CN116949187B - DCT gene molecular marker related to skin blackness of five black chickens and application thereof - Google Patents

DCT gene molecular marker related to skin blackness of five black chickens and application thereof Download PDF

Info

Publication number
CN116949187B
CN116949187B CN202310913978.6A CN202310913978A CN116949187B CN 116949187 B CN116949187 B CN 116949187B CN 202310913978 A CN202310913978 A CN 202310913978A CN 116949187 B CN116949187 B CN 116949187B
Authority
CN
China
Prior art keywords
genotype
chicken
skin
blackness
protrusion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310913978.6A
Other languages
Chinese (zh)
Other versions
CN116949187A (en
Inventor
黎镇晖
董旭
朱婷
郑茗
徐海平
郭钊文
罗雪辉
聂庆华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingyuan Qingcheng District Animal Health And Epidemic Prevention Center
Qingyuan Qingyuan Chicken Research Institute Qingcheng District Qingyuan City
South China Agricultural University
Original Assignee
Qingyuan Qingcheng District Animal Health And Epidemic Prevention Center
Qingyuan Qingyuan Chicken Research Institute Qingcheng District Qingyuan City
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingyuan Qingcheng District Animal Health And Epidemic Prevention Center, Qingyuan Qingyuan Chicken Research Institute Qingcheng District Qingyuan City, South China Agricultural University filed Critical Qingyuan Qingcheng District Animal Health And Epidemic Prevention Center
Priority to CN202310913978.6A priority Critical patent/CN116949187B/en
Publication of CN116949187A publication Critical patent/CN116949187A/en
Application granted granted Critical
Publication of CN116949187B publication Critical patent/CN116949187B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a DCT gene molecular marker related to skin blackness of five black chickens and application thereof, belonging to the field of poultry breeding. According to the invention, 9 SNP loci exist on the DCT gene, wherein the SNP loci NC_052532.1:g143A > G, NC _052532.1:g165G > T, NC _052532.1:g227A > G, NC _052532.1:g268C > A and NC_052532.1:g344T > C are obviously related to skin blackness (L1) at the protrusion of the pterygoid bone; NC_052532.1 g268C > A and NC_052532.1 g 34T > C are obviously related to skin blackness (L2) at the left side of the dragon bone process, and the SNP locus can be used as a potential molecular marker for breeding the skin blackness character of the five black chickens.

