CN116855499A

CN116855499A - Small RNA of PIANZAIHUANG for preventing and/or treating hepatic fibrosis, small RNA composition, and preparation method and application thereof

Info

Publication number: CN116855499A
Application number: CN202310933806.5A
Authority: CN
Inventors: 黄进明; 庄毅超; 苏媛媛; 郭宏源; 付正; 邓绮虹; 张辰宇
Original assignee: Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Current assignee: Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Priority date: 2023-07-27
Filing date: 2023-07-27
Publication date: 2023-10-10

Abstract

The invention provides a small RNA of a PIANZAIHUANG for preventing and/or treating hepatic fibrosis, a small RNA composition, a preparation method and application thereof, and belongs to the technical field of biological medicines. The small RNA of the invention is a nucleotide sequence shown in any one of SEQ ID NO.1 and SEQ ID NO. 3-6, and the small RNA composition is composed of the nucleotide sequence shown in SEQ ID NO. 1-6 as a component. The 6 small RNA molecules can be effectively absorbed by ingestion, exist in vivo stably, play a role in preventing and/or treating liver fibrosis, and the composition obtained by combining the 6 small RNA molecules can also be used for preventing and/or treating liver fibrosis. The research of the invention discovers that the small RNA which is beneficial to preventing and treating hepatic fibrosis in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG.

Description

Small RNA of PIANZAIHUANG for preventing and/or treating hepatic fibrosis, small RNA composition, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a small RNA and small RNA composition of a PIANZAIHUANG for preventing and/or treating hepatic fibrosis, a preparation method and application thereof.

Background

Liver fibrosis is a progressive pathological process in which connective tissue hyperplasia in the liver occurs abnormally, resulting from various pathogenic factors, thereby causing excessive deposition of extracellular matrix in the liver. Liver fibrosis is a common pathological process of various chronic liver diseases, has reversibility, and the reversion of liver fibrosis is a key for preventing and treating chronic liver diseases and liver cirrhosis. In the prior art, antiviral treatments such as interferon, lamivudine and the like are mostly adopted in clinic, but drug resistance is easy to generate, and the side effect is large after long-term administration, and once the drug is stopped, the phenomenon of rebound can be generated, so that death is caused by serious patients.

The traditional Chinese medicine of the Tze Huang is applied to the clinical treatment of liver diseases for a long time. A plurality of researches show that the administration of the PIANZAIHUANG has obvious treatment effect on liver fibrosis diseases. The mechanism research shows that various medicinal components in the Tze Huang have the value of treating the hepatic fibrosis diseases, but the pharmacological and pharmacodynamic mechanisms of the Tze Huang in the hepatic fibrosis diseases cannot be completely explained.

In recent years, various studies have shown that exogenous small RNAs derived from foods, herbs, etc. can be absorbed by the human body through the digestive tract, enter human cells to regulate target genes and function. The small RNA found in traditional Chinese medicine honeysuckle has the capability of directly inhibiting the replication of H5N1 and SARS-CoV-2 viruses, and the small RNA of the honeysuckle can play a role in treating viral infectious diseases after the honeysuckle decoction is taken. Also as found in rhodiola rosea, the small RNAs have the function of treating pulmonary fibrosis. These findings suggest that the small RNA of the traditional Chinese medicine can be taken orally as a novel traditional Chinese medicine active ingredient which is ignored for a long time and can be absorbed through the alimentary canal to reach the target organ to exert the therapeutic value.

Disclosure of Invention

The invention aims to provide a small RNA and a small RNA composition of a PIANZAIHUANG for preventing and/or treating hepatic fibrosis, and a preparation method and application thereof.

The invention provides a small RNA for preventing and/or treating hepatic fibrosis, which is a nucleotide sequence shown in any one of SEQ ID NO.1 and SEQ ID NO. 3-6.

The invention also provides application of the small RNA nucleotide sequence shown in any one of SEQ ID NO. 1-6 in preparing a medicament for preventing and/or treating liver fibrosis.

