CN114292847B

CN114292847B - Long-chain non-coding RNA and application thereof in preparation of medicament for treating osteoporosis

Info

Publication number: CN114292847B
Application number: CN202111675393.2A
Authority: CN
Inventors: 印崇; 周静梅; 李静佳; 廖佳梅; 罗荣萍; 郭晓兰; 田野; 骞爱荣
Original assignee: Affiliated Hospital of North Sichuan Medical College
Current assignee: Affiliated Hospital of North Sichuan Medical College
Priority date: 2021-12-31
Filing date: 2021-12-31
Publication date: 2023-10-03
Anticipated expiration: 2041-12-31
Also published as: CN114292847A

Abstract

The invention discloses long-chain non-coding RNA and application thereof in preparation of a medicament for treating osteoporosis. The nucleotide sequence of the RNA is shown as SEQ ID NO. 1. The invention provides an RNA sequence designed based on a humanized long-chain non-coding RNA AP001476.3, which can play a role in treating osteoporosis by targeting miR-241-3p and can be used as an RNA drug.

Description

Long-chain non-coding RNA and application thereof in preparation of medicament for treating osteoporosis

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to long-chain non-coding RNA and application thereof in preparation of a medicament for treating osteoporosis.

Background

Osteoporosis is a very common senile bone disease, and is mainly characterized by reduced bone mass, damaged bone tissue microstructure, reduced bone strength and the like, and is one of the high-risk causes of fracture occurrence. At present, china is in the accelerated process of population aging, and osteoporosis becomes a great threat to the health of the old.

LncRNA is non-coding RNA with the length of more than 200 nucleotides, is widely distributed in eukaryotes, and plays an important role in regulating and controlling various physiological and pathological processes such as cell differentiation, organ development, disease occurrence and the like. LncRNA has gained increasing attention in the field of bone research, and a variety of LncRNA closely related to bone formation has recently been reported. Yuan et al found that LncRNA PGC1β -OT1 could bind to miR-148a-3p, promoting osteogenic differentiation of mesenchymal stem cells, while inhibiting adipogenic differentiation thereof. Li Bing et al show that LncRNA H19 can activate ERK signal pathway, and has therapeutic effect on disuse osteoporosis. In addition, the applicant also found in earlier studies that LncRNA-AK016739, aK039312, aK079370 all inhibited the expression of osteogenic differentiation transcription factors, thereby inhibiting osteoblast differentiation and bone formation.

Research on RNA drugs began in 1978 and has received increasing attention in recent years; compared with the traditional method for controlling or curing diseases through regulating and controlling proteins, the RNA medicine can inhibit the expression of bad genes from the source, thereby inhibiting the development of the diseases. Currently, the U.S. FDA has approved a number of RNA drugs for different diseases. Such as Fomivirsen, are used to treat retinitis caused by CMV. Mipomersen is used for the treatment of familial hypercholesterolemia. Pegaptanib treats age-related macular degeneration, and the like. The increasing number of batches of RNA drugs over the years fully demonstrates the feasibility of RNA therapies and also demonstrates that RNA therapies are rapidly evolving as a new generation of therapeutic regimens. The current RNA drugs are mainly based on short nucleic acids such as siRNA and miRNA, and mRNA and LncRNA sequences are used as RNA drugs, so that the RNA drugs have the characteristics of long half-life and strong specificity, and are now becoming new directions for RNA drug research. Meanwhile, the current RNA drugs are mainly based on local diseases like macular degeneration, hepatitis and the like and rare diseases like Huntington's disease, and the research of RNA drugs for osteoporosis is still reported recently due to the problems of targeting and administration modes.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides long-chain non-coding RNA and application thereof in preparation of a medicament for treating osteoporosis, and the sequence can treat osteoporosis by targeting miR-214-3p, has the characteristics of strong specificity and high safety, and is named HOPE (Human-derived Osteogenic Promoting Element).

In order to achieve the above purpose, the technical scheme adopted by the invention for solving the technical problems is as follows:

a long-chain non-coding RNA has a nucleotide sequence shown in SEQ ID NO. 1.

The specific sequence is as follows: CACCCACAGCCCTGCCTCTCAGTCCCTGCCGTCACCCACAGCCCTGCCTCTCAGTCCCTGCCGTCACCCACAGCCCTGCCTCTCAGTCCCTGCCGT; (SEQ ID NO. 1).

Further, the RNA has at least one site that binds to miR-214-3p or miR-143-3 p.

Further, the RNA has homology of more than 80% with the nucleotide sequence shown in SEQ ID NO.1, and expresses the nucleotide sequence of the same functional protein, and the specific sequence can be: CACCCACAGCCCTGCCTCTCAGTCAACTACGTCACC CACAGCCCTGCCTCTCAGTCAACTACGTCACCCACAGCCCTGCCTCTCAGTCAACTACGT；(SEQ ID NO.2)

Further, the RNA has at least one site that binds to miR-143-3 p.

Further, the RNA sequence may be synthesized directly or may be formed by means including in vitro transcription, recombinant RNA techniques, and the like.

The application of the long-chain non-coding RNA in preparing a product for diagnosing osteoporosis.

The application of the long-chain non-coding RNA in screening products for diagnosing osteoporosis.

Further, the product includes a formulation, chip, reagent or kit.

The application of the long-chain non-coding RNA in preparing RNA medicaments for treating osteoporosis.

The application of the long-chain non-coding RNA in preparing a composite medicine for treating osteoporosis.

The RNA or the drug can be delivered into the body of an osteoporosis patient through intravenous injection, minimally invasive bone marrow cavity local injection, subcutaneous micro-needle injection and the like by a delivery carrier.

The invention has the beneficial effects that:

the invention provides an RNA sequence designed based on a humanized long-chain non-coding RNA AP001476.3, which can play a role in treating osteoporosis by targeting miR-241-3p or miR-143-3p and can be used as an RNA drug.

The HOPE sequence disclosed by the invention can be produced by a direct RNA synthesis mode, can also be produced by in vitro transcription, recombinant RNA technology and the like, does not need complex preparation process and flow, and can be directly used for RNA treatment after being produced.

Drawings

FIG. 1 shows the regulation of bone formation by AP 001476.3;

FIG. 2 shows the modulation of bone formation by AP 001476.3;

FIG. 3 is a graph showing the regulation of bone formation by the repeat region (TAIL) of AP 001476.3;

FIG. 4 shows the regulation of bone formation by HOPE sequences;

FIG. 5 is a graph showing the regulatory effect of HOPE on pre-mouse osteoblast differentiation;

FIG. 6 is a graph showing the regulatory effect of HOPE on human mesenchymal stem cell osteogenic differentiation;

FIG. 7 shows the promotion of HOPE on bone formation in mice.

Detailed Description

The following description of the embodiments of the present invention is provided to facilitate understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and all the inventions which make use of the inventive concept are protected by the spirit and scope of the present invention as defined and defined in the appended claims to those skilled in the art.

It must be stated first that the reagents, instruments and the like used in the present invention are commercially available products unless otherwise specified.

The glass reaction bottle used in the following examples is a glass reaction bottle having a plurality of connectors, and a thermometer and a condenser tube are connected to the connectors in a matching manner so as to realize reflux.

EXAMPLE 1 Regulation of bone formation by AP001476.3

The full-length gene sequence of AP001476.3 is synthesized, then the full-length gene sequence is connected into a plasmid pCDNA3.1 in a conventional manner, an over-expression plasmid of AP001476.3 is constructed, the regulation and control effect of the over-expression plasmid on the formation of mouse bones is detected through a rapid detection technology of the bone formation, and the result shows that AP001476.3 has a promoting effect on the formation of the mouse bones (figure 1), and the specific detection process is as follows:

2 month old C57BL/6 mice were selected, the constructed plasmids were transfected into the mice, and HOPE sequences and mutants thereof were transfected into the mice in vivo by using a skull subcutaneous local injection technique, and all mice were intraperitoneally injected with calcein (20 mg/kg) 10d and 3d before the mice were sacrificed, respectively. After the end of the experiment, the distal femur is killed, fixed by formaldehyde, dehydrated by gradient sucrose/OCT mixed solution, and then non-decalcified embedded by OCT. A frozen section of femur with a thickness of 4 μm was made using a frozen microtome, photographed by a fluorescence microscope, and examined for the effect of AP001476.3 on bone formation.

Example 2 target prediction of AP001476.3

Screening for bone formation-related mirnas to which AP001476.3 can bind through the RNA v 22 website revealed that AP001476.3 can bind miR-214-3p (fig. 2).

EXAMPLE 3 Regulation of bone formation by the AP001476.3 functional region

The overexpression plasmid pCDNA3.1 comprising the AP001476.3 repeat region and the non-repeat region sequence was constructed, and the regulation and control effect on the bone formation of mice were detected by a rapid detection technology for bone formation, and the result shows that the repeat region of AP001476.3 has a promotion effect on the bone formation of mice, but the non-repeat region has no function on the bone formation (figure 3). The specific detection process is as follows:

EXAMPLE 4 Regulation of bone formation by HOPE sequences

1. Promotion of bone formation by HOPE sequences

By analyzing the sequence of the repeated region of the AP001476.3, the sequence containing a plurality of binding sites of the AP001476.3 and the miR-214-3p is designed and named as HOPE (SEQ ID NO. 1), meanwhile, the sequence mutated with the binding sites of the miR-143-3p and the miR-214-3p is constructed, the sequences are connected to an over-expression plasmid, and the regulation and control effects on the bone formation of mice are detected by a rapid bone formation detection technology, so that the result shows that: the HOPE sequence had an effect of promoting bone formation in mice, and the HOPE sequence mutated with the miR-214-3p binding site was not functional for bone formation, but the HOPE sequence mutated with the miR-143-3p binding site (SEQ ID NO. 2) still had an effect of promoting bone formation (FIG. 4).

2. Modulation of mouse preosteoblast differentiation by HOPE

The HOPE sequence is transfected in the preosteoblast MC3T3-E1 of the mouse by lipofectamine 2000 transfection reagent, and the osteogenic differentiation level of the preosteoblast MC3T3-E1 is detected, and the specific process is as follows:

(1) Cell culture: inoculating mouse preosteoblast MC3T3-E1 in logarithmic growth phase into cell culture dish at 37deg.C with 5% CO ₂ Complete medium (alpha-MEM supplemented with 10% FBS, 100units/mL streptomycin and 100units/mL penicillin).

(2) Cell transfection: preosteoblasts of MC3T3-E1 were prepared at 1X 10 ⁵ Density of wells/wells were seeded in six well plates, medium was changed to alpha-MEM, and cells were transfected using lipofectamine 2000 transfection reagent at a concentration of 2 μl/mL and a concentration of 20nM for the HOPE sequence. 6h after transfection, the medium was changed to complete medium, and after 48h the level of osteoblastic differentiation was measured.

(3) Osteogenic differentiation related gene expression levels: after removal of the cells, cells were lysed by adding Trizol, RNA was extracted and reverse transcribed into cDNA. qPCR was used to detect the change in expression of the osteogenic differentiation related gene Runx2, osterix.

As shown in FIG. 5, the expression level of osteogenic differentiation related gene Osterix, runx2 of cells was significantly increased after transfection of the HOPE sequence, indicating that the HOPE sequence promotes osteoblast differentiation.

3. Modulation of human mesenchymal stem cell osteogenic differentiation by HOPE

The HOPE sequence is transfected in the human mesenchymal stem cells by lipofectamine 2000 transfection reagent, and the osteogenic differentiation level of the human mesenchymal stem cells is detected, and the specific process is as follows:

(1) Cell culture: human mesenchymal stem cells in logarithmic growth phase are inoculated in a cell culture dish at 37 ℃ and 5% CO ₂ Complete medium (RPMI 1640 supplemented with 10% FBS, 100units/mL streptomycin and 100units/mL penicillin).

(2) Cell transfection: human mesenchymal stem cells are used in an amount of 1 x 10 ⁵ Density of wells/wells were seeded in six well plates, medium was changed to RPMI1640, and cells were transfected with lipofectamine 2000 transfection reagent at a concentration of 2 μl/mL and hop sequence concentration of 20nM. 6h after transfection, the medium was changed to complete medium, and after 48h the level of osteoblastic differentiation was measured.

As shown in FIG. 6, the expression level of osteogenic differentiation related gene Osterix, runx2 of cells was significantly increased after transfection of the HOPE sequence, indicating that the HOPE sequence promotes osteoblast differentiation.

4. Promotion of mouse bone formation by HOPE

(1) Selecting a C57BL/6 mouse with the age of 2 months, shaving hair on the top of the skull after the mouse is anesthetized, locally injecting 40 mu l of HOPE sequence into the skull of the mouse by using an insulin syringe after alcohol wiping, and killing the mouse after 20 days;

(2) Bone formation assay: all mice were intraperitoneally injected with calcein (20 mg/kg) 10d and 3d before mice were sacrificed, respectively. After the end of the experiment, the distal femur is killed, fixed by formaldehyde, dehydrated by gradient sucrose/OCT mixed solution, and then non-decalcified embedded by OCT. Femur frozen sections were made with a thickness of 4 μm using a frozen microtome, photographed by a fluorescence microscope, and analyzed for bone mineral deposition rate and bone formation rate changes using Image J software.

As shown in FIG. 7, the HOPE sequence can promote the bone formation of mice, while the HOPE mutant has no remarkable promoting effect.

Sequence listing

<110> affiliated Hospital of Chuanbei medical college

<120> a long-chain non-coding RNA and application thereof in preparation of osteoporosis treatment drugs

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 96

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

cacccacagc cctgcctctc agtccctgcc gtcacccaca gccctgcctc tcagtccctg 60

ccgtcaccca cagccctgcc tctcagtccc tgccgt 96

<210> 2

<211> 96

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cacccacagc cctgcctctc agtcaactac gtcacccaca gccctgcctc tcagtcaact 60

acgtcaccca cagccctgcc tctcagtcaa ctacgt 96

Claims

1. A long-chain non-coding RNA is characterized in that the nucleotide sequence of the RNA is shown as SEQ ID NO. 1.

2. The long-chain non-coding RNA of claim 1, wherein the RNA has at least one site that binds miR-214-3p or miR-143-3 p.

3. The long non-coding RNA of claim 1, wherein the RNA is injectable through a delivery vehicle.

4. Use of the long non-coding RNA of any one of claims 1-3 in the preparation of an RNA medicament for the treatment of osteoporosis.