Description

DCT gene molecular marker related to skin blackness of five black chickens and application thereof
Technical Field
The invention relates to the field of poultry breeding, in particular to a DCT gene molecular marker related to skin blackness of five black chickens and application thereof.
Background
The skin blackness as an important apparent character of the five black chickens greatly influences the market value of the five black chickens, and the research on chicken complexion is mostly focused on nutrition regulation and control, and the variety breeding of gene regulation and molecular markers is still in an exploration stage. The skin blackness of five black chickens is mainly determined by the deposition of melanin synthesized by melanocytes in the skin, and the melanocytes are gland cells which are widely distributed and mainly exist in skin hair, eyes, central nervous system, endocrine system and other tissues of animals, and the main functions of the skin blackness are to store and transmit melanin synthetically. Melanin is present in animals as a multimeric natural pigment, usually in the form of particles, which is responsible for the coloration of the skin, hair and eyes; can also absorb ultraviolet rays to protect skin from ultraviolet rays; and secondly, the aromatic ring, phenolic hydroxyl and other parts in the melanin molecule have the capability of electron transfer, and can be subjected to oxidation-reduction reaction in organisms.
The dopachrome isomerase gene (DCT) may encode a protein known as dopachrome isomerase, also known as tyrosinase related protein 2 (TYRP 2). In melanocytes, the DCT gene forms a multienzyme complex with the other two tyrosinase family members (TYR and TYRP 1) to participate in the regulation of melanin synthesis. The research of Khumuperawat and the like shows that the DCT gene can be used as a candidate gene for melanin deposition of Thailand black-bone chickens; among tyrosinase family genes, DCT is found by Sultana et al to be a specific gene of melanocytes, and plays a key role in melanin synthesis and expression in skin, feathers, and even retina. Wang Yaqi, the DCT gene not only affects the hair color deposition of various animals, but also controls apoptosis of cells, and determines the survival of the cells. That is, the prior art has disclosed that the DCT gene is related to melanin formation, but the development of molecular markers of chicken skin color DCT genes has not been reported.
Disclosure of Invention
The invention aims to provide a DCT gene molecular marker related to the skin blackness of five-black chicken and application thereof, so as to solve the problems in the prior art, obtain one molecular marker related to the skin blackness of five-black chicken, have 5 SNP loci, can be used as a potential molecular marker for breeding the skin blackness character of five-black chicken, and provide a theoretical basis for molecular marker assisted selection of the skin blackness character of five-black chicken.
In order to achieve the above object, the present invention provides the following solutions:
the invention provides a molecular marker related to chicken skin blackness, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, wherein the molecular marker comprises single nucleotide polymorphism sites SNP1-SNP5, and the SNP1 is SEQ ID NO:1, and nc_052532.1:g.143a > g, and SNP2 is SEQ ID NO:1, and nc_052532.1:g.165gT, wherein SNP3 is SEQ ID NO:1, and nc_052532.1:g.227a > g, and the SNP4 is the nucleotide sequence of SEQ ID NO:1, and nc_052532.1:g.268c > a, and the SNP5 is SEQ ID NO:1, there is NC_052532.1:g.344T > C.
Preferably, the genotype of SNP1 is AA, AG or GG; the genotype of the SNP2 is GG, GT or TT; the genotype of the SNP3 is AA, AG or GG; the genotype of the SNP4 is CC, CA or AA; the genotype of SNP5 is TT, TC or CC.
The invention also provides a method for identifying the skin blackness of the chicken, which comprises the following steps:
