CN107245490B - method for adjusting starch content of rice grains based on ZmMIKC2a gene - Google Patents

Abstract

the invention discloses a method for adjusting the starch content of rice grains based on a gene ZmMIKC2a, wherein the gene ZmMIKC2a is a DNA molecule with a nucleotide sequence shown as SEQ ID NO.1, and the method comprises the following steps: constructing a ZmMIKC2a gene over-expression vector, and introducing the over-expression vector into a target rice genome to obtain a ZmMIKC2a gene over-expression plant of which the grain amylose content and the amylose/total starch ratio are both higher than those of the target rice. The method utilizes the positive regulation and control effect of the ZmMIKC2a gene on the plant seed starch synthesis related gene, changes the amylose content and the amylose/total starch ratio in the rice seed by a genetic engineering method, obtains a new transgenic rice variety with high amylose, and has important practical significance for developing a new transgenic rice variety with specific functions by utilizing a genetic engineering technology.

Description

Method for adjusting starch content of rice grains based on ZmMIKC2a gene

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for adjusting the starch content of rice grains based on a ZmMIKC2a gene.

Background

Starch is a major component of plant seeds, and is an inexhaustible natural material as a final product of photosynthesis. The starch can be used as grain and feed, is an important industrial raw material, and is widely used in the industries of food, chemical industry, energy, machinery, construction, pharmacy and the like. In rice, starch is the main component of rice endosperm, and the content and quality of starch directly affect the quality of rice seeds.

Starch is classified into amylose and amylopectin according to structural differences, the ratio of amylose to amylopectin and the branched chain structure of amylopectin in starch determine the quality of rice, and the ratio between amylose and amylose also determines the use of starch. The renewable and degradable film produced by amylose is applied to the agricultural film processing industry and the packaging industry, can reduce industrial waste gas and weaken the release of greenhouse effect gas, is the best raw material for producing photolytic plastics, is used for disposable tableware, and is an effective way for solving increasingly serious 'white pollution'; the amylopectin has better salary property, can increase the volume of the puffed food, has different effects from amylose as a food additive, and has more applications in the field of adhesives.

generally, the natural starch with good structure can be quickly digested and absorbed in the gastrointestinal tract, and no excess starch can enter the colon for bacterial fermentation to cause diseases. The starch with poor structure can be applied after being structurally modified by various physical and chemical methods. This may result in a significant increase in production costs. In addition, the nutritional and health status of humans is severely affected by the consumption of destructured starch. In addition, the flavor and the storage property of the starch food are influenced by the structure of the starch to different degrees, and the practice proves that the taste and the effect of the high amylose starch serving as the food additive are better than those of the common starch. In this demand, the mechanism of starch structure formation has become a hot spot in recent research work, and due to the important role of starch in human life, improvement of starch quality and starch biosynthesis have become hot spots of research. With the rapid development of molecular biology and genetic engineering technology, the successive cloning of genes related to starch synthesis in food crops is expected to improve the content of starch and the composition of amylose and amylopectin by regulating and controlling the genes, which makes it possible to directly produce 'natural starch' with a proper structure in crops and capable of meeting the corresponding requirements of human beings.

Starch synthesis in cereal endosperm is a complex process catalyzed by multiple enzymes, mainly involving four major classes of enzymes: ADP-glucose pyrophosphorylase (AGPase), Starch Synthases (SSs), Starch Branching Enzymes (SBEs), starch debranching enzymes (DBEs). These four broad classes of enzymes all include many family members, each of which has a fine division of work and plays a different role in starch synthesis. Amylose is a linear polymer linked by alpha-1, 4 glyco-pulmonic bonds, usually containing only a small degree of branching. In normal crop seeds, amylose accounts for about 20-30% of the storage starch, which is not necessary for the formation of starch granules. The granular structure of starch is mainly formed by the folding of amylopectin. AGPase is a very critical enzyme in starch synthesis, and therefore its effect on its activity directly affects starch synthesis. The starch synthetase catalyzes alpha-1, 4-glucan chain and continuously adds oligosaccharide to ADP-glucose so as to realize the extension of the glucan chain. Depending on the state of the amyloid, they can be classified into Granule-bound starch synthases (GBSS) and Soluble Starch Synthases (SSS). Amylose is mainly synthesized by the granule-bound starch synthase GBSSI. Starch synthase adds the glucose group in ADPG (ADP-glucose) to the branched chain of amylopectin or the non-reducing end of amylose. Starch synthases can be divided into 5 families: SSI, SSII, SSIII, SSIV and GBSS. They extend the branches of different degrees of polymerization in amylopectin, or the linear amylose chains, respectively. The GBSS family has two members: GBSSI and GBSSII. GBSSI is encoded by the Wx gene and is primarily responsible for the synthesis of amylose in the endosperm and pollen grains. GBSSII is expressed mainly in leaves and is responsible for the synthesis of amylose in non-storage organs. In GBSSI deletion mutants of corn, wheat, rice and potato, starch granules in storage organs only contain amylopectin components and hardly contain amylose components. GBSSI is the only starch synthase enzyme that is capable of continuously extending amylose to produce long oligosaccharide chains. The branching of the polysaccharide chain is realized by starch branching enzyme, under the catalysis of the Starch Branching Enzyme (SBE), alpha-1, 4 glycosidic bonds inside the polysaccharide chain are cut off, the reducing end is released, an alpha-1, 6 glycosidic bond is generated, and soluble sugar chains are combined to form the branch. SBE plays a different role in amylopectin synthesis, and because of the low amylose branching, SBE plays an important role in amylose branching. The function of starch debranching enzymes is to remove some irregular branches. ISA enzyme mutant analysis of corn, rice and Arabidopsis thaliana shows that mutation of the enzyme can directly cause reduction of starch content, abnormal starch structure, granule morphology and accumulation of phytoglycogen, while PUL mainly plays a role in starch degradation process, but also plays a role in starch synthesis process, and mutation of the enzyme affects starch content and structure.

In conclusion, the cultivation of plants with different amylose and amylopectin ratios by genetic engineering means is urgently needed for the industrial production of starch.

Disclosure of Invention

the invention aims to overcome the defects of the prior art and provides a method for adjusting the starch content of rice grains based on a ZmMIKC2a gene so as to provide a method capable of improving the amylose content and the amylose/total starch ratio of the rice grains.

The invention is realized by the following technical scheme:

The invention provides a method for regulating the starch content of rice grains based on a gene ZmMIKC2a, wherein the gene ZmMIKC2a is a DNA molecule of the following i) or ii):

i) DNA molecule with nucleotide sequence shown in SEQ ID NO. 1;

ii) a DNA molecule having a nucleotide sequence which is at least 98% identical to SEQ ID No.1 and which encodes the amino acid sequence shown as SEQ ID No. 2;

The method comprises the following steps: obtaining the ZmMIKC2a gene by artificial synthesis or gene cloning method, constructing ZmMIKC2a gene over-expression vector, and introducing the over-expression vector into the target rice genome to obtain ZmMIKC2a gene over-expression plant with grain amylose content and amylose/total starch ratio higher than that of the target rice.

the method for obtaining the ZmMIKC2a gene is a gene cloning method, and comprises the following specific steps: extracting corn kernel endosperm or corn filament RNA and inverse transcribing into cDNA, designing specific amplification primer according to ZmMIKC2a gene sequence by using cDNA as template, and carrying out PCR amplification.

further, the specific amplification primer sequence is:

MIKC2a-F：5′-ATGGGTAGGGGAAGGATTGA-3′

MIKC2a-R：5′-TTAGAACTGATGATGAGGGTTATTG-3′

Further, in the step (2), the ZmMIKC2a gene overexpression vector is a pCAMBIA1301 plant expression vector, wherein a 35S promoter, a ZmMIKC2a gene and a terminator are sequentially connected to the multi-cloning site region.

Compared with the prior art, the invention has the following advantages: the invention provides a method for regulating the starch content of rice grains based on a ZmMIKC2a gene, which utilizes the positive regulation and control effect of the ZmMIKC2a gene on plant grain starch synthesis related genes, changes the amylose content and the amylose/total starch ratio in the rice grains by a genetic engineering method, obtains a new transgenic rice variety with high amylose, and has important practical significance for developing the new transgenic rice variety with specific functions by utilizing the genetic engineering technology.

Drawings

FIG. 1 is a map of pEASY-T1 vector;

FIG. 2 is a map of the pCAMBIA1301 vector;

FIG. 3 is a bar graph of grain size and thousand kernel weight measurements of ZmMIKC2a transgenic rice; wherein, fig. 3a is the result of rice kernel length measurement, fig. 3b is the result of rice kernel width measurement, fig. 3c is the result of rice kernel thickness measurement, and fig. 3d is the result of rice kernel thousand kernel weight measurement; WT is a wild plant, C1-3 is a transgenic plant of a p1 empty vector, and L1-5 is an over-expression plant;

FIG. 4 is a histogram of the amylose and total starch content of ZmMIKC2a transgenic rice grain; wherein FIG. 4a is the amylose content and FIG. 4b is the total starch content; WT is a wild type plant, C1 is a transgenic plant of a p1 empty vector, and L1-5 is an over-expression plant.

Detailed Description

example 1

1. Material

The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.

2. Method of producing a composite material

2.1 obtaining of ZmMIKC2a Gene

Selecting kernel endosperm 16 days after pollination of a corn B73 variety, extracting corn endosperm RNA and performing reverse transcription to obtain cDNA, designing primers MIKC2a-F-1 and MIKC2a-R-1 by combining multiple cloning sites of a plant expression vector according to a ZmMIKC2a gene sequence and a corn B73 genome database by taking the corn endosperm cDNA as a template, and performing PCR amplification to obtain a PCR amplification product.

the primer sequence is as follows:

MIKC2a–F-1：5′-GGGGTACCATGGGTAGGGGAAGGATTGA-3′

MIKC2a–R-1：5′-TCCCCCGGGTTAGAACTGATGATGAGGGTTAT-3′

The PCR reaction program is: pre-denaturation at 98 deg.C for 10 min; denaturation at 98 ℃ for 20 s; annealing at 60 ℃ for 20 s; extending for 2min at 72 ℃ for 30 cycles; renaturation at 72 deg.C for 10 min; storing at 10 deg.C.

the PCR amplification product was detected by 2% by mass agarose gel electrophoresis, and the desired fragment was recovered and ligated to pEASY-T1 vector (purchased from all-grass gold Biotechnology Ltd., map of the vector is shown in FIG. 1) to obtain a ligated product. The ligation product was transformed into E.coli competent Trans5 α cells, and the plasmid was extracted. And (3) taking the extracted plasmid as a template, carrying out PCR amplification verification by taking MIKC2a-F-1 and MIKC2a-R-1 as primers, simultaneously carrying out detection by using Kpn I and Sma I double enzyme digestion plasmids, screening positive clones, sending the positive clones to China Dabiota for sequencing, and comparing the sequencing result by using MEGA4.0 software, wherein the result is consistent with the prediction. The obtained recombinant plasmid was named T-MIKC2 a.

2.2 construction of vector for overexpression of ZmMIKC2a Gene

pCAMBIA1301 (purchased from Shanghai Jielan Biotechnology Limited, and the vector map is shown in figure 2) is used as an original vector, a 35S promoter is connected between EcoRI and SacI enzyme cutting sites of a multiple cloning site of the pCAMBIA1301, and a section of NOS terminator is added between SphI and HindIII enzyme cutting sites of the pCAMBIA1301 to obtain a modified vector p 1. The small target fragment is obtained by double digestion of T-MIKC2a with Kpn I and Sma I, the large target fragment is obtained by double digestion of p1 with Kpn I and Sma I, the two fragments are connected by T4 ligase to construct a vector p1-ZmMIKC2a which is used as a ZmMIKC2a gene overexpression vector of the trans-rice.

2.3 Agrobacterium mediated acquisition of ZmMIKC2a Gene overexpressing plants

The methods for obtaining agrobacterium-mediated over-expressed plants and the culture medium formulations used in the culture process are described in the literature: methods in Molecular Biology, vol.343: the method comprises the following steps of (1) Agrobacterium Protocols, 2/e and volume, and specifically comprises the following steps:

2.3.1 obtaining of Rice mature embryo induced callus

Before the experiment, mature seeds of the target rice are dried in strong sunlight for 3-4h and then subjected to shelling treatment. Washing with sterilized water, washing with water, soaking in 75% (by mass) ethanol for 5min, soaking in sterilized water prepared from sterilized water, hypochlorous acid and tween (specific ratio: sterilized water: hypochlorous acid 1: 1, total volume: tween 1mL:1ul) for 30min while shaking continuously to sterilize the surface, washing with sterilized water until the water is clear, placing mature seed on sterilized filter paper, sucking water, placing on callus induction medium, and culturing at 26 + -1 deg.C; after 10-15 days, transferring the induced cream yellow callus to a subculture medium for subculture. Subculturing once every two weeks, selecting subculture for 5-7 days after subculturing twice, and using the callus with light yellow color for co-culture.

2.3.2 preparation of Agrobacterium solutions for transformation of Rice

The p1-ZmMIKC2a is transformed into agrobacterium LBA4404 to obtain recombinant agrobacterium LBA4404/p1-ZmMIKC2a, and meanwhile, the p1 empty vector which is not connected with the ZmMIKC2a is transformed into the agrobacterium LBA4404 to obtain recombinant agrobacterium LBA4404/p1 as a control. Recombinant agrobacterium LBA4404/p1-ZmMIKC2a and LBA4404/p1 were inoculated into YEP liquid medium (containing 50. mu.g/mL kanamycin and 50. mu.g/mL rifampicin), respectively, and shake-cultured at 28 ℃ until OD600 became 0.6-1.0; the cells were collected by centrifugation at 5000rpm for 5min at room temperature, and then suspended in a liquid co-culture medium, and the cell concentration was adjusted to OD600 of 0.4, to obtain an Agrobacterium suspension for co-culture of transformed rice.

2.3.3 infection of Rice vegetative organs by Agrobacterium

Selecting tender and creamy yellow callus, intensively placing into a 100mL sterile triangular flask, and adding the prepared agrobacterium tumefaciens suspension (the suspension is preferably submerged for callus); culturing at 28 deg.C and 220rpm on shaking table for 20-30 min; and (4) pouring out bacterial liquid, placing the infected callus on a culture dish containing sterile filter paper, absorbing excess bacterial liquid, transferring the infected callus onto a solid co-culture medium, and performing dark culture at 22 ℃ for 2-3 d.

2.3.4 selection culture

Cleaning the co-cultured callus with sterilized water until the water becomes clear, discarding the cleaning solution, transferring into a solution containing carbenicillin (100mg/ml), shaking and cleaning for more than 30min, drying with sterile filter paper, and drying in a culture dish containing sterile filter paper; then selecting the callus on a screening culture medium containing carbenicillin (500mg/ml) and hygromycin (50mg/L), and culturing the callus at 28 ℃ for about 30 days by illumination until new resistant callus is grown.

2.3.5 differentiation of resistant calli

Selecting new yellow callus from the screening culture medium, placing the new yellow callus on a differentiation culture medium containing 50mg/L hygromycin, performing dark culture at 28 ℃ for 3 days, transferring to the condition of 30 ℃ for full light culture for 15-30 days, and allowing green spots to appear; seedlings can be differentiated after 30-40 days.

2.3.6 rooting, strengthening seedling and transplanting

Transferring the differentiated seedlings to a rooting culture medium when the h is more than or equal to 3cm, and culturing for 2-3 weeks; selecting seedling with developed root system and h not less than 15cm, adding water, hardening at room temperature for 2-3 days, washing off culture medium with warm water, and culturing in water bucket containing rice culture soil. After the seedlings grow well, the seedlings are transplanted to a paddy field to grow, and 26 seedlings of ZmMIKC2a transgenic rice with independent transformation events and 43 seedlings of p1 transgenic rice with empty carriers are obtained.

2.4 identification of transgenic Rice

In order to detect the transgenic rice, the total DNA of the extracted transgenic rice is taken as a template, a target gene ZmMIKC2a fragment and a hygromycin gene are taken as detection objects, primers are designed, PCR amplification is carried out, and the primer is used for preliminarily identifying a ZmMIKC2a transgenic plant; meanwhile, the hygromycin gene is used as a detection object, and a p1 transgenic empty vector plant is preliminarily identified.

Primers for detecting target gene ZmMIKC2a fragment:

MIKC2a–F-2：5’-ATGGGTAGGGGAAGGATTGA-3’

MIKC2a–R-2：5’-TTAGAACTGATGATGAGGGTTATTG-3’

The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 2min for 30 cycles; total extension at 72 ℃ was 6 min.

primers for detecting hygromycin gene:

Hyg-F：5’-TAGGAGGGCGTGGATATGGC-3’

Hyg-R：5’-TACACAGCCATCGGTCCAGA-3’

The PCR reaction program is: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, extension at 72 ℃ for 1min, and 34 cycles; total extension at 72 ℃ for 10 min.

As a result, 22 of the ZmMIKC2a transgenic rice seedlings of 26 independent transformation events amplified the target gene ZmMIKC2a fragment and hygromycin gene simultaneously, and 43 transgenic rice seedlings of p1 empty vector amplified the hygromycin gene completely, and the 22 transgenic rice seedlings of ZmMIKC2a were subjected to Southern hybridization, and all the results verified that 22T 0 transgenic plants (named L1-22) and 43T 0 transgenic p1 empty vector plants (named C1-43) were obtained. After the T0 transgenic plants are mature, T1 seeds are harvested, and T1 seeds are bred by self-crossing to obtain T2 seeds. By analogy, a transgenic rice strain with over-expression of the ZmMIKC2a gene and a control strain with a transferred p1 empty vector are obtained.

2.5ZmMIKC2a transgenic Rice grain size and thousand seed weight determination

Five transgenic strains L1, L2, L3, L4 and L5 are selected for T3 generation seeds and are subjected to size and thousand kernel weight measurement. The sizes of the seeds are measured one by using vernier calipers, 1000 seeds are selected from T3 generation seeds of five independent transformants respectively, the length, the width and the thickness of the seeds are measured in part, and the experiment is repeated for at least three times; weighing every hundred grains by using an electronic balance, respectively selecting 10 100 grains of the T3 generation of five independent transformants as seeds, weighing the seeds by the weight of each thousand grains, and repeating the steps.

The experiment uses wild type middle flower 11(WT) and three transformed p1 empty vector strains C1, C2 and C3 as controls, and the result is shown in figure 3, the length (figure 3a), width (figure 3b), thickness (figure 3C) and thousand kernel weight (figure 3d) of the seeds of five independent transformed strains have little change, which indicates that the transformation of the ZmMIKC1a gene has little influence on the external phenotype of the rice seeds.

2.6ZmMIKC2a transgenic rice grain amylose and total starch content determination

Taking T3 generation seeds of 5 independent transformation event transgenic strains L1, L2, L3, L4 and L5 to carry out amylose and total starch determination, taking wild type objective corn seeds (WT) and a p 1-transformed empty vector strain C1 as a control, and repeating the determination at least three times in each experiment, wherein the determination method is as follows:

When the amylose is measured, firstly purifying the starch in grains, soaking the seeds dried to remove hard shells and embryos in 0.4 mass percent NaOH solution for 48 hours at room temperature, wherein the ratio of feed liquid (the sample to the 0.4 percent NaOH solution) is 1:3, soaking the seeds in 0.4 percent NaOH solution for 24 hours after washing, repeatedly washing the seeds with water until the surfaces of the seeds are not sticky and smooth any more, draining the water, crushing the seeds by using a colloid mill, sieving the starch milk (200 meshes), centrifuging the starch milk (3000r/min,20min), taking the white precipitate as the starch, repeatedly rinsing and centrifuging the starch, drying the starch by blowing at 40 ℃, crushing the starch, and sieving the starch (200 meshes) to obtain a pure starch product for measuring the amylose. The measurement of amylose was carried out using an amylose/amylopectin assay kit (product number: K-AMYL) manufactured by Megazyme of Ireland, and the measurement method is described in the kit specification and will not be described in detail.

for total starch determination, the dried seeds were dehulled and degermed, ground to a powder using a tissue grinder, dried overnight at 40 ℃ and sieved through a 0.5mm sieve (35 mesh). The total starch determination adopts a total starch determination kit (product number: K-TSTA) produced by Megazyme of Ireland, and specifically comprises the following steps: adding the ground sample (accurately weighed-100 mg) into a test tube (16X 120mm) to ensure that all samples are positioned at the bottom of the test tube; add 0.2mL ethanol solution (80% v/v) and mix with a vortex mixer; placing the mixture into a stirring frame, adding 2mL of 2mol/L KOH into each test tube, stirring the mixture in an ice water mixing bath for about 20min, and re-suspending the powder and dissolving the resistant starch (note: no vortex instrument is used for uniformly mixing, the starch can be emulsified, and the test tubes are in a violent shaking state when the KOH is added, so that the starch is prevented from forming lumps and being difficult to dissolve); while the tubes were stirred on a magnetic stirrer, 8mL of 1.2mol/L sodium acetate buffer (pH3.8) was added to each tube. Immediately adding 0.1mL of thermostable alpha-amylase (kit formulation solution) and 0.1mL of amyloglucosidase (kit formulation solution), mixing well, and incubating at 50 ℃; incubating for 30min, and intermittently mixing; sample starch content > 10%: the entire solution was transferred to a 100mL volumetric flask, the tube was rinsed with a wash bottle and also poured into the volumetric flask, and then the volume of the solution was adjusted to 100mL with distilled water and mixed well. Taking part of the solution and centrifuging (1800rpm,10 min); transfer two diluted sample solutions (0.1mL) into round bottom tubes (16X 100 mm); add 3.0mL of GOPOD solution (kit formulation solution) to each tube (including glucose control and reagent blank) and incubate at 50 ℃ for 20 min; the glucose control included 0.1mL of glucose standard solution (1mg/mL) +3.0mL of LGOPOD solution. Reagent blank control: 0.1mL of distilled water +3.0mL of GOPOD solution; the absorbance of each sample and glucose control was determined at 510nm relative to the reagent blank. The calculation formula is as follows:

Δ a ═ absorbance read relative to reagent blank; FV-total volume (e.g. 100mL or 10 mL); 0.1 ═ sample assay volume; 1/1000 ═ conversion from μ g to mg; 100/w is the ratio of starch by weight of dry powder; w is the dry powder weight; 162/180 converting D glucose to dehydroglucose; starch (% of dry matter) is% starch x 100/100-moisture content (%).

the results are shown in fig. 4, which shows that the content of amylose and the total starch of the ZmMIKC1a transgenic rice grains are improved, wherein the content of the amylose is increased by 1.75-21.03% (fig. 4a), and the content of the total starch is increased by 1.65-6.87% (fig. 4 b). The ZmMIKC1a gene is over-expressed, and the content of amylose and total starch in rice grains, especially the content of amylose, is improved. The ZmMIKC1a gene can directly or indirectly influence the expression of amylose-related genes in the starch synthesis process, and plays a role in the positive regulation and control of the expression of amylose.

the above is a detailed embodiment and a specific operation process of the present invention, which are implemented on the premise of the technical solution of the present invention, but the protection scope of the present invention is not limited to the above-mentioned examples.

SEQUENCE LISTING

<110> institute of tobacco research of agronomy academy of sciences of Anhui province

<120> method for adjusting starch content of rice grains based on ZmMIKC2a gene

<130>/

<160>2

<170>PatentIn version 3.3

<210>1

<211>810

<212>DNA

<213>Zea mays

<400>1

atgggtaggg gaaggattga gatcaagagg atcgagaaca acacgagccg gcaggtcacc 60

ttctgcaagc gccgcaatgg gctcctcaag aaggcgtatg agctctccgt cctctgcgac 120

gctgaggtgg ccctcatcgt cttctctagc cgtggtcgcc tctacgagta tgccaacaac 180

agtgtcaagg ctactattga gaggtacaag aaggcacaca ccgttggctc ttcctctggg 240

ccaccgctcc tagagcacaa tgcccagcaa ttctaccagc aagaatcagc aaaactgcgc 300

aaccagatcc agatgctgca aaacactaac aggcacttgg ttggtgattc cgtgggaaac 360

ctgtcactca aggagctgaa gcagctggag agccgccttg agaaaggcat ctctaagatc 420

agggccagga agagtgagct gctggctgcg gagatcagtt acatggccaa aagggagact 480

gagcttcaga atgaccacat gaccctcagg accaagattg aggagggaga gcaacagctg 540

cagcaggtga ccgtggcacg gtcagttgca gcagcagcag cagctgccac caacttggag 600

ctgaacccat tcttagagat ggataccaaa tgcttcttca ctggcggccc cttcgcaacg 660

ctggacatga agtgctttct ccccggcagc ttgcagcaga tgctggaggc acagcagcgc 720

cagatgctcg ccaccgagct gaacctcggc taccaactgg cgccgcctgg ttctgacgct 780

gccgacaata accctcatca tcagttctaa 810

<210>2

<211>269

<212>PRT

<213>Zea mays

<400>2

Met Gly Arg Gly Arg Ile Glu Ile Lys Arg Ile Glu Asn Asn Thr Ser

1 5 10 15

Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala

20 25 30

Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe

35 40 45

Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Val Lys Ala

50 55 60

Thr Ile Glu Arg Tyr Lys Lys Ala His Thr Val Gly Ser Ser Ser Gly

65 70 75 80

Pro Pro Leu Leu Glu His Asn Ala Gln Gln Phe Tyr Gln Gln Glu Ser

85 90 95

Ala Lys Leu Arg Asn Gln Ile Gln Met Leu Gln Asn Thr Asn Arg His

100 105 110

Leu Val Gly Asp Ser Val Gly Asn Leu Ser Leu Lys Glu Leu Lys Gln

115 120 125

Leu Glu Ser Arg Leu Glu Lys Gly Ile Ser Lys Ile Arg Ala Arg Lys

130 135 140

Ser Glu Leu Leu Ala Ala Glu Ile Ser Tyr Met Ala Lys Arg Glu Thr

145 150 155 160

Glu Leu Gln Asn Asp His Met Thr Leu Arg Thr Lys Ile Glu Glu Gly

165 170 175

Glu Gln Gln Leu Gln Gln Val Thr Val Ala Arg Ser Val Ala Ala Ala

180 185 190

Ala Ala Ala Ala Thr Asn Leu Glu Leu Asn Pro Phe Leu Glu Met Asp

195 200 205

Thr Lys Cys Phe Phe Thr Gly Gly Pro Phe Ala Thr Leu Asp Met Lys

210 215 220

Cys Phe Leu Pro Gly Ser Leu Gln Gln Met Leu Glu Ala Gln Gln Arg

225 230 235 240

Gln Met Leu Ala Thr Glu Leu Asn Leu Gly Tyr Gln Leu Ala Pro Pro

245 250 255

Gly Ser Asp Ala Ala Asp Asn Asn Pro His His Gln Phe

260 265

Claims (4)

1. ZmMIKC2a ZmMIKC2a1. A method for improving the content of amylose in rice grains based on a ZmMIKC2a gene, which is characterized in that the ZmMIKC2a gene is a DNA molecule of the following i) or ii):

   i) DNA molecule with nucleotide sequence shown in SEQ ID NO. 1;

   ii) a DNA molecule having a nucleotide sequence which is at least 98% identical to SEQ ID No.1 and which encodes the amino acid sequence shown as SEQ ID No. 2;

   ZmMIKC2a ZmMIKC2a ZmMIKC2aThe method comprises the following steps: obtaining the ZmMIKC2a gene by artificial synthesis or gene cloning method, constructing ZmMIKC2a gene over-expression vector, and introducing the over-expression vector into target rice to obtain ZmMIKC2a gene over-expression plant.
2. ZmMIKC2a ZmMIKC2a ZmMIKC2a2. The method for improving the amylose content of rice grains based on the gene ZmMIKC2a as claimed in claim 1, wherein the method for obtaining the gene ZmMIKC2a is a gene cloning method, and comprises the following specific steps: extracting corn kernel endosperm or corn filament RNA and inverse transcribing into cDNA, designing specific amplification primer according to ZmMIKC2a gene sequence by using cDNA as template, and carrying out PCR amplification.
3. ZmMIKC2a3. The method for improving the amylose content of rice grains based on the ZmMIKC2a gene as claimed in claim 2, wherein the sequence of the specific amplification primer is as follows:

   MIKC2a -F：5′- ATGGGTAGGGGAAGGATTGA -3′

   MIKC2a -R：5′- TTAGAACTGATGATGAGGGTTATTG -3′。
4. ZmMIKC2a ZmMIKC2a ZmMIKC2a4. The method for improving the content of the amylose in rice grains based on the gene ZmMIKC2a as claimed in claim 1, wherein the over-expression vector of the gene ZmMIKC2a is a pCAMBIA1301 plant expression vector with a multiple cloning site region sequentially connected with a 35S promoter, a gene ZmMIKC2a and a terminator.