Ala Thr Ser Ala Ala Met Glu Lys Thr Val

130 135 140

Ser Thr Arg Leu Met Leu Met Ala Thr Ser Thr Met Ala Met Pro Ser

145 150 155 160

Pro Thr Ala Gly Leu Phe Val Pro Asp AspMet Ser Pro Ala Phe Thr

165 170 175

Pro Thr Thr Gly Gly Ser Gly Phe Asp Asp Leu Ala Gly Met Asp Glu

180 185 190

Gln His Gln Gln Gly Phe Leu Pro Phe Ser Pro Leu Ser Leu Ser Asp

195 200 205

Gln Ala Pro Glu Leu Ala Pro Gly Gly Gly Gly Asp Thr Thr Pro Ser

210 215 220

Phe Leu Asp Met Leu Thr Gly Gly Tyr Leu Asp Gly Gly Gly Tyr Gly

225 230 235 240

Gly Met Ser Gly Gly Ser Asp Ala Met Asp Met Pro Phe Ser Leu Pro

245 250 255

Glu Met Gly Pro Pro Thr Thr Asp Pro Met Pro Phe Gln Leu Gln Trp

260 265 270

Thr Ser Ser Glu Leu Asp Asn Tyr Ile Asn Asp Asp Gly Gly Tyr Ala

275 280 285

Ala Gly Pro Ala Ala Gly Val Gln Gln Gln Gln Gln Gln Gln Gln Gln

290 295 300

Gln Ile Asn Gly Gly Asp His Gln Lys Gln Asp Glu Asn Lys Glu Ala

305 310 315 320

Gly Asn Gly Lys Gly Asn Asp Asp Gly Gly Gly GlySer Ser Ser Val

325 330 335

Tyr Ser Phe Trp Met Asn Thr Ser Gly Ser Asp Gly Ala Glu Gly

340 345 350

Claims

1. Application of corn starch synthesis regulation gene ZmDof36 in regulation of corn kernel size and kernel thousand seed weightZmDof36Nucleotide sequences of genes such asSEQ ID NO.1As shown.

2. Corn starch synthesis regulation geneZmDof36Use in the modulation of the total starch content, the amylose content and the amylopectin structure in corn kernels, saidZmDof36Nucleotide sequences of genes such asSEQ ID NO.1As shown.

3. The corn starch synthesis regulatory gene according to claim 1 or 2ZmDof36The application of (2), which is characterized in that: the geneZmDof36Localized in the nucleus of the cell, and performs transcription regulation gene expression.