(1) Using chicken genome DNA to be detected as a template, and amplifying the molecular marker or the gene fragment comprising the molecular marker by using a primer to obtain an amplified product; the primer is shown as SEQ ID NO:2 and the sequence of SEQ ID NO:3, a downstream primer shown in FIG. 3;
(2) And sequencing the amplification product, detecting the genotype of the single nucleotide polymorphism site SNP1-SNP5 of the molecular marker, and judging the skin blackness of the chicken to be detected according to the detected genotype.
Preferably, the reaction system for amplification is: 2 XGS Taq PCR Mix 15. Mu.L, upstream primer 1.2. Mu.L, downstream primer 1.2. Mu.L, 11.6. Mu.L ddH 2 O and 1. Mu.L of template DNA.
Preferably, the amplification reaction procedure is: 95. pre-denaturing at the temperature of 3min; 4. denaturation at 25s, annealing at 55.0℃for 25s, extension at 72℃for 30s,34 cycles; finally, the extension was carried out for 5min and stored at 4 ℃.
Preferably, genotypes at the SNP1, the SNP2, the SNP3, the SNP4 and the SNP5 are obviously related to skin blackness at the humeral protrusion of the root of the chicken wing; the genotypes at the SNP4 and the SNP5 are obviously related to the skin blackness at the left side of the keel process of the chicken.
The invention also provides application of the molecular marker in auxiliary chicken breeding.
Preferably, the molecular marker is applied to breeding of chicken skin blackness characters.
Preferably, the skin blackness of the chicken is skin blackness at the humerus protrusion of the root of the chicken wing and skin blackness at the left side of the dragon bone protrusion of the chicken.
The invention discloses the following technical effects:
according to the invention, SNP loci on DCT genes are obtained through screening, and 5 SNP loci (NC_052532.1:g143A > G, NC _052532.1:g165G > T, NC _052532.1:g227A > G, NC _052532.1:g268C > A and NC_052532.1:g344T > C) are found to be obviously related to skin blackness characters of five black chickens, so that theoretical basis is provided for molecular marker assisted selection of the skin blackness characters of the five black chickens, and a certain help is provided for early breeding of the five black chickens. .
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the L value, a value and b value at each part between different parents; in the figure, a measuring part 1 is the skin protruding out of the wing root humerus, and a measuring part 2 is the skin on the left side of the keel;
FIG. 2 shows SNP sites of DCT gene fragments.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
Example 1
1. Experimental materials and methods
1.1 Experimental materials
The experimental animals are provided by Zhuhai Yuhe farm and animal husbandry limited company, 50 male parent five-black chickens, 50 female parent Bai Yuluo g chickens, 160 offspring black-skin five-black chickens, 40 offspring white-skin five-black chickens are selected, the offspring five-black chickens used in the experiment are the same batch of hatching eggs, and the feeding and management conditions are consistent after hatching.
The sub-fin vein was collected using disposable blood collection tubes (Jiangsu medical instruments Co., ltd.) containing EDTA, each about 5mL, and the blood samples were stored in a refrigerator at 4℃and used as the subsequent DNA extraction samples.
1.2 Experimental method
1.2.1 Color difference meter for measuring skin blackness
The living skin color was measured by using a 3nh-NR20XE color difference meter (Shenzhen Sanhen technology Co., ltd.) and before the measurement, the measuring area and the fluff in the vicinity were removed by scissors, the L, a and b values of the skin at the position of the protrusion of the humerus of the pterygoid lamina and the skin on the left side of the protrusion of the osseous lamina were recorded, and the measurement was repeated twice for each part, and the average value was obtained. The measurement was preceded by correction with a white plate. The L value represents the brightness, and the lower the L value, the higher the skin blackness (skin blackness L1 at the protrusion of the wing root humerus, skin blackness L2 at the left side of the dragon bone protrusion); the value a represents redness; the b value represents yellowness.
1.2.2 DNA extraction
E.z.n.a. was used as required by the manufacturer's instructions. ® NRBC Blood DNA Midi blood DNA extraction kit (Omega BIO-TEK) total DNA was extracted from a blood sample, and DNA quality was checked by using a NanoDrop2000c ultra-differential spectrophotometer and 1% agarose gel electrophoresis, and DNA of acceptable quality was stored at-20 ℃. The DNA quality control standard is the quality concentration>100μg/mL，1.8< D 260 /D 280 。
1.2.3 Primer design
The red chicken (Gallus) DCT Gene (Gene ID: 395775) was located on chromosome 1 of chicken and contained 8 exons, and after the first exon (DCT-1) sequence was obtained in NCBI, primer design was performed using Primer Premier 5 software, and it was synthesized by the national institute of Biotechnology, inc. (Guangzhou), and specific Primer sequences are shown in Table 1.
TABLE 1 primer sequence information
SEQ ID NO:1 is:CCTAAGACCGTGAAACCGTATTTAACTCAAGATGAAATCACAGCTTGAAGTCGTGAGGCCTGGCCAGGTTACTCTTCTCTGAGTTGCTTTTATTCGAACGCTCTATGAATATACCATGGCACGTAGACTGATTTTTCAGTGAAGTTTCTAAAGGAAAAGCAGTCGGTAAATTAGAAGGGAGCGGGATAAATAATGTAAATATGAGAAAGCGGGAGCTGATGAGACTATTTGTATGAAGAGGCATTTTGTGCAAGGGTGGAGATCATGCGATCTCCAGAGTTGCTCTGCGTGCCTGAACTTTGGCCTCATTCTTCTGACTGCAGAATGAGGAGACAAAGGGCAATGCTGTGAAAGGGTAGTGATCTGTGGGGGAGGAAGAAGAGAGGATGTAGATCAATGAGAGCCAGTGTATGCATACAGGAAGGGAAAAGCAGAATGGAATGGAAGGAGGATCAGAGAGAGAGGAGACAAGCAGTGAGGCAGTAAAAGGATGCATGATGAAGAAGACATACAATAGAGGTATCATGCTCTTGAACTGGCTTCCACCTTTTATATTAAGTAGCTTTCCTTCAGAGATTGTCCAGTGAGACTCTCTTAAGTATTCAAACAATACATACCTAGTGGCAGTATTGGAAAACTGCCTCAGATCATGCTACTTGCGCTACGAAGTCTAGAGCAATTAAACTGACAACAGTTAAAGTCAGCAGCCAAAATATTTATCTATCACTTAAAATATGAACCGAGAGTTGGGTTTTGATGTATGCGTTGG。
note that: shading and thick marking are SNP loci related to the skin blackness of the chicken; the underlined sequences are primer sequences.
1.2.4 PCR amplification
Preparing a 30 mu L amplification reaction system: 15 μL2 xGS Taq PCR Mix, 1.2 μL Forward Primer, 1.2 μL Reverse Primer 1.2 μL, 11.6 μL ddH 2 O, 1. Mu.L template DNA, vortex 10 s, centrifuge 10 s. The PCR reaction procedure was as follows: 95. pre-denaturation at 3min at C, 34 cycles (denaturation at 94℃for 25s, annealing at 55.0℃for 25s, extension at 72℃for 30 s), final extension for 5min, and 5. Mu.L of PCR amplification product for agarose gel electrophoresis detection, and preservation of the remaining sample at 4 ℃.
1.2.5 sanger sequencing
The remaining PCR amplified product, which is clear in band, free of impurities and consistent in size with the target product, was sent to the Optimago, inc. (Guangzhou) for sequencing.
1.2.6 Identification and typing of SNP loci
And (3) comparing 260 sequencing results with DCT sequences obtained on NCBI by Seqman software in DNASTAR software, identifying SNP loci, and carrying out genotyping.
1.2.7 Statistical analysis of SNP locus data
Recording and counting genotypes of each SNP locus, and performing correlation analysis on different genotypes of each SNP locus and the skin blackness L value of the five black chickens by using single factor analysis of variance test in IBM SPSS Statistics software to obtain the target genePA rating of < 0.05 was assessed as a standard of significant variance.
2. Results and analysis
2.1 Skin color measurement results and sensory analysis
To evaluate whether the description of the skin blackness of the five black chickens by adopting the L value of the color difference meter is accurate and reliable, 50 male parent five black chickens and 50 female parent Bai Yuluo g chickens are selected for skin color measurement test. Firstly, through visual observation, the skin color degree between the male parent and the female parent is obviously different, namely the skin color is from deep to shallow, namely the skin color of the male parent five black chickens is larger than Bai Yuluo g of the female parent. Meanwhile, the result of the color difference meter shows that the L, a and b values of different measuring parts of the same generation group have no obvious difference, and the L value of Bai Yuluo g chicken of the female parent is obviously higher than that of five black chicken of the male parent (see figure 1). The test result shows that the skin blackness is inversely related to the L value of the color difference meter. Therefore, the L value is considered to be truly and credible as an index for detecting the skin blackness, and the lower the L value is, the higher the skin blackness is, and the higher the L value is, the lower the skin blackness is.
2.2 DCT gene fragment amplification and SNP locus screening
The DNA of 300 chickens is adopted as a template, all DNA samples are amplified and sequenced by using a primer DCT-1, 260 effective sequencing results are finally obtained after low-quality samples and sequencing failure results are removed, seqMan software in DNASTAR software is used for checking genotypes and peak diagrams, meanwhile, snapGene software is adopted for analyzing the sequencing peak diagrams, and the sequencing results are compared with DCT gene sequences provided on NCBI. The statistics show that the DCT genes tested coexist at 9 SNP sites (see FIG. 2), respectively: NC-052532.1:g96G > T, NC-052532.1:g143A > G, NC-052532.1:g165G > T, NC-052532.1:g199A > G, NC-052532.1:g227A > G, NC _052532.1 g268C > A, NC _052532.1 g 34T > C, NC _052532.1 g 602A > T, NC _052532.1 g 319A > T, the mutation rates were all above 45%, and the mutation rate information is shown in Table 2.
TABLE 2 mutation Rate of SNP loci
2.3 Correlation analysis of SNP locus and five black chicken skin blackness character
Correlation analysis using IBM SPSS Statistics software found that NC-052532.1:g.143A was detected at 9 SNP sites among the 9 SNP sites detected in the DCT gene>G、NC_052532.1:g.165G>T、NC_052532.1:g.227A>G、NC_052532.1:g.268C>A、NC_052532.1:g.344T>C5 SNP loci are obviously related to the skin blackness (L1) at the humerus protrusion of the root part of the chicken wingP< 0.05）；NC_052532.1:g.268C>A and NC_052532.1:g.344T>C2 SNP loci are obviously related to the skin blackness (L2) at the left side of the dragon bone process of the chickenP<0.05 The correlation results are shown in table 3.
TABLE 3 association analysis of SNP loci of DCT genes and skin blackness values
Note that: the number in brackets after genotype represents the geneNumber of samples in the experimental animal population; genotypes without letter mark and with the same letter mark represent that the two groups of differences are not obviousP> 0.05), and different letter labels represent obvious differenceP＜0.05）。
The above results show that the DCT gene can be used as candidate gene for researching the melanin deposition of the skin of the five black chicken, and 5 SNP sites which are obviously related to the skin blackness of the five black chicken, in particular NC_052532.1:g.143A, are found on the DCT gene>G、NC_052532.1:g.165G>T、NC_052532.1:g.227A>G、NC_052532.1:g.268C>A、NC_052532.1:g.344T>C5 SNP loci are obviously related to the skin blackness (L1) at the humerus protrusion of the root part of the chicken wingP<0.05）；NC_052532.1:g.268C>A、NC_052532.1:g.344T>C2 SNP loci are obviously related to the skin blackness (L2) at the left side of the dragon bone process of the chickenP<0.05). The SNP locus can be used as a potential molecular marker, and provides a theoretical basis for molecular breeding improvement of the five black chickens skin color character in actual breeding work.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (4)

1. A method for identifying skin blackness of a five black chicken, which is characterized by comprising the following steps:
(1) Using chicken genome DNA to be detected as a template, and amplifying a molecular marker or a gene fragment comprising the molecular marker by using a primer to obtain an amplified product; the primer is shown as SEQ ID NO:2 and the sequence of SEQ ID NO:3, a downstream primer shown in FIG. 3;
(2) Sequencing the amplification product, detecting the genotype of the single nucleotide polymorphism site SNP1-SNP5 of the molecular marker, and judging the skin blackness of the chicken to be detected according to the detected genotype;
the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, wherein the molecular marker comprises single nucleotide polymorphism sites SNP1-SNP5, and the SNP1 is SEQ ID NO:1, nc_052532.1:g.143a > g, said SNP2 is SEQ ID NO:1, and nc_052532.1:g.165gT, wherein said SNP3 is set forth in SEQ ID NO:1, nc_052532.1:g.227a > g, and the SNP4 is SEQ ID NO:1, nc_052532.1:g.268c > a, said SNP5 is SEQ ID NO:1 in the sequence shown in (1) in (2) in (1) g.34T > C;
the genotype of the SNP1 is AA, AG or GG; the genotype of the SNP2 is GG, GT or TT; the genotype of the SNP3 is AA, AG or GG; the genotype of the SNP4 is CC, CA or AA; the genotype of the SNP5 is TT, TC or CC;
the skin blackness of the chicken is skin blackness at the humerus protrusion of the root of the chicken wing and skin blackness at the left side of the dragon bone protrusion of the chicken;
genotypes at the SNP1, the SNP2, the SNP3, the SNP4 and the SNP5 are obviously related to the skin blackness at the humerus protrusion of the root of the chicken wing; the genotypes at the SNP4 and the SNP5 are obviously related to the skin blackness at the left side of the keel process of the chicken;
at the SNP1 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individuals with the AA genotype and the AG genotype is higher than that of the chicken individuals with the GG genotype; at the SNP2 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individual with the GG genotype is higher than the skin blackness at the root humerus protrusion of the chicken individual with the GT genotype and the TT genotype; at the SNP3 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individual with the AA genotype is higher than that of the chicken individual with the GG genotype; at the SNP4 locus, the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the CC genotype are higher than the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the CA genotype and the AA genotype; at the SNP5 locus, the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the TT genotype are higher than the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the TC genotype and the CC genotype.
2. The method of claim 1, wherein the amplified reaction system is: 2 XGS Taq PCR Mix 15. Mu.L, upstream primer 1.2. Mu.L, downstream primer 1.2. Mu.L, 11.6. Mu.L ddH 2 O and 1. Mu.L of template DNA.
3. The method of claim 1, wherein the amplification reaction procedure is: pre-denaturation at 95℃for 3min; denaturation at 4℃for 25s, annealing at 55.0℃for 25s, elongation at 72℃for 30s,34 cycles; finally, the extension was carried out for 5min and stored at 4 ℃.
4. The application of the reagent for detecting the molecular marker in assisting the breeding of the skin blackness character of the five black chickens is characterized in that the skin blackness character of the chickens is skin blackness at the humerus protrusion of the roots of the chickens and skin blackness at the left side of the dragon bone protrusion of the chickens;
the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, wherein the molecular marker comprises single nucleotide polymorphism sites SNP1-SNP5, and the SNP1 is SEQ ID NO:1, nc_052532.1:g.143a > g, said SNP2 is SEQ ID NO:1, and nc_052532.1:g.165gT, wherein said SNP3 is set forth in SEQ ID NO:1, nc_052532.1:g.227a > g, and the SNP4 is SEQ ID NO:1, nc_052532.1:g.268c > a, said SNP5 is SEQ ID NO:1 in the sequence shown in (1) in (2) in (1) g.34T > C;
the genotype of the SNP1 is AA, AG or GG; the genotype of the SNP2 is GG, GT or TT; the genotype of the SNP3 is AA, AG or GG; the genotype of the SNP4 is CC, CA or AA; the genotype of the SNP5 is TT, TC or CC;
genotypes at the SNP1, the SNP2, the SNP3, the SNP4 and the SNP5 are obviously related to the skin blackness at the humerus protrusion of the root of the chicken wing; the genotypes at the SNP4 and the SNP5 are obviously related to the skin blackness at the left side of the keel process of the chicken;
at the SNP1 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individuals with the AA genotype and the AG genotype is higher than that of the chicken individuals with the GG genotype; at the SNP2 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individual with the GG genotype is higher than the skin blackness at the root humerus protrusion of the chicken individual with the GT genotype and the TT genotype; at the SNP3 locus, the skin blackness at the root humerus protrusion of the chicken wing of the chicken individual with the AA genotype is higher than that of the chicken individual with the GG genotype; at the SNP4 locus, the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the CC genotype are higher than the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the CA genotype and the AA genotype; at the SNP5 locus, the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the TT genotype are higher than the skin blackness at the humeral protrusion of the root of the chicken wing and the skin blackness at the left side of the keel of the chicken individual with the TC genotype and the CC genotype;
the reagent is SEQ ID NO:2 and the sequence of SEQ ID NO:3, and a downstream primer shown in 3.
CN202310913978.6A 2023-07-25 2023-07-25 DCT gene molecular marker related to skin blackness of five black chickens and application thereof Active CN116949187B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310913978.6A CN116949187B (en) 2023-07-25 2023-07-25 DCT gene molecular marker related to skin blackness of five black chickens and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310913978.6A CN116949187B (en) 2023-07-25 2023-07-25 DCT gene molecular marker related to skin blackness of five black chickens and application thereof

Publications (2)

Publication Number Publication Date
CN116949187A CN116949187A (en) 2023-10-27
CN116949187B true CN116949187B (en) 2024-02-20

Family

ID=88444096

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310913978.6A Active CN116949187B (en) 2023-07-25 2023-07-25 DCT gene molecular marker related to skin blackness of five black chickens and application thereof

Country Status (1)

Country Link
CN (1) CN116949187B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101701105B1 (en) * 2015-10-26 2017-02-01 충남대학교산학협력단 Genetic marker for discriminating plumage color of Korean native duck and uses thereof
CN107988376A (en) * 2016-10-26 2018-05-04 乐山师范学院 A kind of application of relevant SNP marker of the colour of skin in black-bone chicken Genotyping
CN113913539A (en) * 2021-12-03 2022-01-11 华南农业大学 Molecular marker related to chicken skin yellowness character and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101701105B1 (en) * 2015-10-26 2017-02-01 충남대학교산학협력단 Genetic marker for discriminating plumage color of Korean native duck and uses thereof
CN107988376A (en) * 2016-10-26 2018-05-04 乐山师范学院 A kind of application of relevant SNP marker of the colour of skin in black-bone chicken Genotyping
CN113913539A (en) * 2021-12-03 2022-01-11 华南农业大学 Molecular marker related to chicken skin yellowness character and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Factors affecting gene expression associated with the skin color of black-bone chicken in Thailand;Panuwat Khumpeerawat等;Poult Sci;第100卷(第11期);第101440页 *
rs731926242.Ensembl.2022,第1-2页. *
Transcriptome analysis of feather follicles reveals candidate genes and pathways associated with pheomelanin pigmentation in chickens;Xiaotong Zheng等;Sci Rep;第10卷(第1期);第12088页 *

Also Published As

Publication number Publication date
CN116949187A (en) 2023-10-27

Similar Documents

Publication Publication Date Title
CN107988376B (en) Application of SNP (single nucleotide polymorphism) marker related to skin color in black-bone chicken genotyping
CN107475412A (en) A kind of molecular labeling related to chicken egg-laying deseription and its application in chicken breeding
CN112725462B (en) SNP molecular marker combination related to body weight and body size of Longsheng chicken and screened based on whole genome sequencing and application
CN114736973B (en) SNP molecular marker related to chicken carcass skin color traits and application thereof
KR20170124003A (en) Method for predicting skin pigmentation
CN110643716A (en) Molecular marker related to sheep tail fat weight and application thereof
CN111575350B (en) Screening method and application of SNP molecular markers related to concentrated egg white height and yolk color of Nandan Yao chicken eggs
CN112921101A (en) Molecular marker related to sheep remaining feed intake and application thereof
CN116949187B (en) DCT gene molecular marker related to skin blackness of five black chickens and application thereof
CN115820870B (en) CDK5 gene molecular marker related to chicken complexion and carcass traits and application
CN115851966B (en) ApoD gene molecular marker related to chicken carcass traits and application
CN110438243B (en) FABP4 gene SNP molecular marker, primer pair and kit related to meat quality of Yanbian yellow cattle and application thereof
CN110079612B (en) SNP molecular marker related to chicken weight, leg muscle weight and leg muscle fiber characters as well as detection method and application thereof
CN115181805B (en) Molecular marker related to yellow-feather broiler leg skin yellowness and application thereof
KR102403326B1 (en) Genetic markers for identify individual of Anguilla japonica and method using the same
KR102110100B1 (en) SNP primer set for golden flat fish and identification method of golden flat fish same
CN116790767B (en) TYR gene molecular marker related to chicken skin blackness and application thereof
CN114350818A (en) Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof
CN116555446B (en) DCT gene molecular marker related to black peritoneum character of chicken and application
CN116814801B (en) LncEDCH1 gene molecular marker related to chicken skin yellowness and application thereof
CN112831569B (en) SNP molecular marker combination related to weight and body size of black-bone chicken in east orchid based on whole genome sequencing screening and application
CN116334235B (en) SERCA2 gene molecular marker related to chicken carcass traits and application thereof
CN114369670B (en) SNP molecular marker located in SREBF2 gene and related to muscovy duck sexual precocity trait and application
CN110656195B (en) SNP locus for identifying flesh color of Xinlimei radish and application thereof
CN116814811B (en) SLC38A11 gene SNPs molecular marker primer combination and application thereof in molecular assisted breeding

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant