CN116904516A

CN116904516A - Application of PTBP1 inhibitor in preparation of medicine for treating glioblastoma

Info

Publication number: CN116904516A
Application number: CN202210056341.5A
Authority: CN
Inventors: 杨建静; 诸葛启钏; 王堪凯; 赵佩琦
Original assignee: First Affiliated Hospital of Wenzhou Medical University
Current assignee: First Affiliated Hospital of Wenzhou Medical University
Priority date: 2022-01-18
Filing date: 2022-01-18
Publication date: 2023-10-20

Abstract

The application discloses application of a PTBP1 inhibitor in preparation of medicines for treating glioblastoma, and belongs to the field of gene therapy, wherein the PTBP1 inhibitor can knock out a PTBP1 gene or knock down the expression level of the PTBP1 gene. The PTBP1 inhibitor can be used for knocking down PTBP1 to reprogram glioblastoma cells into neuron-like cells, so that proliferation of the glioblastoma cells can be obviously inhibited, and the glioblastoma can be treated, and has important clinical value.

Description

Application of PTBP1 inhibitor in preparation of medicine for treating glioblastoma

Technical Field

The application belongs to the field of gene therapy, and particularly relates to application of a PTBP1 inhibitor in preparation of a medicament for treating glioblastoma.

Background

According to a new classification by the 2021 world health organization (World Health Organization, WHO), adult diffuse gliomas are classified into three types based on mutations of isocitrate dehydrogenase (isocitrate dehydrogenase, IDH) and deletions of 1p19q, namely: astrocytoma, IDH mutant; oligodendrogliomas, IDH mutations and 1p19q co-deletions; glioblastoma, IDH wild type. Wherein glioblastoma accounts for more than 70%, and the incidence rate is 3.23/100000 people.

At present, the most reasonable treatment scheme for glioblastoma comprises surgical excision, radiotherapy and chemotherapy. However, the median survival in glioblastoma patients is only less than 2 years. Although several therapeutic regimens for glioblastoma are advancing simultaneously, the status of the disease remains unchanged.

Recently, a technique of reprogramming cells by changing some genes or transcription factors determining the differentiation direction of the cells to achieve efficient transformation between the cells has attracted attention from neuroscientists. There is no current research and practice to apply cell reprogramming techniques to glioblastomas.

Disclosure of Invention

The present application aims to provide a method for inhibiting proliferation of glioblastoma by using a cell reprogramming technology, thereby achieving the purpose of treating glioblastoma, and in order to achieve the purpose, the inventors unexpectedly found that: knocking down PTBP1 can reprogram U87 glioblastoma cells into neuron-like cells, and can remarkably inhibit proliferation of the glioblastoma cells; in vivo experiments, the abnormal organism derived from the U87 glioblastoma cell with the knockdown PTBP1 also shows obvious growth reduction, which provides a potential and feasible new treatment thought for the treatment of glioblastoma, thereby completing the application.

In a first aspect the present application provides the use of a PTBP1 inhibitor in the preparation of a formulation for reprogramming glioblastoma cells to neurons, wherein said PTBP1 inhibitor is capable of knocking out the PTBP1 gene or knocking down the expression level of the PTBP1 gene.

PTBP1 (polypyrimidine tract binding protein 1) was demonstrated to be able to reprogram a variety of cells as neurons in vitro as an RNA binding protein.

In the present application, the PTBP1 gene may be knocked out or the expression level of the PTBP1 gene may be knocked down by any method of knocking out the gene or knocking down the expression level of the gene. By knockout gene is meant that the sequence of the gene is removed from the genome or only a partial sequence of the gene, such as an expression element, is removed so that the gene is not transcribed at all, or the transcription product of the gene, i.e., mRNA, is directly degraded so that it cannot translate a protein. The expression level of the knockdown gene means that the transcription level of the gene or the translation level of mRNA is lowered so that the transcription level and/or translation level of the final gene is lowered, and naturally, the protein level of gene expression is lowered so that the function of the gene is lowered.

In some embodiments of the application, the PTBP1 inhibitor knocks out the PTBP1 gene at the RNA level or knocks down the expression level of the PTBP1 gene.

In some embodiments of the application, the PTBP1 inhibitor is selected from one of the following:

(1) siRNA targeting PTBP1 gene mRNA;

(2) shRNA targeting PTBP1 gene mRNA;

(3) A vector containing shRNA targeting mRNA of PTBP1 gene;

(4) A virus comprising a vector targeting shRNA of mRNA of PTBP1 gene.

Wherein, siRNA, small interfering RNA, has a free form with two bases at the 3' end, which activates RNA interference and specifically effects mRNA degradation by complementary binding sequences to the target mRNA.

shRNA, i.e., short hairpin RNA, comprising a loop structure, can be processed into siRNA, and target mRNA degradation can also be achieved specifically by complementary binding sequences to target mRNA.

In some embodiments of the application, the PTBP1 inhibitor is an shRNA having a nucleotide sequence as shown in SEQ ID No. 1.

In some embodiments of the application, the virus is a lentivirus.

In some preferred embodiments of the application, the shRNA-containing lentiviruses are prepared as follows: 4. Mu.g of the purified sh-Luci and sh-PTBP1 lentiviral vectors were transformed into HEK-293T cells together with a helper packaging plasmid (pMDL, VSV-G, pREV) and the solution was changed after 14 hours. Cell supernatants of 24 hours, 48 hours were then collected for infection of U87 cells.

In other embodiments of the application, the PTBP1 inhibitor is a CRISPR/Cas9 system capable of knocking out the PTBP1 gene or knocking down the expression of the PTBP1 gene.

In some embodiments of the application, the CRISPR/Cas9 system comprises one of the following combinations:

(1) A combination comprising a specific gRNA and a Cas9 protein; the specific gRNA can specifically bind to the DNA fragment of the PTBP1 gene;

(2) A combination of genes encoding a specific DNA molecule transcribed to give the specific gRNA and a Cas9 protein;

(3) A combination comprising a plasmid having the specific DNA molecule and a plasmid encoding a gene having the Cas9 protein, the plasmid having the specific DNA molecule transcribed to obtain an RNA molecule having the specific gRNA;

(4) Comprises a combination of specific recombinant plasmids expressing the specific DNA molecules and the coding genes of the Cas9 proteins.

In a second aspect, the application provides the use of a PTBP1 inhibitor in the manufacture of a medicament for the treatment of glioblastoma.

Further, the treatment of glioblastoma refers to inhibition of glioblastoma proliferation.

Still further, the medicament is capable of reprogramming glioblastoma cells into neurons to inhibit glioblastoma proliferation.

(1) siRNA targeting PTBP1 gene mRNA;

(2) shRNA targeting PTBP1 gene mRNA;

(3) A vector containing shRNA targeting mRNA of PTBP1 gene;

(4) A virus comprising a vector targeting shRNA of mRNA of PTBP1 gene.

In some embodiments of the application, the virus is a lentivirus.

The beneficial effects of the application are that

Compared with the prior art, the application has the following beneficial effects:

the PTBP1 inhibitor is used for knocking down PTBP1, so that proliferation of glioblastoma cells can be obviously inhibited, glioblastoma can be treated, and the application has important clinical value.

The application uses PTBP1 inhibitor to knock down PTBP1, can reprogram glioblastoma cells into neuron-like cells, thereby improving the prognosis of the neural function of glioblastoma patients.

Drawings

FIG. 1 shows the infection efficiency of U87 cells sh-Luci and sh-PTBP1 lentivirus.

FIG. 2 shows the PTBP1 expression levels after transfection of U87 cells sh-Luci and sh-PTBP1 lentiviruses with sh-PTBP1 and sh-PTBP 1.

Fig. 3 shows a fluorescence plot of U87 glioblastoma cell line reprogrammed to a neuronal-like cell.

Figure 4 shows a statistical plot of the reprogramming of the U87 glioblastoma cell line into neuronal-like cells.

Figure 5 shows a fluorescence plot of significant inhibition of KI67 proliferation index following reprogramming of the U87 glioblastoma cell line.

Figure 6 shows a statistical plot of significant inhibition of KI67 proliferation index following reprogramming of the U87 glioblastoma cell line.

Figure 7 shows a fluorescent plot of significant inhibition of the EdU proliferation index following reprogramming of the U87 glioblastoma cell line.

Figure 8 shows a statistical plot of significant inhibition of the EdU proliferation index following reprogramming of the U87 glioblastoma cell line.

Fig. 9 shows in vivo imaging of significantly slowed growth rate of U87 glioblastoma cell line-derived xenobiotics after PTBP1 knockdown.

Figure 10 shows a statistical plot of the significant reduction in growth rate of the U87 glioblastoma cell line-derived xenobiotics following PTBP1 knockdown.

Detailed Description

Unless otherwise indicated, implied from the context, or common denominator in the art, all parts and percentages in the present application are based on weight and the test and characterization methods used are synchronized with the filing date of the present application. Where applicable, the disclosure of any patent, patent application, or publication referred to in this disclosure is incorporated herein by reference in its entirety, and the equivalent patents to such patents are incorporated herein by reference. If the definition of a particular term disclosed in the prior art is inconsistent with any definition provided in the present application, the definition of the term provided in the present application controls.

The numerical ranges in the present application are approximations, so that it may include the numerical values outside the range unless otherwise indicated. The numerical range includes all values from the lower value to the upper value that increase by 1 unit, provided that there is a spacing of at least 2 units between any lower value and any higher value. . These are merely specific examples of what is intended to be provided, and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure.

The terms "comprises," "comprising," "including," and their derivatives do not exclude the presence of any other component, step or process, and are not related to whether or not such other component, step or process is disclosed in the present application. For the avoidance of any doubt, all use of the terms "comprising", "including" or "having" herein, unless expressly stated otherwise, may include any additional additive, adjuvant or compound. Rather, the term "consisting essentially of … …" excludes any other component, step or process from the scope of any of the terms recited below, as those out of necessity for operability. The term "consisting of … …" does not include any components, steps or processes not specifically described or listed. The term "or" refers to the listed individual members or any combination thereof unless explicitly stated otherwise.

In order to make the technical problems, technical schemes and beneficial effects solved by the application more clear, the application is further described in detail below with reference to the embodiments.

Examples

The following examples are presented herein to demonstrate preferred embodiments of the present application. It will be appreciated by those skilled in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the practice of the application, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the application.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, the disclosure of which is incorporated herein by reference as is commonly understood by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. Such equivalents are intended to be encompassed by the claims.

The molecular biology experiments described in the following examples, which are not specifically described, were performed according to the specific methods listed in the "guidelines for molecular cloning experiments" (fourth edition) (j. Sambrook, m.r. Green, 2017) or according to the kit and product specifications. Other experimental methods, unless otherwise specified, are all conventional. The instruments used in the following examples are laboratory conventional instruments unless otherwise specified; the test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

EXAMPLE 1 acquisition and validation of PTBP1 knockdown lentiviruses

shRNA was designed from the mRNA sequence of PTBP1 gene, designated sh-PTBP1, and the sequence was as follows (SEQ ID No. 1):

TGCTGTTGACAGTGAGCGCAGGATTCAAGTTCTTCCAGAATAGTGAAGCCACAGATGTATTCTGGAAGAACTTGAATCCTTTGCCTACTGCCTCGGA

shRNA was designed for Luci, designated sh-Luci, and the sequence was as follows (SEQ ID No. 2):

TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA

after PCR amplification, sh-PTBP1 is cut out by using restriction endonuclease to cut out a sticky end, and then the sticky end is connected with a lentiviral vector and is transformed into escherichia coli for amplification and purification. Subsequently, 4. Mu.g of the purified sh-Luci and sh-PTBP1 lentiviral vectors were transformed into HEK-293T cells together with a helper packaging plasmid (pMDL, VSV-G, pREV) and the solution was changed after 14 hours. Cell supernatants of 24 hours, 48 hours were then collected for infection of U87 cells. Changes in PTBP1 expression in U87 cells after infection were detected by real-time fluorescent quantitative PCR. As shown in figures 1 and 2, the infection efficiency of the U87 cell sh-Luci and sh-PTBP1 lentivirus reaches more than 95%, and the PTBP1 expression in the sh-PTBP1 group is knocked down to 21.77%.

EXAMPLE 2 glioblastoma cell reprogramming

In this example, the inventors cultured human glioblastoma cell line U87 (ATCC HTB-14BSL 1) with DMEM+10% fetal bovine serum: u87 cells were inoculated in 24-well plates at 20000 cells/well, and cultured in an incubator at 37℃containing 5% carbon dioxide. 0.5mL of control Luci lentivirus and the PTBP1 knockdown lentivirus prepared in the example (carrying the m-cherry tag) were added every other day to infect U87 cells. After 24 hours, the cells were cultured for 1 day with normal medium (DMEM (11995040, gibco) +10% foetal calf serum (10099141, gibco) +1% double antibody (15140122, gibco)), followed by culturing with medium specifically inducing neurons (containing DMEM, F12 (11765054, gibco), neurobasal (21103049, gibco), N2 (17502001, gibco), B27 (17504044, gibco), forskolin (S2449, selleck,10 [ mu ] M), and dorsomorphin (S7840, selleck,1 [ mu ] M)), until cell transformation was completed.

Immunofluorescent staining of neuronal indicators: u87 cells after 14 days of reprogramming were fixed with 4% paraformaldehyde for 15 min, PBST with 5% BSA blocked for 30 min and stained overnight with immunofluorescent primary antibodies TUJ1 and MAP2 (abcam). After staining, cells were washed 3 times with PBS for 10 min each, and fluorescent labeling was performed by adding immunofluorescent secondary antibody and DAPI (abcam). After the dyeing is completed, the film is sealed by using an anti-fluorescence quenching agent and nail polish, and then photographed by using an Olinbas confocal microscope. Results as shown in fig. 3 and 4, PTBP1 knockdown U87 cells successfully expressed neuronal indexes TUJ1 and MAP2 after reprogramming.

Proliferation index immunofluorescence staining: u87 cells after 7 days of reprogramming were fixed with 4% paraformaldehyde for 15 min, PBST with 5% bsa blocked for 30 min and stained overnight with immunofluorescent primary antibodies TUJ1 and KI67 (abcam). After staining, cells were washed 3 times with PBS for 10 min each, and fluorescent labeling was performed by adding immunofluorescent secondary antibody and DAPI (abcam). After the dyeing is completed, the film is sealed by using an anti-fluorescence quenching agent and nail polish, and then photographed by using an Olinbas confocal microscope. As a result, as shown in fig. 5 and 6, PTBP1 knockdown U87 cells successfully expressed the neuronal index TUJ1 after reprogramming, and the expression of the proliferation index KI67 was significantly decreased.

Proliferation index immunofluorescence staining: edU was added to U87 cell culture medium 7 days after reprogramming to a final concentration of 10. Mu.M, and after 2 hours incubation, the cells were fixed with 4% paraformaldehyde for 15 minutes, PBST containing 5% BSA was blocked for 30 minutes, and immunofluorescent primary antibody TUJ1 (abcam) was added to the cells overnight for staining. After staining, cells were washed 3 times with PBS, and after 10 minutes each time, click reactions were performed, and immunofluorescent secondary antibodies and DAPI (abcam) were added for fluorescent labeling. After the dyeing is completed, the film is sealed by using an anti-fluorescence quenching agent and nail polish, and then photographed by using an Olinbas confocal microscope. As shown in fig. 7 and 8, PTBP1 knockdown U87 cells successfully expressed the neuronal index TUJ1 after reprogramming, and the expression of the proliferation index EdU was significantly reduced.

Example 3 animal experiments

In this example, glioblastoma cell line U87 of example 1, which had been infected with the control Luci and knockdown PTBP1 virus, was cultured in 10% foetal calf serum in high glucose DMEM to the logarithmic phase, washed with PBS and digested with 0.25% pancreatin, and the cells were collected with PBS to prepare a cell suspension, and then, the cell concentration was adjusted to 1000000/. Mu.L and then, the cell suspension was implanted into the brain of nude mice.

Establishing a nude mouse in-situ brain glioma model: u87 cells infected with luciferase (luciferase) and knocked down PTBP1 lentivirus were seeded 1mm in front of the right sagittal suture of the rat, 3mm below dura at a position 2mm to the right of the midline. 10 SPF-grade BALB/C-nu nude mice were used, 20g each, each male, purchased from Schlemk laboratory animal center. The nude mice were anesthetized with isoflurane gas and then fixed on a stereotactic apparatus (model 68001, shenzhen Ruiwo life technologies Co., ltd.). Hair on top of the head was cut off, the iodophor was sterilized, the scalp was cut open, and the skull was exposed. After the position was determined, the bone window was opened, a small opening was drilled at this position with a small cranial drill, then a U87 cell suspension (containing 500000 cells) was withdrawn with a 5. Mu.L microinjector, and a needle was inserted vertically along the bone hole to 3mm below the dura mater, and after the slow injection for 10 minutes, the needle was left for 5 minutes, after the needle was pulled out, the bone hole was closed with bone wax, and the scalp was sutured. The growth of the tumor was monitored with a PerkinElmer IVIS Lumina X in vivo imaging system and the results are shown in fig. 9 and 10. The results show that the growth rate of U87 cells in vivo after PTBP1 knockdown is significantly reduced.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Sequence listing

<110> Wenzhou medical university affiliated first Hospital

<120> use of PTBP1 inhibitor for preparing medicament for treating glioblastoma

<130> XYY202111995

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 97

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

tgctgttgac agtgagcgca ggattcaagt tcttccagaa tagtgaagcc acagatgtat 60

tctggaagaa cttgaatcct ttgcctactg cctcgga 97

<210> 2

<211> 97

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tgctgttgac agtgagcgca ggaattataa tgcttatcta tagtgaagcc acagatgtat 60

agataagcat tataattcct atgcctactg cctcgga 97

Claims

Use of a PTBP1 inhibitor for the preparation of a formulation for reprogramming glioblastoma cells into neurons, characterized in that the PTBP1 inhibitor is capable of knocking out the PTBP1 gene or knocking down the expression level of the PTBP1 gene.
2. The use according to claim 1, wherein the PTBP1 inhibitor is one selected from the group consisting of:

(1) siRNA targeting PTBP1 gene mRNA;

(2) shRNA targeting PTBP1 gene mRNA;

(3) A vector containing shRNA targeting mRNA of PTBP1 gene;

(4) A virus comprising a vector targeting shRNA of mRNA of PTBP1 gene.
3. The use according to claim 2, characterized in that the nucleotide sequence of the shRNA is shown in SEQ ID No. 1.
4. The use according to claim 2, wherein the virus is a lentivirus.
5. The use according to claim 1, wherein the PTBP1 inhibitor is a CRISPR/Cas9 system capable of knocking out the PTBP1 gene or knocking down the expression of the PTBP1 gene.
6. The use of claim 3, wherein the CRISPR/Cas9 system comprises one of the following combinations:

(1) A combination comprising a specific gRNA and a Cas9 protein; the specific gRNA can specifically bind to the DNA fragment of the PTBP1 gene;

(2) A combination of genes encoding a specific DNA molecule transcribed to give the specific gRNA and a Cas9 protein;

(3) A combination comprising a plasmid having the specific DNA molecule and a plasmid encoding a gene having the Cas9 protein, the plasmid having the specific DNA molecule transcribed to obtain an RNA molecule having the specific gRNA;

(4) Comprises a combination of specific recombinant plasmids expressing the specific DNA molecules and the coding genes of the Cas9 proteins.
Use of a ptbp1 inhibitor for the preparation of a medicament for the treatment of glioblastoma.
8. The use according to claim 7, wherein the treatment of glioblastoma is inhibition of glioblastoma proliferation.
9. The use of claim 8, wherein the medicament is capable of reprogramming glioblastoma cells to neurons to inhibit glioblastoma proliferation.