CN107354127B - Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration - Google Patents
Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration Download PDFInfo
- Publication number
- CN107354127B CN107354127B CN201710561399.4A CN201710561399A CN107354127B CN 107354127 B CN107354127 B CN 107354127B CN 201710561399 A CN201710561399 A CN 201710561399A CN 107354127 B CN107354127 B CN 107354127B
- Authority
- CN
- China
- Prior art keywords
- tug1
- lncrna
- stem cell
- regeneration
- periodontal ligament
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0654—Osteocytes, Osteoblasts, Odontocytes; Bones, Teeth
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
- C12N2506/1392—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from mesenchymal stem cells from other natural sources
Abstract
The invention discloses effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration.The present invention regulates and controls the inside and outside experiment of PDLSCs Osteoblast Differentiation and regeneration by research LncRNA-TUG1, LncRNA-TUG1 has played important regulating and controlling effect in periodontal ligament stem cell Osteoblast Differentiation and tissue regeneration processes, LncRNA-TUG1 can be used as the potential target spot of tissue regeneration therapies, promotion is developed new about LncRNA-TUG1 related drugs or the factor, and regenerative medicine field is finally applied to, reach clinically really precisely medical treatment.
Description
Technical field
The present invention relates to oral tissue regeneration field technical fields, and in particular to LncRNA-TUG1 regulation PDLSCs at
Effect in bone differentiation and regeneration.
Background technique
Oral cavity stem-cell research realizes that biology regeneration and biological function reparation provide for human teeth and periodontium
It may.In recent years, new research is brought to biology regeneration about the progress of tooth steam cell and tissue engineering technique
Direction.Tooth steam cell, can be with soft or hard group with human body multiple location with advantages such as energetic, materials are convenient, low immunological rejections
Regeneration is knitted, as reparation, the healing of skin and regeneration, fat are thin after the reparation and regeneration of tooth and periodontium, the wound of eyes
Tissue reconstruction, self-regeneration of immune system of born of the same parents etc..Periodontal ligament stem cell (PDLSCs) is a kind of in clinical oral work
It is easier to the adult stem cell obtained；It is also a kind of adult stem cell with multi-lineage potential and self-renewal capacity.From 04
It year Seo etc. is successfully separated and identifies from the periodontal membrane tissue of human body using single cell clone technology, periodontal ligament stem cell is with regard to standby
By the concern of dentistry and other biological regeneration field researcher.It passes through induction appropriate in vitro and is capable of forming bone, soft
The Various Tissues such as bone, nerve, fat, blood vessel；Has a potential ability for being divided into osteoblast or cementoblast, and can be
Cementum-parodontium-alveolar bone spline structure object is formed after transplanting in vivo, is bone tissue maintenance, the osteanagenesis, reparation of clinical oral
And the periodontal remodeling of correction provides important clinical value.
Present inventor seminar takes the lead in proposing to carry out biological tooth using tooth related stem cells early period in the world
The new concept of root regeneration, and the inside and outside experiment of serial dependent body has been carried out, successful regeneration out can be just such as on miniature pig animal model
The biological root of the tooth often to function；The periodontal ligament stem cell diaphragm that self allosome periodontal ligament stem cell and Vc induce is used for tissue
Regeneration, achieves good effect；Using cryogenic freezing technology, optimize the biology performance and storage of periodontal ligament stem cell diaphragm
Condition carries out self allosome stem cell tissue regeneration for different time points and reparation provides possibility.
In human genome, there are about 93% DNA can all be transcribed into RNA, but only 2% RNA has coding albumen
The function of matter, numerous DNA are finally transcribed into non-coding RNA.Long-chain non-coding RNA (long non coding RNA,
It LncRNA) is non-coding RNA of a kind of length greater than 200 nucleotide.In the past it is considered as the noise in transcription, does not have
Practical function.But in recent years, going deep into research, scientists find it in epigenetic, transcription and posttranscriptional gene
Important regulating and controlling effect is all played in expression.Studies have shown that LncRNAs participates in the adjustment effect of a variety of vital movements: can be to egg
White encoding gene carries out epigenetics adjusting；Directly adjust genetic transcription and protein degradation；Participate in the life of certain organelles
It is transported at the subcellular of process and intracellular molecules；And it is often closely related with gene imprinting phenomenon.Currently, research LncRNAs is most
Important role may be by number of mechanisms and promote or inhibit the occurrence and development of tumour and invasion to shift, including hepatocellular carcinoma,
Cancer of pancreas, leukaemia etc..In terms of stem-cell research, in recent years research shows that the biological behaviour of certain LncRNA and stem cell
It is closely related.In human adipose's stem cell skeletonization into atomization, LncRNA-MEG3 is reached by regulation miR-140-5p
Enhance to the fat of inhibition ADMSC to differentiation and induced osteogenesis to ability to express；Equally, it reduces in fat stem cell
The expression of LncRNA-MIAT can promote its differentiation to osteoblast.In human marrow mescenchymal stem cell, knock out
It can accelerate the expression of skeletonization differentiation gene after Long Non-Coding RNA NONHSAT009968；LncRNA-H19 is participated in
Differentiation of the bone marrow stroma stem cell to osteoblast and nerve cell, when under H19 timing BMSC can differentiating into nerve cells energy
Power enhancing；Meanwhile lncRNA (Esco2, Pcdhb18 and RGD1560277) also assist in regulation BMSC it is thin to nerve cell and skeletonization
Born of the same parents' differentiation.
Taurine up-regulation gene 1 (Taurine upregulated gene 1, TUG1) is located at human chromosomal
22q12.2, length are about 7.1kb, have several open reading frames but longest coding is no more than 100 amino acid, therefore
Think that it is a kind of long-chain non-coding RNA.TUG1 is found in mouse retinal cells earliest, retina cell nucleus and
There is expression in cytoplasm；Retina cell's decreased growth, apoptosis capacity can be caused to increase after TUG1 is knocked out, mouse is caused to send out
Educate deformity.LncRNA-TUG1 can recruit polycomb repressive complex 2 (PRC2) albumen of methylation, from
And regulate and control the expression of certain cell growth control genes.It is several for three days after retinal progenitor cells progress TUG1siRNA transfection
(such as Klf2) is raised in relevant to Apoptosis access gene expression, and cell death increases, and the normal expression of TUG1 may be for
Certain gene participating in apoptosis are inhibited to play an important role.TUG1 has adjustment effect to SM22 α in vascular smooth muscle cells.
After silencing TUG1, cell decreased growth or apoptosis increase, SM22 α mRNA expression up-regulation；It can inhibit compound with more comb albumen
EZH2 protein binding in body 2 (PRC2), to regulate and control the expression of certain growth control genes；EZH2 in endochylema turns with methyl
It moves in enzymatic activity and the forming process of the cell pseudopodium in PDGF induction and plays a crucial role, obtain TUG1 and EZH2, F-actin
Between interaction mechanism and its adjustment effect to vascular smooth muscle cells skeleton.Researcher also found TUG1 promoter
Nearby include that some highly conserved P53 bind site, can be stimulated by the P53 DNA damage response mediated and express up-regulation.
In addition, after TUG1 is in conjunction with PRC2, then chromatin modification is carried out in conjunction with target gene, play controlling gene expression function and
Realize the expressional function of silencing target gene.TUG1 is a kind of regulatory factor, although its not coding protein, can directly with
The form of RNA by with a variety of transcription factor interactions, regulate and control polygenic expression, for mankind's normal growth and development process
Play a significant role.But effect of the LncRNA-TUG1 in periodontal ligament stem cell and with periodontal ligament stem cell Osteoblast Differentiation and
The research of regeneration dependent interaction, has not been reported at present.
Summary of the invention
For the above-mentioned prior art, inventor combine previous experiments basis (grant of national natural science foundation project,
No.81200758), tested, carried out by the inside and outside that research LncRNA-TUG1 regulates and controls PDLSCs Osteoblast Differentiation and regeneration
Molecular level study and tissue regeneration in vivo research, the results show that LncRNA-TUG1 is in periodontal ligament stem cell Osteoblast Differentiation and group
Knit and played important regulating and controlling effect in regenerative process, by reversely proving, when LncRNA-TUG1 lower, PDLSCs skeletonization to point
Change and paradenlal tissue regeneration ability is suppressed, illustrates LncRNA- in the regeneration of periodontal ligament stem cell mediating tissue through the invention
The adjusting function of TUG1 promotes oral tissue regeneration to provide important foundation for regulation tooth steam cell.
Specifically, the present invention relates to following technical schemes:
Firstly, one of the objects of the present invention is to provide LncRNA-TUG1 as target spot regulation periodontal ligament stem cell at
Application in bone differentiation and/regeneration.
Specifically, the regulation includes positive regulation and/negative regulation, positive regulation, which refers to, promotes periodontal ligament stem cell Osteoblast Differentiation
With/regeneration, negative regulation, which refers to, inhibits periodontal ligament stem cell Osteoblast Differentiation and/regeneration.
LncRNA-TUG1 expression improves, and can promote periodontal ligament stem cell Osteoblast Differentiation and/regeneration；LncRNA-
TUG1 expression decline, PDLSCs skeletonization are suppressed to differentiation and paradenlal tissue regeneration ability.
Based on above-mentioned application, the invention discloses a kind of LncRNA-TUG1 promotors in preparation periodontal ligament stem cell skeletonization
Purposes in differentiation and/regeneration drug.
The LncRNA-TUG1 promotor refers to any activity that LncRNA-TUG1 can be improved, increases LncRNA-
The substance of TUG1 expression quantity, such as increase the over-express vector of the LncRNA-TUG1 of LncRNA-TUG1 expression quantity.
The invention also discloses LncRNA-TUG1 inhibitor to inhibit periodontal ligament stem cell Osteoblast Differentiation and/tissue in preparation
Purposes in regenerating medicine.
In above-mentioned application, the LncRNA-TUG1 inhibitor includes antagonist, lower adjustment, retarding agent, blocking agent etc..
Any activity that can reduce LncRNA-TUG1, the substance for reducing LncRNA-TUG1 expression quantity are used equally for the present invention.
In preferred embodiment, the LncRNA-TUG1 inhibitor is that the slow virus of LncRNA-TUG1 expression is inhibited to carry
Body.
Based on above-mentioned application, the invention discloses the sides of a kind of promotion periodontal ligament stem cell Osteoblast Differentiation and/regeneration
Method, the method includes improving the expression of the activity of LncRNA-TUG1 and/increase LncRNA-TUG1.
In preferred embodiment, the method also includes improving the activity of LncRNA-TUG1 and/increase LncRNA-
Periodontal ligament stem cell after TUG1 expression forms periodontal ligament stem cell compound with artificial bone supporting material and prepares osteogenic materials
Step.
The invention also discloses the method for a kind of inhibition periodontal ligament stem cell Osteoblast Differentiation and/regeneration, the methods
Expression including inhibiting LncRNA-TUG1.
Periodontal ligament stem cell has a variety of differentiation potentials, is capable of forming bone, cartilage, mind by induction appropriate in vitro
Through, Various Tissues such as fat, blood vessel, (even if during directional induction) periodontal ligament stem cell also can be with a variety of in induction
The generation (osteoblast+fat cell, osteoblast+vascular cell etc.) of noble cells inhibits Osteoblast Differentiation by part, can
Effectively to induce stem cell to break up to other specific organization directions.
Secondly, the second object of the present invention be to provide it is a kind of regulate and control periodontal ligament stem cell Osteoblast Differentiation and/tissue again
Raw pharmaceutical composition, described pharmaceutical composition contain a effective amount of above-mentioned LncRNA-TUG1 promotor or LncRNA-TUG1 suppression
Preparation.
Further, also include in described pharmaceutical composition: pharmaceutically acceptable carrier.
" pharmaceutically acceptable carrier " is conventional drug administration carrier, including various excipient or diluent etc..
The present invention achieve it is following the utility model has the advantages that
The present invention is tested by the inside and outside that LncRNA-TUG1 regulates and controls PDLSCs Osteoblast Differentiation and regeneration, it was confirmed that
LncRNA-TUG1 has played important regulating and controlling effect in periodontal ligament stem cell Osteoblast Differentiation and/tissue regeneration processes；
LncRNA-TUG1 can be used as the potential target spot of tissue regeneration therapies, and promotion is developed new about LncRNA-TUG1 related drugs
Or the factor, and regenerative medicine field is finally applied to, reach clinically really precisely medical treatment.
Detailed description of the invention
The accompanying drawings constituting a part of this application is used to provide further understanding of the present application, and the application's shows
Meaning property embodiment and its explanation are not constituted an undue limitation on the present application for explaining the application.
Fig. 1 periodontal ligament stem cell biological characteristics experimental result, it is primary that PDLSCS stem cell is separately cultured situation (A) display
With the 3rd be commissioned to train feeding cell (scale bar:200 μm), Multidirectional Differentiation ability measurement ALP dyeing, Alizarin red staining (B), skeletonization
Correlation factor measures (C)
Fig. 2 periodontal ligament stem cell skeletonization to the situation of change after induction, A. periodontal ligament stem cell skeletonization to after induction 7d,
Apparent LncRNA is expressed in RT-qPCR screening；B. periodontal ligament stem cell skeletonization changes to induction different time, the expression of TUG1
Fig. 3 transfects the immunofluorescence situation of change of slow virus PDLSCs, and A. transfects the slow virus carrier of disturbance target spot,
PDLSCs shows fluorescent microscopy images Scale bar:200um.；B.RT-qPCR verifying, the efficiency feelings of disturbance target spot silencing TUG1
Condition
Fig. 4 Periodontal ligament stem cell skeletonization is to induction different time, correlation skeletonization index situation of change when silencing TUG1,
A.ALP dyes (1w) (scale bar:200 μm)；B. Alizarin red staining (3w) (scale bar:200 μm)；C.ALP activity；D.
Calcium ion concentration；E. the expression of osteogenic factor (ALP, Runx2, OCN), as the result is shown silencing TUG1 group compared with empty carrier group and
Blank control group is in reducing tendency, and empty carrier group and non-adding carrier induction group are not significantly different between the two (has system with p < 0.05 *
Meter learns meaning)
Fig. 5 LncRNA-TUG1 regulates and controls periodontal ligament stem cell tissue regeneration in vivo ability.HE dyes (8w, 12w), scale
Bar:100 μm
Specific embodiment
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to exemplary embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation and/or their combination.
In order to enable those skilled in the art can clearly understand technical solution of the present invention, below with reference to tool
The embodiment of the body technical solution that the present invention will be described in detail.
1 periodontal ligament stem cell biological characteristics of embodiment
1, the separation and culture of Periodontal ligament stem cell
Sterile the first and second premolar teeth for pulling out people's impacted third molar or orthodontic therapy, gently removes its week under anesthesia
The periodontium enclosed takes the periodontium in middle section, is cleaned, is shredded repeatedly with PBS, be placed in enzyme containing Type I collagen (3g/L) and
The digestive juice of II enzyme of Dispase (4g/L) digests 40 minutes at 37 DEG C, crosses 70um cell sieve and collects cell, and 1000 revs/min,
Centrifugation 5 minutes, removes the liquid on upper layer, suspends into single cell suspension again with fresh culture solution.By cell inoculation in 25cm2
In Tissue Culture Flask, (contain 20% fetal calf serum, 2mmol/L glutamine, 100U/ml penicillin and 100 μ in α-MEM culture medium
G/ml streptomysin) in 37 DEG C, 5%CO2Culture was replaced culture solution 1 time every 2-3 days, and it is raw that cell is observed under inverted microscope
Long situation.When cell grows to 80% converging state, 1:2 or 1:3 had digestive transfer culture is pressed with 0.25% trypsase.(take third
Cell completes subsequent experimental from generation to generation)
2, the expression of periodontal ligament stem cell surface marker
Using flow cytometry and immunofluorescence art, periodontal ligament stem cell STRO-1, CD146, CD45 are observed, between CD31 etc.
The expression of mesenchymal stem cells marker.
3, Multidirectional Differentiation ability
By periodontal ligament stem cell respectively in skeletonization to induced medium and fat to induced medium culture 4 weeks, then divide
Its multi-lineage potential is not detected by Alizarin red staining, oil red O stain and RT-PCR technology.
Experimental result is as shown in Figure 1, it can be seen from the results that the PDLSCs that the present invention is separately cultured passes through identification and lures
It leads, osteoblast can be divided into, have the multi-lineage potential of stem cell.
Embodiment 2 screens LncRNA-TUG1, and cellular localization and the expression variation in skeletonization into induction are carried out to it
1, periodontal ligament stem cell difference skeletonization is extracted into RNA to induction 0d, 7d, by RT-qPCR, determines and filter out expression significantly
Purpose non-coding RNA, and carry out variation tendency of the different time skeletonization to induction.
Experimental result is as shown in Fig. 2, filter out the apparent LncRNA-TUG1 of expression, and tentative confirmation TUG1 is in PDLSCs
Expression trend in Osteoblast Differentiation.
2, slow virus carrier constructs
According to people LncRNA-TUG1 sequence (ID:55000) design primer, primer is by the limited public affairs of Shanghai neck section biotechnology
Department synthesizes and purifies.The pGenesil-1 plasmid of linearisation is connected to after annealing, the expression of building LncRNA-TUG1 (silencing) carries
Body slow virus inhibits the expression of LncRNA-TUG1 (because TUG1 sequence is excessive, it is extremely difficult to successfully construct over-express vector, therefore this hair
Bright building inhibits the carrier of LncRNA-TUG1 expression to carry out reversed research demonstration).
Building process used carrier and primer are as follows:
Vector:pLenO-GFP
Lenti-hTUG1-NC sequence: TTCTCCGAACGTGTCACGT (SEQ ID NO:1) (Negative Control)
Lenti-hTUG1-sh1
GPH-hTUG1-SH1 Forward Sequence
5’GATCCCTGTTGACCTTGCTGTGAGAACTTCCTGTCAGATTCTCACAGCAAGGTCAACAGTTTTTG3’
(SEQ ID NO:2)
GPH-hTUG1-SH1 Reverse Sequence
5’AATTCAAAAACTGTTGACCTTGCTGTGAGAATCTGACAGGAAGTTCTCACAGCAAGGTCAACAGG3’
(SEQ ID NO:3)
Lenti-h TUG1-sh2
GPH-hTUG1-SH2 Forward Sequence
5’GATCCGCTTGGCTTCTATTCTGAATCCTTTCTTCCTGTCAGAAAAGGATTCAGAATAGAAGCCAAG
CTTTTTG3’(SEQ ID NO:4)
GPH-hTUG1-SH2 Reverse Sequence
5’AATTCAAAAAGCTTGGCTTCTATTCTGAATCCTTTTCTGACAGGAAGAAAGGATTCAGAATAGAAG
CCAAGCG3’(SEQ ID NO:5)
Lenti-h TUG1-sh3
GPH-hTUG1-SH3 Forward Sequence
5’GATCCGCTACAACTATCTTCCTTTACCTTCCTGTCAGAGTAAAGGAAGATAGTTGTAGCTTTTTG
3’(SEQ ID NO:6)
GPH-hTUG1-SH3 Reverse Sequence
5’AATTCAAAAAGCTACAACTATCTTCCTTTACTCTGACAGGAAGGTAAAGGAAGATAGTTGTAGCG
3’(SEQ ID NO:7)
Lenti-h TUG1-sh4
GPH-hTUG1-SH4 Forward Sequence
5’GATCCGCAAGAGATAACTATGAAAGCCTTCCTGTCAGAGCTTTCATAGTTATCTCTTGCTTTTTG
3’(SEQ ID NO:8)
GPH-hTUG1-SH4 Reverse Sequence
5’AATTCAAAAAGCAAGAGATAACTATGAAAGCTCTGACAGGAAGGCTTTCATAGTTATCTCTTGCG
3’(SEQ ID NO:9)
Cell is grouped: control group, sh-NC group, sh-TUG1-1# group, sh-TUG1-2# group, sh-TUG1-3#
Group, sh-TUG1-4# group require to be separately added into virus according to slow-virus transfection step specification.Normal incubation medium is gained after 12h,
In fluorescence microscopy microscopic observation after being incubated for for 24 hours, there is green fluorescence and illustrate to transfect successfully.(for 24 hours, screening transfects the stable time
48h, 72h, 96h), finally selecting transfection time is 72h, and MOI value is 20.Total serum IgE is extracted, the correlation of subsequent RT-qPCR is completed
Verifying.
Screening verification is as the result is shown: the silencing efficiency of sh-TUG1-2# group is most obvious (as shown in Figure 3).
3, by periodontal ligament stem cell distinguish skeletonization to induction different time (0,1,3,7,10,14d), LncRNA-TUG1's
Expression variation
Cell is cleaned with serum free medium, sh-NC and sh-TUG1-2# slow virus adds according to transfection procedure specification
Enter into cell.It uses normal culture medium after 12h instead, is incubated for 72h, skeletonization is given after stabilization to be transfected and is trained to induced medium
It supports.Complete functional study of the subsequent LncRNA-TUG1 to periodontal ligament stem cell Osteoblast Differentiation.
Experimental result is as shown in Figure 4, the results showed that, LncRNA-TUG1 in PDLSCs skeletonization to induction different time, it is overall
Expression trend is in rising trend；ALP dyeing and Alizarin red staining show that PDLSCs skeletonization has obviously to induction with blank control group
Difference；The expression of ALP activity and osteogenic ability correlation factor (ALP, Runx2, OCN) is increased compared with the expression of blank control group,
Demonstrate again that PDLSCs has ability of the skeletonization to cell differentiation.
The research of 3 LncRNA-TUG1 of embodiment regulation periodontal ligament stem cell tissue regeneration in vivo
Periodontal ligament stem cell compound is implanted to nude mice dorsal sc, it is observed and organizes the formation of ability.
1, slow virus sh-NC empty carrier and sh-TUG1-2# are transfected into periodontal ligament stem cell respectively
Using the periodontal ligament stem cell of tissue block method and enzyme digestion culture people, eugonic third generation parodontium is done
Cell inoculation in 60mm culture dish, be trained be divided into α-MEM culture medium (containing 15% fetal calf serum, 2mmol/L glutamine,
100U/ml penicillin, 100 μ g/ml streptomysins).Slow virus sh-NC empty carrier and sh-TUG1-2# transfection parodontium are done respectively
Cell, experiment are divided into 3 groups: (1) normally culture periodontal ligament stem cell group (2) sh-NC empty carrier transfection periodontal ligament stem cell group (3)
Sh-TUG1-2# transfects periodontal ligament stem cell group
2, the preparation of biologic bracket material
It will be co-cultured by the periodontal ligament stem cell of autoclaved β-TCP biologic bracket material and in vitro culture,
Ratio 50mg:1*107A cell.Be randomly divided into 3 groups: (1) normally culture periodontal ligament stem cell film+β-TCP group (2) sh-NC is empty
Carrier transfects periodontal ligament stem cell+β-TCP group (3) sh-TUG1-2# and transfects periodontal ligament stem cell+β-TCP group
3, it returns and plants in timbering material/stem cell complex body
Nude mice is randomly divided into 3 groups: (1) normally culture periodontal ligament stem cell film+β-TCP group (2) sh-NC empty carrier transfects tooth
After all film stem cell+β-TCP group (3) sh-TUG1-2# transfection periodontal ligament stem cell+β-TCP organize back plant 8w, 12w, put to death respectively
Nude mice.
A. imageological examination: x-ray and CT examination observe regeneration situation.
B. histological observation: putting to death animal and obtain sample, and fixed, decalcification carries out HE dyeing, and observation biological support tissue is again
Raw situation.
Experimental result is shown, lowers obvious (the H&E dyeing of variation decline of tissue regeneration in vivo ability after LncRNA-TUG1
After showing mineralising induction 8w, 12w, it was demonstrated that LncRNA-TUG1 has facilitation to tissue regeneration ability).
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Shandong University
<120>effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213>artificial sequence
<400> 1
ttctccgaac gtgtcacgt 19
<210> 2
<211> 65
<212> DNA
<213>artificial sequence
<400> 2
gatccctgtt gaccttgctg tgagaacttc ctgtcagatt ctcacagcaa ggtcaacagt 60
ttttg 65
<210> 3
<211> 65
<212> DNA
<213>artificial sequence
<400> 3
aattcaaaaa ctgttgacct tgctgtgaga atctgacagg aagttctcac agcaaggtca 60
acagg 65
<210> 4
<211> 73
<212> DNA
<213>artificial sequence
<400> 4
gatccgcttg gcttctattc tgaatccttt cttcctgtca gaaaaggatt cagaatagaa 60
gccaagcttt ttg 73
<210> 5
<211> 73
<212> DNA
<213>artificial sequence
<400> 5
aattcaaaaa gcttggcttc tattctgaat ccttttctga caggaagaaa ggattcagaa 60
tagaagccaa gcg 73
<210> 6
<211> 65
<212> DNA
<213>artificial sequence
<400> 6
gatccgctac aactatcttc ctttaccttc ctgtcagagt aaaggaagat agttgtagct 60
ttttg 65
<210> 7
<211> 65
<212> DNA
<213>artificial sequence
<400> 7
aattcaaaaa gctacaacta tcttccttta ctctgacagg aaggtaaagg aagatagttg 60
tagcg 65
<210> 8
<211> 65
<212> DNA
<213>artificial sequence
<400> 8
gatccgcaag agataactat gaaagccttc ctgtcagagc tttcatagtt atctcttgct 60
ttttg 65
<210> 9
<211> 65
<212> DNA
<213>artificial sequence
<400> 9
aattcaaaaa gcaagagata actatgaaag ctctgacagg aaggctttca tagttatctc 60
ttgcg 65
Claims (5)
1.LncRNA-TUG1 as non-disease diagnosing and treating purposes target spot regulation periodontal ligament stem cell Osteoblast Differentiation and/
Application in paradenlal tissue regeneration, which is characterized in that in the application, LncRNA-TUG1 expression is improved, and promotes parodontium dry thin
Born of the same parents' Osteoblast Differentiation and/paradenlal tissue regeneration；LncRNA-TUG1 expression decline, periodontal ligament stem cell skeletonization to differentiation and periodontal group
Power of regeneration is knitted to be suppressed.
2.LncRNA-TUG1 promotor promotes in periodontal ligament stem cell Osteoblast Differentiation and/paradenlal tissue regeneration drug in preparation
Purposes.
3. purposes according to claim 2, which is characterized in that the LncRNA-TUG1 promotor, which refers to, improves LncRNA-
The activity of TUG1, the substance for increasing LncRNA-TUG1 expression quantity.
4.LncRNA-TUG1 inhibitor inhibits in periodontal ligament stem cell Osteoblast Differentiation and/paradenlal tissue regeneration drug in preparation
Purposes.
5. purposes according to claim 4, which is characterized in that the LncRNA-TUG1 inhibitor includes reducing LncRNA-
The activity of TUG1 and/antagonist of reduction LncRNA-TUG1 expression quantity, lower adjustment, retarding agent, blocking agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710561399.4A CN107354127B (en) | 2017-07-11 | 2017-07-11 | Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710561399.4A CN107354127B (en) | 2017-07-11 | 2017-07-11 | Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107354127A CN107354127A (en) | 2017-11-17 |
| CN107354127B true CN107354127B (en) | 2019-02-22 |
Family
ID=60293430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710561399.4A Active CN107354127B (en) | 2017-07-11 | 2017-07-11 | Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107354127B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616190B (en) * | 2019-02-19 | 2023-08-18 | 中国人民解放军第四军医大学 | Method for regulating and controlling periodontal ligament stem cell osteogenic differentiation based on extracellular matrix |
| CN110241196B (en) * | 2019-05-10 | 2020-07-28 | 山东大学 | Application of circRNA PRKD3 in osteogenic differentiation of periodontal ligament stem cells |
| CN110305867B (en) * | 2019-07-10 | 2020-08-21 | 东莞赛尔生物科技有限公司 | Method and reagent for regulating and controlling dryness maintenance capability of adipose-derived stem cells |
| CN112239744B (en) * | 2020-10-20 | 2021-08-03 | 青岛市妇女儿童医院（青岛市妇幼保健院、青岛市残疾儿童医疗康复中心、青岛市新生儿疾病筛查中心） | Interfering RNA capable of promoting osteogenic transformation of dental pulp stem cells and application thereof |
| CN112342217B (en) * | 2020-11-11 | 2021-04-16 | 杨桂梅 | Periodontal ligament stem cell proliferation and osteogenic differentiation promoter |
| CN113413489B (en) * | 2021-06-23 | 2022-06-10 | 重庆医科大学附属口腔医院 | Let-7 a-containing periodontal defect repair system |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520771A (en) * | 2016-12-20 | 2017-03-22 | 江苏省人民医院 | Long non-coding RNA and application of long non-coding RNA in diagnosis and treatment of preeclampsia |
-
2017
- 2017-07-11 CN CN201710561399.4A patent/CN107354127B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520771A (en) * | 2016-12-20 | 2017-03-22 | 江苏省人民医院 | Long non-coding RNA and application of long non-coding RNA in diagnosis and treatment of preeclampsia |
Non-Patent Citations (2)
| Title |
|---|
| "Long noncoding RNA TUG1 facilitates osteogenic differentiation of periodontal ligament stem cells via interacting with Lin28A";Qin He 等;《Cell Death and Disease》;20180419;第9卷(第455期);第1-14页 |
| "长链非编码ＲNA 在骨代谢中的研究进展";郭建民 等;《中国老年学杂志》;20161031;第36卷(第19期);第4923-4926页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107354127A (en) | 2017-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107354127B (en) | Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration | |
| Deng et al. | The role of miR-31-modified adipose tissue-derived stem cells in repairing rat critical-sized calvarial defects | |
| Charbord | Bone marrow mesenchymal stem cells: historical overview and concepts | |
| US20060247195A1 (en) | Method of altering cell properties by administering rna | |
| CN110337490A (en) | Enhance the method for fibroblast therapeutic activity | |
| CN104321426A (en) | Immortalized stem cells and medicinal composition and medicinal preparation comprising product thereof as active ingredient | |
| CN111500578B (en) | Regulating ADSCs osteogenic differentiation and tissue regeneration circRNA-FTO and application thereof | |
| CN112375785B (en) | Method for promoting mesenchymal stem cell osteogenic differentiation and application | |
| Wang et al. | Enhancement of bone formation by genetically engineered human umbilical cord–derived mesenchymal stem cells expressing osterix | |
| CN109504710B (en) | Application of KDM4D | |
| Awais et al. | Human dental pulp stem cells exhibit osteogenic differentiation potential | |
| CN107320726B (en) | Application of the LncRNA-TUG1 in the drug that the stemness of preparation regulation periodontal ligament stem cell maintains ability | |
| Li et al. | Systemically transplanted bone marrow stromal cells contributing to bone tissue regeneration | |
| KR101503939B1 (en) | Method for preparation of cartilage cell | |
| CN103387959A (en) | Stem cell from deciduous teeth, and preparation method and application thereof | |
| CN104232570B (en) | Set up the method and its application of monoclonal mescenchymal stem cell | |
| CN105087477A (en) | Application of mesenchymal stem cell modified by miR-21 antisense nucleotide | |
| Popuri | Concerns of a pediatric dentist in dental stem cells: an overview | |
| CN105878264A (en) | Application of miR-21 and inhibitor thereof to preparation of drug for promoting periodontal tissue regeneration | |
| JP4554940B2 (en) | Medicament containing mesenchymal cells derived from human placenta and method for producing VEGF using the cells | |
| US20080233090A1 (en) | Method of Treatment by Administration of Rna | |
| KR102306231B1 (en) | A method for differentiation of tonsil-derived mesenchymal stem cell into tenocyte | |
| Jung et al. | Mechanical stimulation increases the proliferation and differentiation potential of human adipose-derived stromal cells | |
| WO2010021162A1 (en) | Cell preparation for bone tissue regeneration | |
| Karimi et al. | Stem Cells in Dentistry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |