CN114921562A - SSR multiple PCR primer for Oxytropis myriophylla and application thereof - Google Patents
SSR multiple PCR primer for Oxytropis myriophylla and application thereof Download PDFInfo
- Publication number
- CN114921562A CN114921562A CN202210448605.1A CN202210448605A CN114921562A CN 114921562 A CN114921562 A CN 114921562A CN 202210448605 A CN202210448605 A CN 202210448605A CN 114921562 A CN114921562 A CN 114921562A
- Authority
- CN
- China
- Prior art keywords
- primer
- primers
- pairs
- multiplex pcr
- ssr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Abstract
The invention discloses SSR multiple PCR primers for acanthocephalus molpadus, which comprise 9 pairs of specific primers, namely primer pairs of Clu982, Clu1605, Clu740, Clu493, Clu1563, Clu873, Clu1288, Clu1020 and Clu370, wherein each pair of primers comprises a forward primer and a reverse primer, and the base sequences of the 9 pairs of specific primers are shown as SEQ ID NO: 1 to 18. Also discloses a kit comprising the primers and a method for fluorescence multiplex PCR of the microsatellite of the echinacea purpurea. And the application of the primer, the kit and the method in evaluating the genetic diversity of the echinacea purpurea.
Description
Technical Field
The invention belongs to the technical field of microsatellite markers, and particularly relates to an SSR multiple PCR primer for a young echinocandis and application thereof.
Background
The echinoderm piscicus (Collichthys lucidus) belongs to Perciformes (Perciformes), the family of chuteidae (Sciaendae) and the genus of mermaid (Collichthys) and is distributed in the western pacific region including coastal waters such as philippines, vietnam, china, korea and japan, is one of the main economic fishes in the countries, is mainly distributed in the yellow sea and the east sea in China, and has the maximum yield in the east sea. According to the fixed-point survey in 1986, the catch amount of the Cereus spinosus in the Yangtze river mouth accounts for 24% of the catch composition in the fixed-position operation, and the catch species accounts for 26% of the catch composition in the bottom trawl fishery (Hebao Quanli-Chili, 1988). From the 70 s of the world, marine fishery resources in China are over-harvested, which is reflected in the reduction of group nutrition level and the miniaturization and the aging of individuals. Analysis of the data from the tragus ostii monitoring of 2018-2019 revealed that the age of the initial sexual maturity of the spiny greenfish was shortened from 112mm in length in 1986-1987 to 88mm in size 2018-2019, characterizing an overcast (rill et al, 2022; pandelly et al, 2021). The acanthocephalus spinosus has the characteristics of tender meat, delicious meat taste and high economic value, and has been artificially domesticated as an aquiculture object in recent years. Interference of human activities with the acanthocephalus spinosus population has prompted a long-term monitoring need for its genetic diversity. The currently commonly used molecular markers include Single Nucleotide Polymorphisms (SNPs) and microsatellite markers (SSRs), for example, 169624 SNP markers were developed by Zhao linin et al (Zhao et al, 2017), and 19 SSR markers were developed by Ma Chunyan et al (Ma et al, 2011). The long-term monitoring tool needs to have the requirements of stability and low cost, and the multiplex PCR-SSR marker is the most suitable technology at present, but needs to be further screened on the basis of the obtained SSR marker.
The invention aims to develop a multiplex PCR-SSR marker with 3-6 basic groups of motifs on the basis of screening simple repeated sequences of a whole genome.
Disclosure of Invention
The invention aims to provide SSR multiple PCR primers for the Oxytropis myriophylla and a kit comprising the primers, wherein the primers are high in polymorphism, stable in amplification and reliable in result.
The invention also aims to provide a microsatellite fluorescent multiplex PCR method for the sea buckthorn juvenile fish.
The last purpose of the invention is to provide the application of the primer, the kit and the method in the aspect of evaluating the genetic diversity of the echinocandis.
