KR102403326B1 - Genetic markers for identify individual of Anguilla japonica and method using the same - Google Patents

Abstract

The present invention provides a genetic marker capable of individual identification and parentage confirmation of far eastern Anguilla japonica by developing a primer combination capable of simultaneously analyzing several microsatellite markers with various alleles, and optimizing and establishing multiple amplification reaction conditions, and a method using the same.

Description

Genetic markers for identify individual of Anguilla japonica and method using the same}

The present invention relates to a genetic marker for individual identification of eels, and more particularly, to a genetic marker for individual identification and paternity confirmation of an eel from the Far East, and a method using the same.

Eel is one of the fish loved as a tonic food in many countries, including Korea, and is a food that provides rich nutrients including high-quality protein and vitamins. In particular, consumption of eels is mainly made in Korea and Japan, which accounts for 20% of global eel consumption (62,640 tons in 2016). Globally, the production of eels has been over 200,000 tons per year since the late 1990s, and it has continued to increase, reaching 270,000 tons in 2018 (FAO). The eels currently farmed in Korea include Far East eels ( Anguilla japonica ), North American eels ( A. rostrata ), Southeast Asian eels ( A. bicolor bicolor ), and radish eels ( A. marmorata ), most of which are Far East eels. is occupied by Currently, more than 97% of the supply of eels is produced by aquaculture, but the mass production technology for artificial seeds has not been established. Therefore, eel farming has an unstable supply and demand structure in which production is determined according to the amount of eels collected. Therefore, it can be said that the development of specific genetic markers is essential in order to establish resource management and artificial seed mass production technology according to securing the genetic diversity of eels. In this regard, Korean Patent Registration No. 1047322 discloses a DNA marker for the discrimination of Anguilla eel species.

However, in the case of the prior art, it relates to the species identification of the genus of eels from the Far East, and the technology for microsatellite genetic markers for individual identification of eels is still unexplored.

The present invention is to solve various problems, including the above problems, by developing a primer combination capable of simultaneously analyzing multiple microsatellite markers having various alleles, and by optimizing and establishing multiple amplification reaction conditions. An object of the present invention is to provide a genetic marker capable of individual identification and paternity confirmation and a method using the same. However, these problems are exemplary, and the scope of the present invention is not limited thereto.

According to one aspect of the present invention, i-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 1 and a reverse primer set forth in SEQ ID NO: 2;

i-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 7 and a reverse primer set forth in SEQ ID NO: 8, and

i-3) a first primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 13 and a reverse primer set forth in SEQ ID NO: 14;

ii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 3 and a reverse primer set forth in SEQ ID NO: 4;

ii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 9 and a reverse primer set forth in SEQ ID NO: 10, and

ii-3) a second primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 15 and a reverse primer set forth in SEQ ID NO: 16; and

iii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 5 and a reverse primer set forth in SEQ ID NO: 6;

iii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 11 and a reverse primer set forth in SEQ ID NO: 12, and

iii-3) a third primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 17 and a reverse primer set forth in SEQ ID NO: 18, wherein the first primer set is a first fluorescent material a label, the second set of primers is labeled with a second fluorescent material, the third set of primers is labeled with a third fluorescent material, and the first to third fluorescent materials emit light of different wavelengths, respectively. A kit for individual identification of Far East eels is provided.

According to another aspect of the present invention, an extraction step of extracting a DNA sample of an eel from the Far East;

an amplification step of amplifying the DNA sample with the kit of claim 1; and

There is provided a method for identifying an eel from Far East, including analyzing the band pattern of the amplification product of the amplification step.

The genetic marker for individual identification of eels of the present invention made as described above is a genetic marker with high discrimination and excellent amplification rate developed based on next-generation sequencing. A multiplex PCR set capable of simultaneously analyzing 9 markers at once. It can be developed and analyzed quickly and accurately, and it can be used for efficient management of sheep lines and breeding lines because it is possible to identify individuals and confirm paternity accurately and scientifically. Of course, the scope of the present invention is not limited by these effects.

1 is a diagram schematically showing the size range of the allele for each microsatellite marker and the fluorescent dye label of the present invention.
2 is a graph showing the genotype analysis results of Far East eels. Each peak represents an allele of the microsatellite marker.
3 is a graph showing the genotype analysis results of the parent group of Far Eastern eels.
4 is a graph showing the results of paternity analysis based on genotype frequency using parantage analysis of Cervus 3.0.7 software. (*) indicates an accuracy of 95% or more, and (+) indicates an accuracy of 80% or more.

Definition of Terms:

As used herein, the term “marker” refers to a specific sequence of DNA that can identify a known position on a chromosome, and can show diversity caused by mutation or modification at a locus. These markers can be used to scientifically identify and evaluate the genetic makeup and characteristics of an organism.

As used herein, the term “microsatellite” refers to a region in which a nucleotide sequence appears repeatedly, and in general, a repeating sequence of about 5 to 50 times appears in one microsatellite. These microsatellites are also called short tandem repeat (STR) or simple sequence repeat (SSR). Microsatellites show a higher mutation rate than other DNA regions and can be used for individual identification or paternity confirmation because the number of repetitions is different for each individual.

As used herein, the term "multiplex PCR" is a method capable of amplifying desired PCR products through a single PCR reaction from a composition in which various primers are complexly combined.

As used herein, the term "next generation sequencing" is a method of analyzing a genome sequence at high speed, and has a feature of processing a large number of nucleotide sequences in parallel.

As used herein, the term "Far Eastern eel" is a freshwater fish belonging to the eel family of the order Eelaceae, and the body length is about 60 cm, and it is very long and thin. There are oval-shaped fine scales on the body, but it is covered in the skin and appears to be missing. The back is blue-gray and the belly is white or yellow. They are carnivorous and mainly feed on benthic invertebrates and are active at night.

DETAILED DESCRIPTION OF THE INVENTION:

According to one aspect of the present invention, i-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 1 and a reverse primer set forth in SEQ ID NO: 2;

i-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 7 and a reverse primer set forth in SEQ ID NO: 8, and

i-3) a first primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 13 and a reverse primer set forth in SEQ ID NO: 14;

ii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 3 and a reverse primer set forth in SEQ ID NO: 4;

ii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 9 and a reverse primer set forth in SEQ ID NO: 10, and

ii-3) a second primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 15 and a reverse primer set forth in SEQ ID NO: 16; and

iii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 5 and a reverse primer set forth in SEQ ID NO: 6;

iii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 11 and a reverse primer set forth in SEQ ID NO: 12, and

iii-3) a third primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 17 and a reverse primer set forth in SEQ ID NO: 18, wherein the first primer set is a first fluorescent material a label, the second set of primers is labeled with a second fluorescent material, the third set of primers is labeled with a third fluorescent material, and the first to third fluorescent materials emit light of different wavelengths, respectively. A kit for individual identification of Far East eels is provided.

In the kit, the first to third fluorescent materials may be each selected from the group consisting of FAM, HEX, and TAMARA, and the primer pair may be included at a final concentration of 0.1 to 0.5 μM, respectively.

According to another aspect of the present invention, an extraction step of extracting a DNA sample of an eel from the Far East;

an amplification step of amplifying the DNA sample with the kit of claim 1; and

There is provided a method for identifying an eel from Far East, including analyzing the band pattern of the amplification product of the amplification step.

In the identification method, the amplification step may be performed by multiplex PCR. In addition, in order to proceed with the multiplex PCR, the 5' side of each marker primer forward oligo (forward primer) is labeled with three fluorescent materials such as FAM, HEX, and TAMRA, and PCR details such as temperature and time for amplification Conditions may be included.

Pedigree information is an essential element for genetic improvement in selective breeding and individual or pedigree management of cultured organisms (Gjedrem and Baranski, Springer Science & Biasness Media, 10, 2010). In livestock and plant species, physical labeling can be used to label individuals, but most aquatic organisms have a disadvantage in that physical labeling is difficult. and Cordes, Aquaculture , 283, 1-37. 2004).

Individual identification and paternity using genetic markers is based on the simple concept that offspring inherit one of two alleles at each locus from each parent (Herbinger et al ., Acuaculture 137, 245-256. 1995). Thus, the offspring will have one allele from each parent. Paternity can be accomplished by comparing the DNA markers of the offspring to the genotype of the potential parent. In comparison, paternity can be ruled out with 100% certainty if alleles in one set of marker loci are found only in the genotype of the offspring not in the putative parent. Conversely, if the genotypes of the offspring and potential parents perfectly match at the locus of multiple markers, it can be confirmed that there is a high probability of parentage. The more DNA markers used in this analysis, the better the accuracy.

DNA markers are being used as an efficient means to predict genetic variation and relationships at the DNA level without being affected by the environment (Van and Van, Theoretical and Applied Genetics , 60, 285-290. 1981). Among them, microsatellite markers not only essentially reflect the genetic characteristics of a species, but also exist throughout the genome of eukaryotes (Liu, WileyBlackwell , 2011). In addition, due to its high polymorphism and high reproducibility among individuals, it is widely used in population genetic studies to maintain the genetic diversity of biological species and studies such as individual identification and paternity (Jarne and Lagoda, Trends in Ecology and Evolution , 11). , 424-429. 1996).

Meanwhile, Far East eel ( Anguilla japonica ), a major aquaculture target species representing domestic fish farming, is one of the tonic foods loved in many countries including Korea. Eel has a high content of vitamin E and is evaluated as a good food for relieving fatigue. In addition, it is rich in unsaturated fatty acids such as vitamin A, taurine, docosahexaenoic acid and eicosapentaenoic acid. it is known Globally, the genus Anguilla fish is classified into 15 species and 3 subspecies, and a total of 18 species. Of these, 12 species inhabit the tropical regions of India and the Pacific, 3 species inhabit the temperate regions of the northern hemisphere, and 3 species are known to inhabit the temperate regions of the South Pacific. Two types of eels from the Far East (A. japonica) and A. marmorata live in Korea. Of these, the eels from the Far East are distributed in all rivers except for the rivers flowing north of 50 thousand in the Samcheok region of the eastern coast of Korea. It is widely collected in the area. It is known that the production of artificial seeds is very difficult because eels usually spawn at a depth of about 300 meters in the sea and come up to the river in the form of eels after 6 months to grow and grow. Therefore, although eel is a major aquaculture target species, industrialization technology for artificial seed production has not been established, so most of it is cultured using wild eel seeds collected from nature. Recently, due to overfishing of resources, habitat destruction, global warming, etc., the catch of eel has decreased, and the proportion of imports is gradually increasing. In addition, there is a movement to designate eels from the Far East as well as eels from Europe, which are endangered species, as import bans and trade sanctions.

For individual identification and paternity of Far Eastern eels, it generally consists of tissue sample collection, DNA extraction, DNA marker selection, PCR amplification, genotyping of PCR products, and data analysis steps to analyze the relationship between parent and offspring.

In general, a microsatellite marker is a representative molecular marker used for individual identification and paternity confirmation. Microsatellite refers to a sequence in which a specific base is repeated in the genome, and various alleles exist depending on the degree of repetition. The mutation of this repeating sequence has excellent resolving power to the extent that the number of repetitions differs for each individual, and since it is inherited from parents to offspring according to Mendel's law of inheritance, it can be used for paternity analysis and pedigree creation.

In fish farming and breeding, it can be said that securing genetic diversity to prevent the occurrence of deformities and diseases caused by genetic recessiveness is of utmost importance. Reduction of genetic diversity leads to an increase in group inbreeding and a genetic bottleneck, and it appears as external expressions such as growth retardation, frequent disease occurrence, and malformations, and ultimately leads to serious consequences such as reduction in group size or extinction. Therefore, in order to establish resource management and artificial seed mass production technology for Far East eels, individual management and paternity confirmation using molecular markers and maintenance of genetic diversity using them are essential.

Accordingly, the present inventors developed a microsatellite gene marker for eel individual identification with high discrimination and excellent amplification rate developed based on next-generation sequencing. The genetic marker is a multiplex PCR set capable of simultaneously analyzing 9 markers at a time, enabling rapid and accurate individual identification and paternity confirmation, so it can be used to investigate the release effect of eel-released seeds. It can be actively used for efficient management of sheep and breeding lines by understanding the degree of inbred and pedigree relationship between individuals.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. It is provided to fully inform the

Example 1: Clinical sample information

To develop genetic markers for individual identification and paternity verification of Far Eastern eels, one eel specimen (March 15, 2019) was obtained from the Aquaculture Research Department of the Aquaculture Industry Research Department of the National Academy of Fisheries Science. After collecting the muscle tissue of the eel, 5 μl of Proteinase K was added to 600 μl of 8M TNES-UREA to isolate the polymer genomic DNA, followed by reaction at 37° C. for 12 hours. Thereafter, after confirming that the tissue was completely dissolved, genomic DNA was purified using a phenol-chloroform (Phenol:Chloroform) extraction method and an ethanol precipitation method. The presence or absence of genomic DNA was confirmed by electrophoresis of the isolated genomic DNA on a 1% agarose gel, and the concentration was measured using a NanoVue (Ge Healthcare) spectrophotometer. After that, cytochrome b gene sequence analysis of mitochondrial DNA was performed to identify genetic species from the extracted eel genomic DNA. A nucleotide sequence of about 600 bp was obtained using the following general-purpose primer, and 100% identical to A. japonica (MH050933) through NCBI BLAST (http://www.ncbi.nlm.nih.gov/BLAST) analysis. Confirmed. The universal primer information is summarized in Table 1 below.

Universal primer sequence information primer sequence (5'-->3') SEQ ID NO: Cyt-H AAACTGCAGCCCCTGCTCAGAATGATATTTGTCCTCA 19 Cyt-L CGAAGCTTGATATGAAAAACCATCGTT 20

Example 2: Mass production and preprocessing of genomic information

Next-generation sequencing was performed for assembling the eel genome from the genomic DNA extracted in Example 1. First, for short read sequencing, a library for NGS analysis was prepared using Illumina TruSeq Nano DNA Prep Kit (Insert 550bp), and the size and concentration of DNA fragments were measured for the library using an Agilent High Sensitivity DNA Chip. . After that, only the concentration of the eel library excluding the adapter dimer was accurately quantified using digital PCR and Taqman probe, and sequencing was performed with the NovaSeq 6000 platform to obtain about 26 Gb of nucleotide sequence data. Afterwards, for long read sequencing analysis, a library was constructed using the PacBio SMRT sequencing method, and only 15 kb or more of 500 ng to 5 μg was recovered using the BluPippin system (0.75% gel), followed by QC of the library with a bioanalyzer. For the prepared library, about 82 Gb of nucleotide sequence data was obtained by PacBio SMRT sequencing (see Table 2). For single genome assembly using long reads, clean pared-end reads were used to remove long reads contamination. For decontaminated long reads, after primary genome assembly using FALCON_UNZIP, error correction and secondary assembly were performed using clean paired-end reads to complete the 1,051.82 Mb crude eel genome from the Far East. The sequence information analysis results are summarized in Table 2 below, and genome assembly information is summarized in Table 3 below.

Sequence information analysis result Sequel (Long reads) farsighted 82,855,116,121 (78.77 X) NovaSeq (151 x 2) farsighted
(%) 52,580,806,242 (49.99X) -100 high quality
(%) 49,621,342,278 -94.37 pollutant removal
(%) 49,099,154,567 -93.38 organelle trimming
(%) 49,078,360,678 -95.13 Clean (bp)
(%) 49,078,360,678 -95.13

Far Eastern eel raw genome assembly information genome assembly Far East eel Expected genome size (bp) 1,087,876,12 No. Contigs 1,306 Total continuation length (bp) 1,051,819,391 assembly achievement 96.69% Average length (bp) 805,374 Minimum length (bp) 27,149 Maximum length (bp) 7,452,511 N50 (bp) 1,611,243 N (%) 0.00 GC (%) 43.42 repeat(%) 24.27 BUSCO (actinopterygii_odb10) (%) 94.11 BUSCO (vertebrata_odb10) (%) 95.90 Segma (%) 80.24

Example 3: Analysis of genomic information

GRAMENE's Simple Sequence Repeat Identification Tool (SSRIT) was used to develop microsatellite markers for eels from the Far East. From the assembled eel genome data, candidate markers were discovered by varying the number of repeats according to the length of the motif. Prediction conditions are that the motif has a size of 10 to 20 bp, with di for 9 or more repetitions, tri for 6 or more repetitions, tetra for 5 or more repetitions, penta for 4 or more repetitions, and finally hexa for 3 or more repetitions. Repeat conditions were set. Among the selected markers, a sequence of at least 500 bp upstream and downstream for PCR primer production was secured, and microsatellite markers in the 3'-UTR region with high diversity and relatively stable inheritance were preferentially selected.

Example 4: Microsatellite Marker Selection

The present inventors searched for microsatellite marker candidates through genomic information comparative analysis, and designed primers for PCR amplification using Primer3 software based on the searched microsatellite marker candidates. Stable amplification was made possible for the conserved regions of both adjacent sequences centering on the microsatellite marker sequence. For each microsatellite marker, the size of the amplification product was set to 100, 200, and 300 bp, so that three different A multiplex PCR was prepared in which the primer sequence was predicted and the results could be collectively confirmed by a single analysis later. Finally, among microsatellite marker candidates, 96 marker information was obtained in the order of the highest repeat number under the tri-modif condition in consideration of the accuracy of data reading during genotype analysis.

The selected 96 microsatellite marker candidates were arbitrarily selected as 100, 200, and 300 bp in size of the PCR product in consideration of multiplex PCR to prepare primers. For PCR amplification of the prepared primers, eel samples stored in the National Fisheries Research Institute of Fisheries and Life Resources storage were used, and PCR analysis was performed under PCR AT 60°C conditions for two individuals, followed by 1% agarose gel electrophoresis. It was determined whether or not amplification was performed. As a result of PCR analysis, it was confirmed that all markers except for 18 of the 96 markers were amplified, and finally 27 markers were selected in consideration of the size and number of repeats of the amplification product. As for the selected marker, primers capable of amplifying 100, 200, or 300 bp for each fluorescence (FAM, HEX, TAMRA) were used to enable multiplex analysis.

Example 5: Individual identification and paternity analysis of Far Eastern eels

The present inventors utilized the eel progeny and parent generation artificially produced by the Aquaculture Research Department of the National Academy of Fisheries Science for individual identification and paternity analysis of Far Eastern eels. For the analysis, four artificially produced populations (13 parents, 85 offspring) and natural eels (22 individuals) were used as controls (see Table 4). The Far East eel samples are summarized in Table 4 below.

Far Eastern eel sample information female cock number of individuals hatch date F4462 M3171 24 2020.12.17. (correction)
Day 19 of hatching M3893 F4867 M1211 23 2020.12.10. (correction)
Day 26 of hatching M3893 F3703 M3689 23 M3171 M3745 M3278 M1211 M2881 F3591 M3072 15 M3893 M3278 M3896

The size of alleles for each microsatellite marker was analyzed using the ABI PRISM 3730XL DNA Analyzer (Applied Biosystems) device, and the results were calculated using the GeneMapper v5.0 program. The number and frequency of alleles were analyzed using the GenAlEx v6.502 program and the Arlequin v3.5.1.2 program, and Cervus 3.0.7. A combination of markers for individual identification and paternity was tested using the program ( FIGS. 1 and 2 ).

Of the 27 markers used in the analysis, 9 markers that were finally easy to analyze were finally selected through microsatellite analysis data reading (see Table 5), and the frequency of alleles for each mating group through the Arlequin v3.5.1.2 program was analyzed (FIG. 3). As a result of comparing the alleles of the parent group and the progeny, it was confirmed that most alleles of the parent group were inherited into the progeny. Information on the selected 9 microsatellite markers is summarized in Table 5 below.

Far East eel microsatellite marker sequence information designation scaffold motif number of copies size range Forward (F) and Reverse (R) Neon SEQ ID NO: ANJAP-30
ANJAP000439
TTA
13
82-148
(F) CCAGTTTCGTGCCTTGTACTTT FAM
One (R) ACCAGCCTGTGTTAAAGGCTTA 2 ANJAP-50
ANJAP000813
TTA
16
78-147
(F) ACAGAGGAACATGTAAATGTATCCA HEX
3 (R) CGGATAATGTCTAGCCCTGCTT 4 ANJAP-51
ANJAP000814
TTA
13
102-144
(F) GCCATGGCAATTCAGAGCATAA TAMRA
5 (R) ACGGTCATTAAGGTTAGAGGGT 6 ANJAP-03
ANJAP000032
TTA
21
156-246
(F) GGGGAAAGAATCTGTGTCCCAT FAM
7 (R) AAGGAAAGCACCAGCAAACATC 8 ANJAP-47
ANJAP000802
AAT
25
163-205
(F) GGTAGCGGGTATTCCAAAATGC HEX
9 (R) CCGTCTAGAGCGCTTTTATGGA 10 ANJAP-56
ANJAP000843
TAA
21
295-334
(F) CAGCCTTAACGGTCCTATCAGT TAMRA
11 (R) TCTGATTCATTACCCAGGGCAC 12 ANJAP-69
ANJAP000890
ATT
21
292-337
(F) CGCAGTGTAAGCTGGTGATAGA FAM
13 (R) TCATTCTGATGCCCGAAGGTTA 14 ANJAP-78
ANJAP000949
TTA
19
258-324
(F) CACCACACGATGCAATCAACTT HEX
15 (R) GGACAATGGGGTACAAAAAACCG 16 ANJAP-89
ANJAP001084
ATT
22
246-282
(F) AGAAAGCCTTACCTGCATGTGA TAMRA
17 (R) CGCTGCTTGAAGTGCTGATAAA 18

Based on the information on the analyzed markers, individual identification and paternity test tests were performed through the Cervus 3.0.7 program. The genotype information of the parent group (4 cancers, 14 males), the progeny group (85 individuals), and the wild population (22 individuals) were all mixed and used for analysis. As a result of the analysis, it was confirmed that all of the progeny groups of group 1 (F4462 x M3171, M3893) were produced from the parents of F4462 x M3171, and the progeny generation of group 2 (F4867 x M1211, M3893) was 7 from the parents of F4867 x M1211. , F4867 x M3893 It was confirmed that 16 mice were produced from the parents. The progeny of group 3 (F3703 x M3689, M3171, M3745, M3278, M1211, M2881) were from the parent of F3703 x M3689, 6 from the parent of F3703 x M3171, 1 from the parent of F3703 x M3745, F3703 x M3278 It was confirmed that 2 mice were produced from the parents of F3703 x M1211, 3 mice were from the parents of F3703 x M2881, and 1 mice were produced from the parents of F4462 x M3171. In addition, it was confirmed that the progeny of group 4 (F3591 x M3072, M3893, M3278, M3896) produced 8 mice from the parents of F3591 x M3072 and 7 mice from the parents of F3591 x M3278. The confidence of the Cervus analysis result is determined by the LOD score value, and it can be seen that the reliability is high when the corresponding value represents a positive number (FIG. 4).

Example 6: Establishment of multiplex PCR conditions

In order to establish conditions for simultaneously analyzing 9 microsatellite markers in a single PCR reaction, the present inventors performed analysis by varying the primer content, PCR reaction time and temperature conditions. TaKaRa Ex Taq DNA Pholymerase (TAKARA Bio. inc., Japan) was used for the analysis. As a result of the analysis, based on the total volume of 20 μl of the PCR mixture, 0.4 μl of the primer set for the ANJAP-30 marker was used and 0.1 μl of the other primer sets were used. It was confirmed that it was done well (see Tables 6 and 7). The multiplex PCR composition information is summarized in Table 6 below, and the reaction conditions are summarized in Table 7.

Compositions for multiplex PCR template 2 μl FAM(3) HEX(3) TAMRA(3) Primer (F) 0.1 (0.4) μl 0.1 μl 0.1 μl Primer (R) 0.1 (0.4) μl 0.1 μl 0.1 μl 10x buffer 2 μl dNTP 1.6 μl ExTaq 0.1 μl D.W. 11.9 μl Sum 20 μl

Reaction conditions for multiplex PCR Temperature (℃) time (min) number of iterations (cycles) 95 10 One 95 One
5 59 One 72 One 95 One
5 58 One 72 One 95 One
32 57 One 72 One 65 30 One

Although the present invention has been described with reference to the above-described embodiments, these are merely exemplary, and those skilled in the art will understand that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> Genetic markers for identify individual of Anguilla japonica and method using the same <130> PD22-6176 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-30 F <400> 1 ccagtttcgt gccttgtact tt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-30 R <400> 2 accagcctgt gttaaaggct ta 22 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-50 F <400> 3 acagaggaac atgtaaatgt atcca 25 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-50 R <400> 4 cggataatgt ctagccctgc tt 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-51F <400> 5 gccatggcaa ttcagagcat aa 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-51R <400> 6 acggtcatta aggttagagg gt 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-03F <400> 7 ggggaaagaa tctgtgtccc at 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-03R <400> 8 aaggaaagca ccagcaaaca tc 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-47F <400> 9 ggtagcgggt attccaaaat gc 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-47R <400> 10 ccgtctagag cgcttttatg ga 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-56F <400> 11 cagccttaac ggtcctatca gt 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-56R <400> 12 tctgattcat tacccagggc ac 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-69F <400> 13 cgcagtgtaa gctggtgata ga 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-69R <400> 14 tcattctgat gcccgaaggt ta 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-78F <400> 15 caccacacga tgcaatcaac tt 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-78R <400> 16 ggacaatggg gtacaaaaac cg 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-89F <400> 17 agaaagcctt acctgcatgt ga 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ANJAP-89R <400> 18 cgctgcttga agtgctgata aa 22 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Cyt-H <400> 19 aaactgcagc ccctgctcag aatgatattt gtcctca 37 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Cyt-L <400> 20 cgaagcttga tatgaaaaac catcgtt 27

Claims (5)

i-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 1 and a reverse primer set forth in SEQ ID NO: 2;
i-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 7 and a reverse primer set forth in SEQ ID NO: 8, and
i-3) a first primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 13 and a reverse primer set forth in SEQ ID NO: 14;
ii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 3 and a reverse primer set forth in SEQ ID NO: 4;
ii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 9 and a reverse primer set forth in SEQ ID NO: 10, and
ii-3) a second primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 15 and a reverse primer set forth in SEQ ID NO: 16; and
iii-1) a first primer pair comprising a forward primer set forth in SEQ ID NO: 5 and a reverse primer set forth in SEQ ID NO: 6;
iii-2) a second primer pair comprising a forward primer set forth in SEQ ID NO: 11 and a reverse primer set forth in SEQ ID NO: 12, and
iii-3) a third primer set including a third primer pair including a forward primer set forth in SEQ ID NO: 17 and a reverse primer set forth in SEQ ID NO: 18, wherein the first primer set is a first fluorescent material a label, the second set of primers is labeled with a second fluorescent material, the third set of primers is labeled with a third fluorescent material, and the first to third fluorescent materials emit light of different wavelengths, respectively. A kit for identification of eels from the Far East. According to claim 1,
The first to third fluorescent materials are each selected from the group consisting of FAM, HEX, and TAMARA, the kit. According to claim 1,
Each of the primer pairs is characterized in that it is included in a final concentration of 0.1 to 0.5 μM, the kit. An extraction step of extracting a DNA sample of an eel from the Far East;
an amplification step of amplifying the DNA sample with the kit of claim 1; and
Including the step of analyzing the band pattern of the amplification product of the amplification step, an individual identification method of an eel from the Far East. 5. The method of claim 4,
The amplification step is performed by multiplex PCR, the method.

Images