Further, the medicine is a medicine for inhibiting the expression of AKT1, TGFB1 and UQRC 2 genes;

preferably, the agent is an agent that reduces ALT and AST levels in serum;

and/or, the medicament is a medicament for reducing the collagen fiber content of liver tissue;

and/or the medicament is a medicament for inhibiting the expression of Collagen1 and alpha-SMA proteins.

The invention also provides a small RNA composition for preventing and/or treating hepatic fibrosis, which consists of the nucleotide sequences shown as SEQ ID NO. 1-6 as components.

Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 30-50%, the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 15-30%, the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 10-25%, the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 5-20%, the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 5-15%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 3-10%.

Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 35-36%, the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 17-18%, the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 15-16%, the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 11-12%, the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 10-11%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 8-9%.

Further, the nucleotide sequences shown in SEQ ID NOS.1-6 have a molar ratio of 1:0.5:0.44:0.33:0.28:0.23.

The invention also provides a preparation method of the small RNA composition, which comprises the following steps:

mixing the nucleotide sequences shown in SEQ ID NO. 1-6.

The invention also provides application of the small RNA composition in preparing a medicament for preventing and/or treating liver fibrosis;

preferably, the drug is a drug that inhibits the expression of AKT1, TGFB1, uqrc 2 genes.

Further, the medicine is a medicine for reducing ALT and AST content in serum;

The invention also provides a medicine for preventing and/or treating hepatic fibrosis, which is a preparation prepared by taking the small RNA or the small RNA composition as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.

Compared with the prior art, the invention has the beneficial effects that:

the invention extracts 6 kinds of small RNA from traditional Chinese patent medicine PIANZAIHUANG, and the 6 kinds of small RNA can inhibit the expression of three genes AKT1, TGFB1 and UQCRC2, thereby playing a role in preventing and/or treating hepatic fibrosis. And, the composition obtained by combining these 6 small RNAs can also be used for preventing and/or treating liver fibrosis. Meanwhile, 6 sRNAs can be effectively absorbed through ingestion, exist stably and are convenient and effective to use. The 6 sRNAs can also be used as markers to control the quality of the Pianzaihuang, and the Pianzaihuang with high content of 6 sRNAs has better effect of preventing and treating hepatic fibrosis. The research of the invention discovers that the small RNA which is beneficial to preventing and treating hepatic fibrosis in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 is a flow chart of a small RNA high throughput sequencing experiment.

FIG. 2 shows Solexa sequencing to obtain the copy number of the small RNA of the anti-inflammatory and anti-inflammatory bolus of the present invention.

FIG. 3 shows the concentration of small RNA of the anti-inflammatory agent in serum.

Fig. 4 shows the concentration of small RNA of the inventive bolus in the liver.

FIG. 5 shows the binding results of PTH-sRNA-1 to AKT1 gene.

FIG. 6 shows the binding results of PTH-sRNA-5 to AKT1 gene.

FIG. 7 shows the binding results of PTH-sRNA-7 to AKT1 gene.

FIG. 8 shows the binding results of PTH-sRNA-12 to AKT1 gene.

FIG. 9 shows the binding results of PTH-sRNA-14 to AKT1 gene.

FIG. 10 shows the binding results of PTH-sRNA-18 to AKT1 gene.

FIG. 11 shows the binding results of PTH-sRNA-1 and TGFB1 genes.

FIG. 12 shows the binding result of PTH-sRNA-5 to TGFB1 gene.

FIG. 13 shows the binding result of PTH-sRNA-7 to TGFB1 gene.

FIG. 14 shows the binding results of PTH-sRNA-12 and TGFB1 genes.

FIG. 15 shows the binding results of PTH-sRNA-14 and TGFB1 genes.

FIG. 16 shows the binding results of PTH-sRNA-18 and TGFB1 gene.

FIG. 17 shows the binding results of PTH-sRNA-1 and UQCRC2 genes.

FIG. 18 shows the binding results of PTH-sRNA-5 to UQCRC2 gene.

FIG. 19 shows the binding results of PTH-sRNA-7 to UQCRC2 gene.

FIG. 20 shows the binding results of PTH-sRNA-12 to UQCRC2 gene.

FIG. 21 shows the binding results of PTH-sRNA-14 to UQCRC2 gene.

FIG. 22 shows the binding results of PTH-sRNA-18 to UQCRC2 gene.

Fig. 23 shows the binding ability of small RNA of bolus to target site through luciferase reporter assay.

FIG. 24 shows ALT and AST detection in mouse serum.

FIG. 25 is a representative graph of staining of mouse liver tissue HE, masson, sirius scarlet.

FIG. 26 shows the expression level of α -SMA and Collagen1 in mouse liver tissue.

FIG. 27 is a representation of immunohistochemical staining of Collagen1, alpha-SMA protein in liver tissue (scale bar: 100 μm).

Detailed Description

The materials and equipment used in the embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

The Tze Huang used in the invention is provided by Zhangzhou Tze Huang pharmaceutical industry Co., ltd.

In the invention, the total RNA of the Tze Huang is firstly extracted in the early-stage research, and the total RNA is subjected to small RNA high-throughput sequencing; and then, carrying out intragastric bolus on the mice, carrying out high-throughput sequencing on small RNA extracted from serum of the mice, screening the small RNA with the pharmaceutical source of the bolus of the miniRNA, and selecting the small RNA with the copy number of more than 100 for research, so that the 6 small RNA are finally found to be relevant to liver fibrosis.

Example 1 verification of 6 Small RNAs of the invention in Pianzaihuang

1. Extraction of total RNA in Pianzaihuang

Taking a proper amount of the Tze Huang, grinding the Tze Huang into 100 meshes of powder at normal temperature or low temperature, total RNA from the samples was extracted with Trizol reagent. The specific method comprises the following steps:

1) Grinding Tze Huang into powder by using a low-temperature grinder, weighing 50mg, putting into a 1.5ml centrifuge tube, adding 1ml of trizol vortex, and standing on ice for 10min;

2) Adding 200 μl of chloroform, shaking vigorously to mix them, and standing for 5min;

3) Centrifuging at 4deg.C and 14000g for 20min;

4) Sucking the supernatant into a new 1.5ml centrifuge tube, adding isopropanol with the volume of 1-2 times of the supernatant, uniformly mixing, and then placing into a-20 ℃ for precipitation for more than 1 hour;

5) Centrifuging at 4deg.C and 14000g for 20min;

6) Discarding the supernatant precipitate, adding 1ml of 75% alcohol prepared with DEPC water, and blowing;

7) Centrifuging at 4deg.C and 14000g for 20min;

8) Discarding the supernatant, inverting a 1.5ml centrifuge tube, and airing the alcohol for about 5-10min;

9) Dissolving in DEPC water, and preserving at-80deg.C to obtain total RNA of PIANZAIHUANG.

2. The invention detects the content of 6 small RNAs

After total RNA extraction of the Tze Huang, detection can be performed by high throughput sequencing techniques, reverse transcription PCR (RT-PCR), real-time fluorescent quantitative PCR (qPCR), RNA chips, northern Blotting, in situ hybridization, and the like. The specific method of the embodiment is as follows:

extracting total RNA from Tze Huang, performing PAGE electrophoresis to recover 18-45nt RNA molecule, adding 3' joint, adding RT primer with UMI into the system, and performing reverse transcription extension to synthesize cDNA chain. The 6 small RNA sequences and the content of the small RNA are detected by a small RNA high-throughput sequencing technology (the experimental flow is shown in the figure 1) (table 1). The RT primer with UMI is supplied by sequencing company (Shenzhen megagene Co., ltd.).

TABLE 1 names and sequences of small RNAs

The 6 small RNA copies are shown in FIG. 2. As can be seen from Table 1 and FIG. 2, the 6 small RNAs of the present invention are higher in the Tze Huang, wherein the PTH-sRNA-1 content is the highest.

The beneficial effects of the present invention are demonstrated by specific test examples below.

Test example 1 stability study of the small RNA of Pianzaihuang of the invention into the body by ingestion

1. Experimental method

And detecting small RNA of the Pianzaihuang which enters the animal body through ingestion and exists stably by using an RT-qPCR method. Male C57 mice were randomly divided into normal control groups (PBS control groups), bolus dose groups, and multiple bolus dose groups. After 12h of fasted food, the Tze Huang is ground into 100-mesh powder, and then is prepared into suspension by PBS for gastric administration. The single administration group is only administrated by intragastric administration once, and the multiple administration group is administrated by intragastric administration once every 3 hours for three times. The dosage of the bolus for each time is 0.1g/100g. The PBS control group was perfused with an equivalent dose of PBS. After the last gastric lavage is finished for 6 hours, blood of the mice is taken to separate serum, and liver tissues are taken. The RT-qPCR method is used for detecting the content of 6 small RNA of the Pitahuang in serum and liver tissues, and primers for detecting the small RNA of the Pitahuang by reverse transcription PCR and qPCR are shown in table 2.

TABLE 2 reverse transcription PCR and qPCR detection primer list

Reverse transcription (10 μl) of sRNA of Pitahuang was performed using the system shown in Table 3.

TABLE 3 sRNA reverse transcription reaction System

After the system is prepared, the mixture is evenly mixed and put into a PCR instrument for reaction, and the reaction procedure is shown in Table 4.

TABLE 4 reverse transcription procedure for sRNA

After the reverse transcription is completed, quantitative detection is performed by using qPCR primers. qPCR system is shown in Table 5 and reaction procedure is shown in Table 6.

TABLE 5 sRNA fluorescent quantitative PCR reaction System

TABLE 6 fluorescent quantitative PCR reaction procedure

2. Experimental results

The experimental results are shown in fig. 3 and 4: the results show that the 6 small RNAs of the Tze Huang can be absorbed through the alimentary canal and reach the serum and liver tissues. Experimental results show that 6 sRNA of the Tze Huang can enter the animal body through ingestion and exist stably.

Test example 2 bioinformatics means analysis of the binding of small RNA of Pianzaihuang to target Gene

1. Experimental method

Whether the small RNA of the Pianzaihuang can be combined with a series of target genes related to liver fibrosis diseases or not is researched, and the therapeutic value of the small RNA on the liver fibrosis diseases is exerted by inhibiting the expression of target genes. And analyzing the combination condition of the 6 small RNAs of the Pianzaihuang and the target genes of AKT1, TGFB1 and UQCRC2 by using a bioinformatics means (RNA hybrid).

2. Experimental results

The binding capacity of PTH-sRNA-1 to the mRNA of the AKT1 gene is shown in FIG. 5, which illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-1 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-1 has 2 binding modes with AKT 1.

The binding capacity of PTH-sRNA-5 to the mRNA of the AKT1 gene is shown in FIG. 6: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-5 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-5 has 1 binding mode with AKT 1.

The binding capacity of PTH-sRNA-7 to the mRNA of the AKT1 gene is shown in FIG. 7: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-7 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-7 has 3 binding modes with AKT 1.

The binding capacity of PTH-sRNA-12 to the mRNA of the AKT1 gene is shown in FIG. 8: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-12 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-12 has 3 binding modes with AKT 1.

The binding capacity of PTH-sRNA-14 to the mRNA of the AKT1 gene is shown in FIG. 9: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-14 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-14 has 1 binding mode with AKT 1.

The binding capacity of PTH-sRNA-18 to the mRNA of the AKT1 gene is shown in FIG. 10: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-18 to the mRNA of the AKT1 gene. Among them, PTH-sRNA-18 has 1 binding mode with AKT 1.

The binding capacity of PTH-sRNA-1 to TGFB1 gene mRNA is shown in FIG. 11: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-1 to TGFB1 gene mRNA. Among them, there are 2 binding modes of PTH-sRNA-1 and TGFB 1.

The binding capacity of PTH-sRNA-5 to TGFB1 gene mRNA is shown in FIG. 12: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-5 to the mRNA of the TGFB1 gene. Among them, there are 2 binding modes of PTH-sRNA-5 and TGFB 1.

The binding capacity of PTH-sRNA-7 to TGFB1 gene mRNA is shown in FIG. 13: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-7 to the mRNA of the TGFB1 gene. Among them, PTH-sRNA-7 has 2 binding modes with TGFB 1.

The binding capacity of PTH-sRNA-12 to TGFB1 gene mRNA is shown in FIG. 14: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-12 to the mRNA of the TGFB1 gene. Among them, PTH-sRNA-12 has 2 binding modes with TGFB 1.

The binding capacity of PTH-sRNA-14 to TGFB1 gene mRNA is shown in FIG. 15: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-14 to the mRNA of the TGFB1 gene. Among them, PTH-sRNA-14 has 2 binding modes with TGFB 1.

The binding capacity of PTH-sRNA-18 to TGFB1 gene mRNA is shown in FIG. 16: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-18 to TGFB1 gene mRNA. Among them, PTH-sRNA-18 has 2 binding modes with TGFB 1.

The binding capacity of PTH-sRNA-1 to the UQCRC2 gene mRNA is shown in FIG. 17: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-1 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-1 and UQCRC 2.

The binding capacity of PTH-sRNA-5 to the mRNA of the UQCRC2 gene is shown in FIG. 18: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-5 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-5 and UQCRC 2.

The binding capacity of PTH-sRNA-7 to the mRNA of the UQCRC2 gene is shown in FIG. 19: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-7 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-7 and UQCRC 2.

The binding capacity of PTH-sRNA-12 to the mRNA of the UQCRC2 gene is shown in FIG. 20: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-12 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-12 and UQCRC 2.

The binding capacity of PTH-sRNA-14 to the mRNA of the UQCRC2 gene is shown in FIG. 21: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-14 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-14 and UQCRC 2.

The binding capacity of PTH-sRNA-18 to the mRNA of the UQCRC2 gene is shown in FIG. 22: the figure illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-18 to the mRNA of the UQCRC2 gene. Among them, there are 2 binding modes of PTH-sRNA-18 and UQCRC 2.

It is considered that the minimum free energy (mfe) is smaller than-20 and has an inhibitory effect, so that according to the analysis result, all 6 small RNAs of the invention have the functions of specifically binding with target genes mRNA of AKT1, TGFB1 and UQCRC2 and inhibiting gene expression.

Three genes of AKT1, TGFB1 and UQRC 2 are all acknowledged to play a role in promoting disease occurrence and development in the liver fibrosis disease process, and AKT1 mediates mitochondrial autophagy through the generation of ROS in the liver fibrosis process and promotes secretion of TGFB 1. TGFB1 is a key cytokine that promotes the development of liver fibrosis and can cause hepatic stellate cells to be converted into myofibroblasts (Myofibroblast-like cells), thereby leading to the formation of liver fibrosis. Meanwhile, inhibition of uqrc 2 can inhibit mitochondrial function in hepatic stellate cells.

Therefore, inhibition of three genes AKT1, TGFB1 and UQCRC2 can play a role in preventing and/or treating liver fibrosis diseases. The 6 kinds of small RNAs have the effect of preventing and/or treating liver fibrosis.

Test example 3 inhibition effect of small RNA of Pianzaihuang on target Gene

1. Experimental method

Six small RNAs of the four-point Tze Huang, namely PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18, are obtained from the four-point Tze Huang by adopting the method described in the embodiment 1, and can be directly synthesized by adopting the conventional technology.

The inhibition effect of the small RNA of the Pianzaihuang on the target gene is proved by a luciferase report experiment:

the segment sequence fragments of AKT1, TGFB1 and UQCRC2 target genes and 6 small Pitazia Tsiang RNAs of the present invention (PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18 with the molar ratio of 1:0.5:0.44:0.33:0.28:0.23) are respectively inserted into pMIR-REPORT Luciferase plasmids to construct luciferase reporter plasmids of the respective genes. Positive clones were screened and sequenced for verification, clones were amplified and plasmids were purified.

The relevant cells are cultured and inoculated in a 24-well plate, and after 12-16 hours, the cells are co-transfected by the luciferase expression plasmid carrying the predicted target gene to be detected and the small RNA plasmid of the Pianzaihuang. After 24 hours, the cells were collected and lysed, and luciferase substrate was added and luciferase reacted with the substrate to produce luciferin. By detecting the intensity of fluorescence, the luciferase activity can be determined. And comparing with the transfected nonsense small RNA group, so as to judge whether the predicted target point can be inhibited by the small RNA of the Tze Huang.

Segment sequence fragments of AKT1 target gene binding to small RNAs:

GGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCCCCTTCTGTGT

CACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCCCTCAGATGATCT

CTCCACGGTAGCACTTGACCTTTTCGACGCTTAACCTTTCCGCTGTCGC

CCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCACGCCTCCTGGCCAG(SEQ ID NO.25)

segment sequence fragments of TGFB1 target gene binding to small RNAs:

CACCAGCCCTGTTCGCGCTCTCGGCAGTGCCGGGGGGCGCCGCCTCCC

CCATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCT

GTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGGGACTATCCAC

CTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGA(SEQ ID NO.26)

segment sequence fragments of uqrc 2 target gene binding to small RNAs: GATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCA (SEQ ID NO. 27)

Nonsense small RNA sequence: GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 28). Nonsense small RNAs are nonsensical small RNA sequences that do not bind to the target gene.

2. Experimental results

And (3) respectively inserting segment sequence fragments of AKT1, TGFB1 and UQCRC2 target genes and small RNA of the Pianzaihuang into pMIR-REPORT Luciferase plasmids to construct luciferase reporter plasmids of the genes. The result of luciferase report experiments (figure 23) shows that the 6 small RNAs of the Pianzaihuang provided by the invention have inhibition effects on three target genes AKT1, TGFB1 and UQCRC2 after being combined. The nonsense small RNA has no inhibition effect on three target genes of AKT1, TGFB1 and UQCRC 2.

Test example 4 prevention and protection effects of small RNA of Pianzaihuang on liver fibrosis

1. Experimental method

Six small RNAs of the Pitazia Tsiang, namely PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18, are directly synthesized by adopting a conventional technology.

The hepatic fibrosis model is constructed, and the prevention and protection effects of the sRNA composition of the anti-inflammatory and anti-inflammatory bolus on hepatic fibrosis are proved:

CCl is put into ₄ Mixing with olive oil at a ratio of 1:4, and injecting olive oil diluted CCl into the abdominal cavity of 8-week-old C57 mice respectively ₄ And olive oil, 100 μl per mouse, injected once every three days, 10 times, after the last injection is completed, mice are sacrificed after one day. During the molding, mice were randomly divided into a control group (control), a bolus sRNA group (PTH sRNA) and a nonsense small RNA group (scramble RNA), wherein the control group (control) was perfused with PBS, and the bolus sRNA group was prepared into a suspension by mixing 6 small RNAs and perfusing the suspension with PBS (PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18 in a molar ratio of 1:0.5:0.44:0.33:0.28:0.23), and the total amount of sRNA was perfused at a dose of 0.16nmol/g once per day. Nonsense small RNA groups the nonsense small RNA is also prepared into a suspension by PBS for gastric lavage, and the gastric lavage is carried out once a day according to the dosage of the total amount of the nonsense small RNA of 0.16 nmol/g. As same asWhen wild mice without modeling were used as controls (WT).

The sequence of the nonsense small RNA is shown as SEQ ID NO. 28.

2. Experimental results

After the modeling was completed, blood was taken from the serum isolated to examine the levels of ALT and AST in the serum of each group of mice, and as shown in fig. 24, the levels of ALT and AST in the serum of the mice in the control group were significantly higher than those in healthy mice, while the levels of ALT and AST in the serum of mice given the anti-inflammatory agent sRNA administration of the anti-inflammatory agent were significantly lower than those in the control group.

Then, the disease progression of liver fibrosis was evaluated by HE, masson and sirius red staining for each group of mice, and the results also indicated (fig. 25) that the liver tissue collagen fiber content of the mice administered with the anti-inflammatory sRNA administration of the anti-inflammatory agent was significantly lower than that of the mice of the control group.

The expression levels of the Collagen1 and alpha-SMA proteins were then detected by Western Blot, and the results indicate (FIG. 26) that the expression of the Collagen1 and alpha-SMA proteins in the liver tissue of mice could be significantly inhibited by prophylactic administration to model mice.

The results of immunohistochemistry indicated that mice passed through CCl (fig. 27) ₄ After induction, the levels of α -SMA and Collagen1 were significantly elevated in liver tissue, compared to mice given anti-inflammatory sRNA, where accumulation of α -SMA and Collagen1 was significantly inhibited.

The above results demonstrate that the small RNA compositions of the present invention can prevent liver fibrosis.

In conclusion, 6 small RNAs are extracted from the traditional Chinese patent medicine Pianzaihuang, and the 6 small RNAs can inhibit the expression of three genes AKT1, TGFB1 and UQCRC2, thereby playing a role in preventing and/or treating hepatic fibrosis. And, the composition obtained by combining these 6 small RNAs can also be used for preventing and/or treating liver fibrosis. Meanwhile, 6 sRNAs can be effectively absorbed through ingestion, exist stably and are convenient and effective to use. The 6 sRNAs can also be used as markers to control the quality of the Pianzaihuang, and the Pianzaihuang with high content of 6 sRNAs has better effect of preventing and treating hepatic fibrosis. The research of the invention discovers that the small RNA which is beneficial to preventing and treating hepatic fibrosis in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.

Claims

1. A small RNA for preventing and/or treating liver fibrosis, characterized in that: it is a nucleotide sequence shown in any one of SEQ ID NO.1 and SEQ ID NO. 3-6.

Use of a microrna nucleotide sequence as set forth in any one of seq ID nos. 1 to 6 for the preparation of a medicament for the prevention and/or treatment of liver fibrosis.

3. Use according to claim 2, characterized in that: the medicine is used for inhibiting the expression of AKT1, TGFB1 and UQCRC2 genes;

preferably, the agent is an agent that reduces ALT and AST levels in serum;

4. A small RNA composition for preventing and/or treating liver fibrosis, characterized in that: it is composed of the nucleotide sequences shown as SEQ ID NO. 1-6 as components.

5. The small RNA composition of claim 4, wherein: the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 30-50%, the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 15-30%, the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 10-25%, the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 5-20%, the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 5-15%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 3-10%.

6. The small RNA composition of claim 5, wherein: the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 35-36%, the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 17-18%, the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 15-16%, the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 11-12%, the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 10-11%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 8-9%.

7. The small RNA composition of any one of claims 4 to 6, wherein: the mol ratio of the nucleotide sequences shown in SEQ ID NO. 1-6 is 1:0.5:0.44:0.33:0.28:0.23.

8. The method for producing a small RNA composition of any one of claims 4 to 7, wherein: it comprises the following steps:

mixing the nucleotide sequences shown in SEQ ID NO. 1-6.

9. Use of the small RNA composition of any one of claims 4 to 7 for the preparation of a medicament for the prevention and/or treatment of liver fibrosis;

10. Use according to claim 9, characterized in that: the medicine is used for reducing ALT and AST content in serum;

11. A medicament for preventing and/or treating liver fibrosis, characterized in that: the preparation is prepared by taking the small RNA as claimed in claim 1 or the small RNA composition as claimed in any one of claims 4 to 7 as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.