The first object of the present invention can be achieved by the following technical solutions: an SSR multiplex PCR primer for medullus echinocandis, which comprises 9 pairs of specific primers, namely primer pairs Clu982, Clu1605, Clu740, Clu493, Clu1563, Clu873, Clu1288, Clu1020 and Clu370, wherein each pair of primers comprises a forward primer and a reverse primer, and the base sequences of the 9 pairs of specific primers are shown as SEQ ID NO: 1 to 18.
Further, the kit also comprises two fluorescence labeling universal primers M13 and PQE-F, wherein the fluorescence label matched with the universal primer M13 is 5-FAM, and the fluorescence label matched with the universal primer PQE-F is 5-HEX, wherein the base sequences of the universal primers M13 and PQE-F are respectively shown in SEQ ID NO: 19 to 20.
The invention also provides a kit for the SSR multiple PCR of the Oxytropis myriophylla, which comprises the 9 pairs of specific primers.
The invention further provides a kit for the SSR multiple PCR of the spinosad, which comprises the 9 pairs of specific primers and the fluorescence labeling universal primer.
The second objective of the present invention can be achieved by the following technical solutions: a microsatellite fluorescent multiplex PCR method for the Oxytropis myriophylla comprises the following steps:
(1) extracting DNA of the sea buckthorn juvenile fish: collecting fin ray tissues of a myriophyllum echinocandis sample, and extracting genome DNA;
(2) synthesizing a specific primer: synthesizing the 9 pairs of specific primers, and dividing the 9 pairs of specific primers into two groups, namely a G1 group and a G2 group, wherein the G1 group comprises primer pairs Clu982, Clu1605, Clu740 and Clu493, and the G2 group comprises primer pairs Clu1563, Clu873, Clu1288, Clu1020 and Clu 370;
(3) multiplex PCR amplification: carrying out PCR amplification on the genome DNA in the step (1) by using the two groups of specific primers in the step (2) and the fluorescence labeling universal primer to obtain an amplification product;
(4) evaluation of genetic diversity: and (3) carrying out genotyping on the amplified products by adopting a capillary electrophoresis method, counting alleles of each site and an individual, and comparing genetic diversity according to indexes such as heterozygosity and the like.
In the above method for fluorescence multiplex PCR of the microsatellite of the Mylopharyngodon cibotius, the method comprises the following steps:
preferably, the reaction systems of groups G1 and G2 during PCR amplification in step (3) are as follows:
the G1 group of multiplex PCR amplification reaction system is:
| PCR system reactant | Content (μ L) |
| Clu982.F(20μM) | 0.06 |
| Clu982.R(20μM) | 0.24 |
| Clu1605.F(10μM) | 0.06 |
| Clu1605.R(10μM) | 0.24 |
| Clu740.F(20μM) | 0.06 |
| Clu740.R(20μM) | 0.24 |
| Clu493.F(5μM) | 0.06 |
| Clu493.R(5μM) | 0.24 |
| M13(10μM) | 0.36 |
| PQE-F(10μM) | 0.36 |
| BSA(2mg/mL) | 0.45 |
| DNA(50ng/μL) | 2.0 |
| Taq HS(Takara) | 12.5 |
| ddH2O | 10.13 |
| Total | 25.0 |
The G2 multiplex PCR amplification reaction system was:
| PCR system reactant | Content (μ L) |
| Clu1563.F(20μM) | 0.06 |
| Clu1563.R(20μM) | 0.24 |
| Clu873.F(5μM) | 0.06 |
| Clu873.R(5μM) | 0.24 |
| Clu1288.F(10μM) | 0.06 |
| Clu1288.R(10μM) | 0.24 |
| Clu1020.F(20μM) | 0.06 |
| Clu1020.R(20μM) | 0.24 |
| Clu370.F(10μM) | 0.06 |
| Clu370.R(10μM) | 0.24 |
| M13(10μM) | 0.36 |
| PQE-F(10μM) | 0.36 |
| BSA(2mg/mL) | 0.45 |
| DNA(50ng/μL) | 2.0 |
| Taq HS(Takara) | 12.5 |
| ddH2O | 9.83 |
| Total | 25.0 |
The specific primer pair and the fluorescence labeling universal primer for amplifying the G1 group microsatellite loci are as follows:
the specific primer pair and the fluorescence labeling universal primer for amplifying the G2 group microsatellite loci are as follows:
the primer combination in the application is obtained by optimizing the primer interaction on the basis of analyzing the polymorphism of the whole genome microsatellite marker, and the system configuration process comprises the following steps: firstly, preparing a primer crude stock solution according to requirements, and then preparing a primer crude stock solution according to the following steps of 1: 4 mixing the forward primer and the reverse primer, mixing the primer pair mixed solution in equal amount, and finally configuring an amplification system according to the number of the detected samples. The configuration process avoids errors caused by single addition of the primers, improves the experimental stability, and is suitable for batch amplification.
Preferably, in the PCR amplification in step (3), the amplification procedure adopted is as follows: 10s at 98 ℃, 40s at 57 ℃, 60s at 72 ℃ and 35 cycles; 10s at 98 ℃, 40s at 53 ℃, 60s at 72 ℃ and 15 cycles; finally, extension is carried out for 30min at 72 ℃.
Preferably, in step (4), the amplification product is genotyped by capillary electrophoresis on an ABI3730XL gene analyzer.
The other purpose of the invention can be realized by the following technical scheme: the SSR multiple PCR primer, the kit and the method are applied to the evaluation of the genetic diversity of the echinocandis.
Compared with the prior art, the invention has the following advantages:
(1) the invention utilizes the combination of microsatellite markers, multiple PCR and a general amplification primer technology to screen 9 high-polymorphism microsatellite loci and classify the acanthocephalus spinosus;
(2) the invention can combine the primer group G1 and the primer group G2 at one time, detect 9 sites at the same time, and can detect 1-9 sites by adjusting the number of the primer group G1 and the primer group G2 in practical application, and the universal primer can be reused, so that the efficiency is improved and the cost is reduced compared with simple single-site detection;
(3) the microsatellite loci contained in the invention are 3-6 bases, so that the size of the allele is more accurately judged, and the accuracy of genotype data is improved;
(4) according to the method for fluorescence multiplex PCR of the microsatellite of the echinacea parva, the reliable and effective microsatellite primer combination is selected, the method for typing the echinacea parva colony by utilizing the multiplex PCR technology is provided, and the developed primer and the kit can be used for the aspects of colony genetics research, germplasm resource evaluation, pedigree identification, proliferation and releasing effect evaluation and the like.
Drawings
FIG. 1 is a capillary electrophoresis chart in example 2, wherein 1 corresponds to a site Clu 982;
FIG. 2 is a diagram of capillary electrophoresis in example 2, wherein 2 corresponds to the Clu1605 site;
FIG. 3 is a diagram of capillary electrophoresis in example 2, wherein 3 corresponds to the position Clu 740;
FIG. 4 is a capillary electrophoresis chart in example 2, and 4 corresponds to the locus Clu 493;
FIG. 5 is a diagram of capillary electrophoresis in example 2, wherein 5 corresponds to the position Clu 1563;
FIG. 6 is a capillary electrophoresis chart in example 2, wherein 6 corresponds to the Clu873 site;
FIG. 7 is a diagram of capillary electrophoresis in example 2, wherein 7 corresponds to the Clu1288 locus;
FIG. 8 is a diagram of capillary electrophoresis in example 2, wherein 8 corresponds to the position Clu 1020;
FIG. 9 is a capillary electrophoresis chart in example 2, wherein 9 corresponds to the position Clu 370;
FIG. 10 is a gel electrophoresis image of the band of item 9 in example 3, at positions Clu982, Clu740, Clu1605, Clu493, Clu1563, Clu1020, Clu873, Clu1288 and Clu370 from left to right.
Detailed Description
The following examples are included to further illustrate certain embodiments of the invention.
Example 1
The SSR multiplex PCR primers for syphilis echinocandis provided in this example include 9 pairs of specific primers, which are primer pairs Clu982, Clu1605, Clu740, Clu493, Clu1563, Clu873, Clu1288, Clu1020, and Clu370, respectively, wherein each pair of primers includes a forward primer and a reverse primer, and the base sequences of the 9 pairs of specific primers are shown in SEQ ID NO: 1-18, and the sequences of the primers are shown in the following table 1:
TABLE 19 base sequences of the pairs of specific primers
| Primer and method for producing the same | Forward primer F | Reverse primer R |
| Clu982 | tgtaaaacgacggccagtggaaaggaaattgtgtgtatgc | tcatctacattgttgtcatcaacatc |
| Clu1605 | tgtaaaacgacggccagtgtcacgtgtctccatcaggtta | ccaccgaaatctggttgagtaat |
| Clu740 | tgtaaaacgacggccagtgagcagtgcaggaggagttatc | gagcacaaatgtccatgattgt |
| Clu493 | ttgagaggatcgcatccagtgtagggccaggttgtattgt | tgatccaaatggccataattc |
| Clu1563 | tgtaaaacgacggccagtatgaagcaggattgaatttcgt | acagtgctgatcactcctttca |
| Clu873 | ttgagaggatcgcatccactactgagagctggccgttatt | gtgctgcacttcaattcttctg |
| Clu1288 | tgtaaaacgacggccagtcacatgtgtcacctccaacac | aaatttgtctccatttcgtgct |
| Clu1020 | tgtaaaacgacggccagttcattcctttactgctaaggctg | tcactgtctccacagcaatctc |
| Clu370 | ttgagaggatcgcatccaatgtgagtgagtcagcaggtct | ccaccattcctctcattctctt(18) |
。
The primer can further comprise 2 fluorescence labeling universal primers M13 and PQE-F, wherein the base sequences of the universal primers M13 and PQE-F are respectively shown in SEQ ID NO: 19-20, the fluorescent labels matched with the fluorescent probe are respectively 5-FAM and 5-HEX, and the specific sequences are shown in the following table 2.
Table 22 Universal primers and fluorescent labels conjugated to the Universal primers
| Serial number | Primer pair | Primer sequences | |
| 1 | M13 | tgtaaaacgacggccagt | 5- |
| 2 | PQE-F | ttgagaggatcgcatcca | 5-HEX |
The 9 pairs of primers, the 9 pairs of primers and the fluorescence labeling universal primers can also be prepared into a kit for the SSR multiplex PCR of the echinocandis.
Example 2
The microsatellite multiplex PCR method for the echinocandis japonicus provided by the embodiment comprises the steps of firstly screening and designing two groups of microsatellite amplification primer combinations according to microsatellite loci, wherein the microsatellite amplification primer combinations comprise 9 pairs of specific primers, then dividing the microsatellite amplification primer combinations into two groups, adding the specific primer pairs and the fluorescence-labeled universal primers of the respective groups into different reaction tubes of the different groups, amplifying a plurality of target fragments through PCR, separating a plurality of amplification products of the different primers through electrophoresis, and finally counting separation bands.
Specifically, the method for performing microsatellite multiplex PCR on the Mylopharyngodon piceus provided by the embodiment comprises the following steps:
(1) extracting DNA of the echinocandis japonicus: collecting fin ray tissues of parent spiny head mermaid to be evaluated, and extracting genome DNA;
(2) screening out two groups of multiple SSR-PCR primers;
according to the genome reference sequence of the echinocandis juvenile fish, the distribution and classification characteristics of the microsatellite are counted, two groups of multiple SSR-PCR combinations are screened by analyzing population re-sequencing data, typing is carried out on the microsatellite, the microsatellites with high polymorphism level and 3-6 base repeating units are screened, the amplification specificity of the primers and the compatibility between the primer combinations are evaluated, and the two groups of multiple SSR-PCR combinations are screened and are represented by G1 and G2, wherein the G1 group comprises primer pairs of Clu982, Clu1605, Clu740 and Clu493, and the G2 group comprises primer pairs of Clu1563, Clu873, Clu1288, Clu1020 and Clu370, which respectively comprise 4 and 5 microsatellite loci, as shown in the following tables 3 and 4, the microsatellite sequences are marked by fluorescent universal primers, and are automatically typed by utilizing a capillary electrophoresis instrument, and the universal primers are shown in the following table 5.
TABLE 5 Universal primers
| Primer pair | Primer sequences |
| M13 | tgtaaaacgacggccagt |
| PQE-F | ttgagaggatcgcatcca |
(3) The above primers were synthesized at commercial companies;
(4) and (3) PCR amplification: the amplification program comprises 35 cycles of 98 ℃ for 10s, 57 ℃ for 40s, and 72 ℃ for 60 s; 10s at 98 ℃, 40s at 53 ℃, 60s at 72 ℃ and 15 cycles; finally, extension is carried out for 30min at 72 ℃. The amplification systems are shown in the following tables 6-7:
| PCR system reactant | Content (μ L) |
| Clu1563.F(20μM) | 0.06 |
| Clu1563.R(20μM) | 0.24 |
| Clu873.F(10μM) | 0.06 |
| Clu873.R(10μM) | 0.24 |
| Clu1288.F(5μM) | 0.06 |
| Clu1288.R(5μM) | 0.24 |
| Clu1020.F(20μM) | 0.06 |
| Clu1020.R(20μM) | 0.24 |
| Clu370.F(10μM) | 0.06 |
| Clu370.R(10μM) | 0.24 |
| M13(10μM) | 0.36 |
| PQE-F(10μM) | 0.36 |
| BSA(2mg/mL) | 0.45 |
| DNA(50ng/μL) | 2.0 |
| Taq HS(Takara) | 12.5 |
| ddH 2 O | 9.83 |
| Total | 25.0 |
(5) The amplified samples were sent to a commercial company for genotyping using ABI3730 XL;
(6) and (3) genotype detection: the multiplex PCR products were typed on an automatic sequencer (ABI 3730XL) to read individual genotypes.
Capillary electrophoresis FIGS. 1 to 9 correspond to the positions Clu982, Clu1605, Clu740, Clu493, Clu1563, Clu873, Clu1288, Clu1020, and Clu370, respectively, one to one. As shown in table 8 below:
| |
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 |
| Site of the heart | Clu982 | Clu1605 | Clu740 | Clu493 | Clu1563 | Clu873 | Clu1288 | Clu1020 | Clu370 |
It can be seen from the peak diagrams of FIGS. 1-9 that the peak patterns are regular and stable, and the allele lengths strictly conform to the repeat motif characteristics, indicating that the developed multiplex PCR-SSR can be stably used.
Example 3
The application of the SSR fluorescence labeled primer in the evaluation of the genetic diversity of the Scopus echinatus is described by specific examples below.
(1) Extraction of DNA of sea buckthorn juvenile fish
30 individual fin rays of the echinocandis japonicus are cut and immediately stored in 95% ethanol, and genome total DNA is extracted by using a marine animal tissue genome DNA extraction kit, wherein the specific steps refer to kit use instructions. And after the DNA extraction is finished, detecting the concentration by using an ultraviolet spectrophotometer.
(2) Synthesis of primers
Primers were synthesized according to the sequences and fluorescent labeling requirements in tables 1 and 2.
(3) Multiplex PCR amplification
Each individual was subjected to PCR amplification according to the systems shown in tables 6 and 7.
Setting a PCR reaction program: 10s at 98 ℃, 30s at 59 ℃, 60s at 72 ℃ and 30 cycles; 10s at 98 ℃, 30s at 53 ℃, 60s at 72 ℃ and 15 cycles; finally, extension is carried out for 30min at 72 ℃.
After the PCR is finished, 5 mu L of agarose gel electrophoresis is taken to detect a dispersion band with expected size, and the rest is sent to a commercial company for genotyping by adopting ABI3730 XL;
the gel electrophoresis image is shown in FIG. 10, wherein the bands of the 9 items in the image respectively correspond to the positions of Clu982, Clu740, Clu1605, Clu493, Clu1563, Clu1020, Clu873, Clu1288 and Clu370 from left to right.
Firstly, the band with the confirmed size is confirmed and amplified through gel electrophoresis, then the typing of each site is detected through capillary electrophoresis, and the typing stability can be used for detecting the population.
(4) Conversion of the peak patterns to alleles was performed using the software GeneMarker V2.2.2.0, Table 9 is a population genetics parameter.
TABLE 9 genetic parameters of 9 microsatellite loci of Oxytropis spinosa juvenile fish
| Locus | N | Na | Ne | I | Ho | He | uHe | F |
| Clu982 | 30 | 7.000 | 4.945 | 1.706 | 0.300 | 0.798 | 0.811 | 0.624 |
| Clu1605 | 30 | 9.000 | 5.882 | 1.927 | 0.433 | 0.830 | 0.844 | 0.478 |
| Clu740 | 30 | 8.000 | 5.521 | 1.835 | 0.533 | 0.819 | 0.833 | 0.349 |
| Clu493 | 30 | 8.000 | 3.377 | 1.547 | 0.400 | 0.704 | 0.716 | 0.432 |
| Clu1563 | 30 | 9.000 | 5.389 | 1.839 | 0.633 | 0.814 | 0.828 | 0.222 |
| Clu873 | 30 | 3.000 | 2.723 | 1.042 | 0.333 | 0.633 | 0.644 | 0.473 |
| Clu1288 | 30 | 6.000 | 1.991 | 1.026 | 0.433 | 0.498 | 0.506 | 0.129 |
| Clu1020 | 30 | 17.000 | 12.000 | 2.622 | 0.833 | 0.917 | 0.932 | 0.091 |
| Clu370 | 30 | 9.000 | 5.233 | 1.880 | 0.200 | 0.809 | 0.823 | 0.091 |
| Mean | 30 | 8.500 | 4.845 | 1.601 | 0.467 | 0.714 | 0.726 | 0.319 |
Note: locus: site, N: number of individuals, Na: allelic factor, Ne: effective allelic factor, I: shannon information index, Ho: observing the heterozygosity; he, desired heterozygosity; f: and (4) fixing the index.
The results show that the multiple PCR method formed by the microsatellite 9 pairs of primers is stable and accurate in grouping of the juvenile fish of the acanthocephalus spinosus, and meets the requirements of germplasm identification, family management and proliferation and releasing effect evaluation of the juvenile fish of the acanthocephalus spinosus.
The invention is not limited to the specific embodiments described above, which are intended to illustrate the use of the invention in detail, and functionally equivalent production methods and technical details are part of the disclosure. In fact, a person skilled in the art, on the basis of the preceding description, will be able to find different modifications according to his own needs, which modifications are intended to be within the scope of the claims appended hereto.
Sequence listing
<110> southern ocean science and engineering Guangdong province laboratory (Guangzhou)
SOUTH CHINA SEA FISHERIES Research Institute CHINESE ACADEMY OF FISHERY SCIENCES
<120> SSR multiplex PCR primer for Oxytropis myriophylla and application thereof
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgtaaaacga cggccagtgg aaaggaaatt gtgtgtatgc 40
<210> 2
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tcatctacat tgttgtcatc aacatc 26
<210> 3
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgtaaaacga cggccagtgt cacgtgtctc catcaggtta 40
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccaccgaaat ctggttgagt aat 23
<210> 5
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgtaaaacga cggccagtga gcagtgcagg aggagttatc 40
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gagcacaaat gtccatgatt gt 22
<210> 7
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttgagaggat cgcatccagt gtagggccag gttgtattgt 40
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgatccaaat ggccataatt c 21
<210> 9
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tgtaaaacga cggccagtat gaagcaggat tgaatttcgt 40
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
acagtgctga tcactccttt ca 22
<210> 11
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttgagaggat cgcatccact actgagagct ggccgttatt 40
<210> 12
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gtgctgcact tcaattcttc tg 22
<210> 13
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tgtaaaacga cggccagtca catgtgtcac ctccaacac 39
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aaatttgtct ccatttcgtg ct 22
<210> 15
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tgtaaaacga cggccagttc attcctttac tgctaaggct g 41
<210> 16
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tcactgtctc cacagcaatc tc 22
<210> 17
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ttgagaggat cgcatccaat gtgagtgagt cagcaggtct 40
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
ccaccattcc tctcattctc tt 22
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
tgtaaaacga cggccagt 18
<210> 20
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
ttgagaggat cgcatcca 18
Claims (8)
1. An SSR multiplex PCR primer for the medlars, which comprises 9 pairs of specific primers, namely primer pairs of Clu982, Clu1605, Clu740, Clu493, Clu1563, Clu873, Clu1288, Clu1020 and Clu370, wherein each pair of primers comprises a forward primer and a reverse primer, and the base sequences of the 9 pairs of specific primers are respectively shown as SEQ ID NO: 1 to 18.
2. The SSR multiplex PCR primer for the Oxytropis myriophylla according to claim 1, which is characterized in that: the kit also comprises two fluorescence labeling universal primers M13 and PQE-F, wherein the fluorescence label matched with the universal primer M13 is 5-FAM, the fluorescence label matched with the universal primer PQE-F is 5-HEX, and the base sequences of the universal primers M13 and PQE-F are respectively shown in SEQ ID NO: 19-20.
3. A kit for SSR multiplex PCR of the Oxytropis myriophylla is characterized in that: comprising the 9 pairs of specific primers of claim 1.
4. A kit for SSR multiplex PCR of the Oxytropis myriophylla is characterized in that: comprising the pair of specific primers of claim 1 and the two fluorescently labeled universal primers M13 and PQE-F of claim 2.
5. A microsatellite fluorescent multiplex PCR method for the Oxytropis myriophylla is characterized by comprising the following steps:
(1) extracting DNA of the echinocandis japonicus: collecting fin tissue of a syphilis echinocandis sample, and extracting genome DNA;
(2) synthesizing a specific primer: synthesizing the 9 pairs of specific primers, and dividing the 9 pairs of specific primers into two groups, namely a G1 group and a G2 group, wherein the G1 group comprises primer pairs of Clu982, Clu1605, Clu740 and Clu493, and the G2 group comprises primer pairs of Clu1563, Clu873, Clu1288, Clu1020 and Clu 370;
(3) multiplex PCR amplification: carrying out PCR amplification on the genome DNA in the step (1) by using the two groups of specific primers in the step (2) and the fluorescence labeling universal primer to obtain an amplification product;
(4) evaluation of genetic diversity: and (3) carrying out genotyping on the amplified products by adopting a capillary electrophoresis method, counting alleles of each site and an individual, and comparing genetic diversity according to heterozygosity indexes.
6. The method of the acanthogobius multifida microsatellite fluorescent multiplex PCR as claimed in claim 5, wherein: during PCR amplification in the step (3), the reaction systems of the group G1 and the group G2 are respectively as follows:
the G1 group of multiplex PCR amplification reaction system is:
the G2 group of multiplex PCR amplification reaction system is:
。
7. The method of the acanthogobius multifida microsatellite fluorescent multiplex PCR as claimed in claim 5, wherein: when PCR amplification is carried out in the step (3), the adopted amplification procedure is as follows: 10s at 98 ℃, 40s at 57 ℃, 60s at 72 ℃ and 35 cycles; 10s at 98 ℃, 40s at 53 ℃, 60s at 72 ℃ and 15 cycles; finally, extension is carried out for 30min at 72 ℃.
8. Use of the SSR multiplex PCR primers of claim 1 or 2, the kit of claim 3 or 4, and the method of any one of claims 5 to 7 for assessing the genetic diversity of echinocandis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210448605.1A CN114921562A (en) | 2022-04-27 | 2022-04-27 | SSR multiple PCR primer for Oxytropis myriophylla and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210448605.1A CN114921562A (en) | 2022-04-27 | 2022-04-27 | SSR multiple PCR primer for Oxytropis myriophylla and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114921562A true CN114921562A (en) | 2022-08-19 |
Family
ID=82807343
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210448605.1A Pending CN114921562A (en) | 2022-04-27 | 2022-04-27 | SSR multiple PCR primer for Oxytropis myriophylla and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114921562A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115725749A (en) * | 2022-11-17 | 2023-03-03 | 广州艾基生物技术有限公司 | Mouse source cell STR detection kit, method and application |
| CN116042788A (en) * | 2022-11-22 | 2023-05-02 | 湖南师范大学 | Method and application of microsatellite fluorescence multiplex PCR (polymerase chain reaction) of cheilinus |
| CN116042788B (en) * | 2022-11-22 | 2024-04-19 | 湖南师范大学 | Method and application of microsatellite fluorescence multiplex PCR (polymerase chain reaction) of cheilinus |
-
2022
- 2022-04-27 CN CN202210448605.1A patent/CN114921562A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115725749A (en) * | 2022-11-17 | 2023-03-03 | 广州艾基生物技术有限公司 | Mouse source cell STR detection kit, method and application |
| CN116042788A (en) * | 2022-11-22 | 2023-05-02 | 湖南师范大学 | Method and application of microsatellite fluorescence multiplex PCR (polymerase chain reaction) of cheilinus |
| CN116042788B (en) * | 2022-11-22 | 2024-04-19 | 湖南师范大学 | Method and application of microsatellite fluorescence multiplex PCR (polymerase chain reaction) of cheilinus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108998547B (en) | Microsatellite marking method for paternity test of cupfish | |
| KR102062452B1 (en) | Genetic maker for parentage and thereod in Turbot | |
| KR102077917B1 (en) | Genetic maker for parentage and thereof in Olive flounder | |
| CN109055571B (en) | Specific primer of yellow fin spine porgy microsatellite marker and application | |
| CN109182556B (en) | SNP molecular marker related to growth traits of pelteobagrus vachelli and application | |
| CN110343767B (en) | Specific primer of microsatellite molecular marker of litopenaeus vannamei and application of specific primer in genetic diversity analysis | |
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| KR102206211B1 (en) | Genetic marker for parentage and thereof in Limanda yokohamae | |
| Hao et al. | A study of taxonomical relationships among species of Korean Allium sect. Sacculiferum (Alliaceae) and related species using inter-simple sequence repeat (ISSR) markers | |
| CN114921562A (en) | SSR multiple PCR primer for Oxytropis myriophylla and application thereof | |
| KR20180077873A (en) | SNP markers for selection of marker-assisted backcross in watermelon | |
| Ming et al. | Genetic diversity of main inbred Indica rice varieties applied in Guangdong Province as revealed by molecular marker | |
| KR101649589B1 (en) | SSR primer derived from apple and use thereof | |
| CN107022616B (en) | Quinoa binary InDel molecular marker and development method and application thereof | |
| KR101359542B1 (en) | Microsatellite primer sets for discriminating cultivars of peach and uses thereof | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| CN111440877B (en) | SSR multiple PCR primer for Swallow piniperis and application thereof | |
| KR102276917B1 (en) | EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same | |
| KR101427103B1 (en) | Specific SSR primers for discriminating waxy corn cultivar 'Arichal', and uses thereof | |
| KR102527604B1 (en) | Genetic marker for parentage and thereof in Tribolodon hakonensis. | |
| CN113151492B (en) | SNP molecular marker related to trachinotus ovatus hypoxia-resistant character and application thereof | |
| KR102540651B1 (en) | SSR Marker Composition for Identification of Blade type of Pyropia yezoensis and Application thereof | |
| CN116219031A (en) | SSR fluorescent marker primer for multiple PCR of oplegnathus fasciatus and application thereof | |
| KR20130010172A (en) | A method for identifying lettuce varieties using microsatellite primer set | |
| KR20100128118A (en) | Probe and dna chip for identifying freshwater fish species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |