KR102132198B1 - CRISPR system specific for TERT promoter mutation and use thereof - Google Patents

Abstract

The present invention is a composition for DNA targeting using a CRISPR interference (CRISPRi) system specific for a TERT promoter mutation, a composition for preventing or treating cancer using the system, a diagnostic and imaging composition, and a single strand used in a CRISPR interference (CRISPRi) system Guide RNA (sgRNA) and its use. The single-stranded guide RNA (sgRNA) according to the present invention and the CRISPRi system using the same can selectively and effectively target the point mutation of the TERT promoter and inhibit its activity, -124 C through such epigenetic editing technology Targeting the >T or -146 C>T mutant TERT promoter is expected to be very suitable as a new cancer therapy.

Description

CRISPR system specific for TERT promoter mutation and use thereof {CRISPR system specific for TERT promoter mutation and use thereof}

The present invention is a composition for DNA targeting using a CRISPR interference (CRISPRi) system specific for a TERT promoter mutation, a composition for preventing or treating cancer using the system, a diagnostic and imaging composition, and a single strand used in a CRISPR interference (CRISPRi) system Guide RNA (sgRNA) and its use.

Cancer is the most common disease with circulatory diseases in Korea. Normally, cells divide, grow and die by the intracellular regulation function, and maintain the balance of cell numbers. When these cells are damaged, they become abnormal cells whose proliferation and suppression are not regulated and become uncontrolled and excessively proliferative, and may invade surrounding tissues and organs to cause mass formation and destruction of normal tissues. This condition is defined as a cancer or tumor.

Tumors include benign tumors and malignant tumors. Benign tumors grow relatively slowly and do not spread, metastasize to various parts of the body and can be removed and healed. Most benign tumors are life-threatening except in unusual cases. Does not cause Malignant tumors, on the other hand, are tumors that pose a danger to life by rapid growth and invasive (digging or spreading) growth and spreading metastasis to each part of the body (moving away from the original site).

In particular, hepatocellular carcinoma (HCC) is the third most common cause of cancer-related deaths in Korea and around the world, and is an increasing type of carcinoma. HCC is a very heterogeneous disease at the clinical, pathological and molecular level, with over 80% to 90% of hepatitis B virus (HBV), hepatitis C virus (HCV), and alcohol (alcohol), metabolic disease (metabolic etiologies) caused by cirrhosis. HCC is cirrhotic nodule, regenerating nodule> dysplastic nodule (DN)> early HCC> progressive HCC> multistep hepatocarcinogenesis However, unlike other cancers, genetic changes related to development and progression are almost no known genetic mutations other than mutations in the TP53 and CTNNB1 genes and a small number of genetic mutations.

In addition, skin cancer is frequently exposed to various harmful substances or ultraviolet rays due to an increase in the amount of ultraviolet rays caused by the destruction of the ozone layer due to recent lifestyle patterns such as increased outdoor activities and environmental pollution. As the number of older populations increases, the number of patients continues to increase worldwide. Skin cancer is a malignant tumor of the skin. Representative types include basal cell carcinoma, squamous cell carcinoma, and melanoma. Among them, melanoma can occur anywhere on the skin, eyeball, and cerebrospinal fluid, where melanocytes are present, and unlike other skin cancers, the growth rate is very fast. It is known as a tumor. The primary metastatic site of melanoma is skin outside the primary site, but other organs such as lymph nodes, bones, lungs, liver, and spleen may also be affected. In particular, metastasis to the brain and spinal cord is considered the main cause of death. According to estimates by the National Cancer Institute in the United States in 2012, there were an estimated 996,587 melanoma patients in the United States. In addition, according to the US Bureau of Statistics released in 2009, it is predicted that in the next 50 years, the incidence of melanoma among Asians will triple. In fact, in Korea, a survey by the Korea Health Insurance Review and Assessment Service found that the number of patients treated for melanoma of the skin from 2010 to 2014 increased by about 63% in 5 years.

If melanoma is diagnosed early, it can be easily treated by surgical methods, but it may experience pain and some feeling of fatigue or placebo after surgery, and if lymph nodes are excised, infection and lymphedema can be experienced. In addition, there is a side effect that scars may remain depending on the surgical range, the location of the tumor, and the constitution of the individual. In addition, melanoma is a refractory disease that has no special treatment until now if it has advanced or recurred because of its high resistance to conventional chemotherapeutic agents and radiation. In the case of radiation treatment, there is a side effect that the skin of the irradiated area may become dry or turn red, hair may fall out, and dermatitis may occur. Treatments used in chemotherapy are dacarbazine (DTIC) and carmustine (BCUN). , Lomustine (CCNU), cisplatin, etc. They are used as monotherapy or as complex therapy. Most of them are artificially synthesized substances, and their effects are not only weak, but also nausea, vomiting, and leukopenia. , Side effects such as thrombocytopenia, body aches and diarrhea are very serious.

Recent reports have shown that TERT promoter somatic mutations are common in melanoma, HCC and some other cancers. In the case of Melanoma, -124 C>T, -146 C>T mutations were reported, and it was reported that -124 C>T somatic mutations of the TERT promoter were observed in about 59% of HCC. Sorafenib, which has been used as a therapeutic agent for HCC, has no long-term life-prolonging benefit from drugs and has limitations such as resistance induction, so it is urgently needed to develop effective new treatments such as gene therapy.

On the other hand, CRISPR (clustered regularly interspaced short palindromic repeat) / Cas9 system is an immune system found in bacteria that acts as a defense mechanism against phage. It is an RNA-guided gene scissor that recognizes the target base of target DNA by single-stranded guide RNA (sgRNA) and causes DNA double strand break (DSB) by the nuclease activity contained in the Cas9 protein. . Compared to the existing ZFN and TALEN gene scissors, the advantage of being able to target and edit any DNA region through only the sequence change of sgRNA is as long as the sgRNA that recognizes 20 base sequences and the Cas9 protein recognition PAM (protosapcer adjacent motif) sequence are present. do. In addition, a plurality of targets can be simultaneously performed using a plurality of sgRNAs, and the efficiency is also significantly higher than that of ZFN and TALEN. It is known that it works very well in mammalian cells and animals through cell experiments and animal experiments.

Accordingly, the present inventors target a mutant base region of the -124 C>T or -146 C>T somatic TERT promoter found in HCC, and sgRNA that specifically works for the mutant TERT promoter through the CRISPR system and does not work for the wild TERT promoter. Was produced. Also, a CRISPR system for targeting the mutant TERT promoter was constructed by using a mutant (D10A / H840A) dead Cas9 that does not cause DSB due to lack of nuclease activity of Cas9 and introducing KRAB known as an epigenetic editor. In addition, according to this, a CRISPR interference (CRISPRi) system for targeting only HCCs having a -124 C>T or -146 C>T mutation of the TERT promoter was constructed and the present invention has been completed.

Accordingly, an object of the present invention relates to a composition for DNA targeting using a CRISPR interference (CRISPRi) system.

In addition, the object of the present invention relates to a composition for preventing or treating cancer using the system.

Further, another object of the present invention relates to a single strand guide RNA (sgRNA) used in a CRISPR interference (CRISPRi) system.

In order to achieve the above object, the present invention

A guide RNA comprising a nucleotide sequence complementary to a TERT (Telomerase reverse transcriptase) promoter, or DNA encoding the guide RNA; And

Provided is a composition for DNA targeting, comprising a Cas9 polypeptide or a polynucleotide encoding the same.

The composition may be to suppress the expression of DNA.

In addition, the TERT promoter may include one or more point mutations, and the TERT promoter may include -124 C>T or -146 C>T mutations.

In addition, the nucleotide may be 20 nucleotides comprising a base complementary to a -124 C>T or -146 C>T mutation of the TERT promoter, wherein the nucleotide is -124 C from 1'to 5'from the 3'end. >T or -146 C>T. In particular, the nucleotide may be made of a nucleotide sequence of SEQ ID NO: 1 ( 5' - GGGGCUGGGAGGGCCCGGAA -3' ) or SEQ ID NO: 2 ( 5'-GGGCUGGGAGGGCCCGGAAG-3' ).

In addition, the Cas9 may be a biologically inactivated Cas (dCas), and the Cas9 protein is C-terminal, N-terminal or C-terminal and N-terminal, KRAB, KOX, SID, MBD2, MBD3, One or more domains selected from the group consisting of DNMT1, DNMT3A and DNMT3B may be linked, and preferably, the KRAB domain may be linked to the N-terminus.

In addition, the present invention provides a composition for preventing or treating cancer, comprising the composition for DNA targeting.

In addition, the present invention provides a composition for diagnosing cancer, comprising the composition for DNA targeting.

In addition, the present invention provides an imaging composition for cancer, comprising the composition for DNA targeting.

In addition, the present invention is a single-stranded guide RNA (sgRNA) comprising a nucleotide sequence complementary to a TERT (Telomerase reverse transcriptase) promoter, which is 20 nucleotides comprising a base complementary to a -124 C>T mutation of the TERT promoter. Phosphorus, single stranded guide RNA is provided.

The single-stranded guide RNA may be composed of a nucleotide sequence of SEQ ID NO: 1 ( 5' - GGGGCUGGGAGGGCCCGGAA -3' ) or SEQ ID NO: 2 ( 5'-GGGCUGGGAGGGCCCGGAAG-3' ).

In addition, the present invention provides a method of preparing a single stranded guide RNA, comprising the step of conferring one or more mismatches to a nucleotide sequence complementary to a TERT promoter.

In addition, the present invention provides a DNA targeting method comprising the step of administering the composition for DNA targeting of claim 1 to isolated eukaryotic cells or eukaryotic organisms other than humans.

The single-stranded guide RNA (sgRNA) according to the present invention and the CRISPRi system using the same can selectively and effectively target the point mutation of the TERT promoter and inhibit its activity, -124 C through such epigenetic editing technology Targeting the >T or -146 C>T mutant TERT promoter is expected to be very suitable as a new cancer therapy.

1 is a diagram showing a protospacer sequence targeting a -124 C>T mutant TERT (Telomerase reverse transcriptase) promoter.
Figure 2 shows the results of performing an in vitro DNA cleavage assay for selecting a mutant TERT promoter DNA specific sgRNA.
FIG. 3 is a diagram schematically illustrating a CRISPR interference (CRISPRi) system.
4 is a diagram illustrating a possible combination of dCas9 and epigenetic editors.
5 is a diagram confirming whether the CRISPRi system works through a cell experiment by a reporter assay in a Huh-7.5 liver cancer cell line. (A) 2-1 sgRNA, (B) 2-2 sgRNA.
6 is a view showing the results of confirming the operation of the CRISPRi system in the Huh-7.5 liver cancer cell line and Hep3B liver cancer cell line. The amount of TERT protein expression was confirmed by western blot.
7 is a view confirming cell death by operating the CRISPRi system by performing a cell proliferation assay in the Huh-7.5 liver cancer cell line and the Hep3B liver cancer cell line.
In FIG. 8, (A) is a diagram showing the P19 sites of 2-1 and 2-2 sgRNA. (B) is a diagram showing the results of in vitro DNA cleavage assay using 2-1, 2-2 P19 mutant sgRNA. P19G: 2-1, 2-2 original sgRNA; P19C, P19A, P19U: point mutation sgRNA.
9 is a result confirming whether the CRISPRi system works in the liver cancer cell line (A) Hep3B (wild TERT promoter), (B) Huh-7.5 (-124 C>T mutant TERT promoter). The amount of TERT protein expression was confirmed by western blot. P19G; 2-1, 2-2 original sgRNA; P19C, P19A, P19U: point mutation sgRNA.
10 is a schematic diagram of the genomic structure of adenovirus expressing the CRISPRi system.
11 is a diagram confirming the reduction of TERT gene expression by the adenovirus expressing the CRISPRi system in the hepatic cancer cell lines Hep3B (wild TERT promoter), Huh-7.5 (-124 C>T mutant TERT promoter) at the RNA level. sg2-1: 2-1 original sgRNA; sg2-1 p19: P19C mutant sgRNA.
12 is a diagram confirming cell death induced by adenovirus expressing CRISPRi system in hepatic cancer cell lines Hep3B (wild TERT promoter), Huh-7.5 (-124 C>T mutant TERT promoter) by cell proliferation assay. sg2-1: 2-1 original sgRNA; sg2-1 p19: P19C mutant sgRNA.

Hereinafter, the present invention will be described in detail.

The present invention

A guide RNA comprising a nucleotide sequence complementary to a TERT (Telomerase reverse transcriptase) promoter, or DNA encoding the guide RNA; And

Provided is a composition for DNA targeting, comprising a Cas9 polypeptide or a polynucleotide encoding the same.

As used herein, the term “guide RNA” refers to RNA that is specific to target DNA, capable of complexing with Cas protein, and bringing Cas protein to target DNA.

In the present invention, the guide RNA may be composed of two RNAs, CRISPR RNA (crRNA) and transactivating crRNA (transactivating crRNA, tracrRNA), or a single generated by fusion of essential parts of crRNA and tracrRNA It may be single-chain RNA (sgRNA).

The guide RNA may be dual RNA including crRNA and tracrRNA.

If the guide RNA includes essential parts of crRNA and tracrRNA and complementary parts to the target, any guide RNA can be used in the present invention.

The crRNA can be hybridized with the target DNA.

The guide RNA can be delivered to a cell or organism in the form of RNA or DNA encoding the guide RNA. The guide RNA may be in the form of an isolated RNA, RNA contained in a viral vector, or encoded in a vector. Preferably, the vector may be a viral vector, a plasmid vector, or an agrobacterium vector, but is not limited thereto.

The guide RNA may include a nucleotide sequence complementary to a TERT (Telomerase reverse transcriptase) promoter.

The TERT promoter may include one or more point mutations, and the mutations may be -124 C>T or -146 C>T mutations.

Accordingly, the nucleotide comprises 20 bases complementary to the -124 C>T (chr5, 1,295,228 C>T hg19 coordinate) or -146 C>T (chr5, 1,295,250 C>T hg19 coordinate) mutations of the TERT promoter. It may be a nucleotide.

The nucleotide may preferably include a base complementary to the -124 C>T or -146 C>T mutation at positions 1 to 5 from the 3'end, more preferably SEQ ID NO: 1 ( 5'-GGGGCUGGGAGGGCCCGGAA-3' ) or SEQ ID NO: 2 ( 5'-GGGCUGGGAGGGCCCGGAAG-3' ) may be composed of a base sequence.

As used herein, the term “Cas protein” refers to the essential protein element in the CRISPR/Cas system and will form a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). When it forms an active endonuclease or nickase (nickase).

Cas gene and protein information can be obtained from GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.

The CRISPR-associated (cas) gene encoding the Cas protein is often associated with the CRISPR repeat-spacer array. More than 40 different Cas protein families have been described. Among these protein families, Cas1 seems to be very common (ubiquitous) among different CRISPR/Cas systems. There are three types of CRISPR-Cas systems. Among them, the Type II CRISPR/Cas system involving Cas9 protein and crRNA and tracrRNA is representative and well known. Certain combinations of cas genes and repeat structures have been used to define eight CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube).

The composition of the present invention may include a Cas element in the form of a protein or a nucleic acid encoding a Cas protein.

Preferably, the Cas protein is a Cas9 protein or variant thereof.

The Cas9 protein may be biologically inactivated Cas (dCas).

The Cas9 protein is C-terminal, N-terminal or C-terminal and N-terminal, KRAB (Kruppel associated box), KOX (Kruppel-type zinc finger factor), SID (mSin interaction domain), MBD2 (methyl-CpG One or more domains selected from the group consisting of binding domain protein 2), MBD3, DNMT1 (DNA Methyltransferase 1), DNMT3A (DNA methyltransferase 3A) and DNMT3B (DNA methyltransferase 3B) may be linked. More preferably, the Cas9 protein may be a KRAB domain linked to the N-terminus.

In addition, the present invention is a guide RNA comprising a nucleotide sequence complementary to the TERT (Telomerase reverse transcriptase) promoter; And

It provides a composition for preventing or treating cancer, comprising a Cas9 polypeptide or a polynucleotide encoding the same.

The composition may be a pharmaceutical composition or a food composition.

In the present invention, the cancer may be solid cancer or non-solid cancer. Solid cancer refers to a cancer tumor that has developed in organs such as the liver, lungs, breast, and skin. Non-solid cancer is a cancer that occurs in the blood and is also called blood cancer. The cancer may be carcinoma, sarcoma, hematopoietic cell-derived cancer, germ cell tumor, or blastoma. The carcinoma may be cancer derived from epithelial cells. Sarcoma may be cancer derived from connective tissue (ie, bone, cartilage, fat, and nerves) in which each tissue may originate from cells derived from mesenchymal cells outside the bone marrow. Hematopoietic cell-derived cancers can originate from hematopoietic cells that tend to leave the bone marrow and mature in lymph nodes and blood. The germ cell tumor can be a cancer derived from pluripotent cells. The pluripotent cells can often be present in the testis or ovary. The blastoma can be derived from immature progenitor cells or embryonic tissue. The cancer is pancreatic cancer, biliary tract cancer, neuroendocrine tumor, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, larynx cancer, stomach cancer, bladder cancer, colon cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer , Skin cancer, thyroid cancer, parathyroid cancer and ureter cancer, esophageal cancer, stomach cancer, colon cancer, liver cancer, pancreatic cancer, biliary cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, germ cell tumor, thyroid cancer, ovarian cancer, cervical cancer, endometrial cancer, Lymphoma, myelodysplastic syndromes (MDS), myelofibrosis, acute leukemia, chronic leukemia, multiple myeloma, sarcoma, and skin cancer.

Preferably, the cancer may be liver cancer or skin cancer.

The term "prevention", which is a term used in the present invention, refers to all actions that inhibit cancer or delay the onset of cancer by administration of the pharmaceutical composition. The term "treatment" refers to any act of improving or beneficially altering the symptoms of cancer by administration of the pharmaceutical composition.

In the present invention, the pharmaceutical composition may be used for a method for preventing or treating cancer, and specifically, the method for preventing or treating cancer may include the step of administering to an individual who is or is expected to develop cancer.

The term "administration" of the present invention means introducing the composition to the individual in an appropriate manner.

The term "individual" of the present invention means all animals, such as rats, mice, livestock, including humans, which may or may not develop cancer, and may be, but is not limited to, mammals, including humans.

The composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" of the present invention means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the individual type and severity, age, sex, drug It can be determined according to the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and discharge, the duration of treatment, factors including the drugs used simultaneously, and other factors well known in the medical field. For example, the composition may be administered as an active ingredient at a dose of 0.01 to 500 mg/kg per day, specifically 10 to 100 mg/kg, and the administration may be administered once or several times a day. . In addition, the pharmaceutical composition of the present invention may include the composition of the present invention in an amount of 0.001 to 50% by weight based on the total weight of the composition.

The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered single or multiple. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The pharmaceutical composition for preventing or treating cancer of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent in addition to the active ingredients described above. The carrier, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms, external preparations, suppositories, or sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., according to a conventional method. have. Specifically, when formulated, it may be prepared using diluents or excipients, such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants, which are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. These solid preparations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. In addition, lubricants such as magnesium stearate and talc may be used in addition to simple excipients. In addition to liquids for oral administration and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be added. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin may be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically) according to the desired method, and the dosage may be adjusted according to the patient's condition, weight, or disease. It depends on the degree, drug type, route of administration, and time, but can be appropriately selected by those skilled in the art.

The composition of the present invention can be combined with other anti-cancer agents, radiation therapy, surgical procedures, and can be appropriately selected and combined by those skilled in the art.

In addition, the present invention provides a composition for diagnosing cancer, comprising the composition for DNA targeting.

In addition, the present invention provides an imaging composition for cancer, comprising the composition for DNA targeting.

The term "diagnosis" as used in the present invention means to identify the presence or characteristics of a pathophysiology. Diagnosis in the present invention is to confirm the onset, progress or prognosis of cancer.

The DNA target composition may be combined with a phosphor for molecular imaging to diagnose cancer through imaging.

The molecular imaging phosphor refers to all materials that generate fluorescence, and it is preferable to emit red or near-infrared fluorescence, and a phosphor having a high quantum yield is more preferable, but is not limited thereto. .

The molecular imaging phosphor is preferably a phosphor capable of binding to the DNA target composition, a fluorescent protein, or other imaging material, but is not limited thereto.

The phosphor is preferably, but not limited to, fluorescein, BODYPY, Tetramethylrhodamine, Alexa, Cyanine, allopicocyanine or derivatives thereof. Does not.

The fluorescent protein is preferably, but not limited to, Dronpa protein, fluorescence chromogenic gene (EGFP), red fluorescent protein (DsRFP), cyanine phosphor that exhibits near infrared fluorescence, or other fluorescent protein.

Other imaging materials are preferably iron oxide, radioactive isotopes, etc., but are not limited thereto, and may be applied to imaging equipment such as MR and PET.

In addition, the present invention is a single-stranded guide RNA (sgRNA) comprising a nucleotide sequence complementary to a TERT (Telomerase reverse transcriptase) promoter, comprising a base complementary to a -124 C>T or -146 C>T mutation of the TERT promoter. A single stranded guide RNA is provided, which is 20 nucleotides.

Preferably, the single-stranded guide RNA may be composed of a nucleotide sequence of SEQ ID NO: 1 ( 5' - GGGGCUGGGAGGGCCCGGAA -3' ) or SEQ ID NO: 2 ( 5'-GGGCUGGGAGGGCCCGGAAG-3' ).

In addition, the present invention provides a method of preparing a single stranded guide RNA, comprising the step of conferring one or more mismatches to a nucleotide sequence complementary to a TERT promoter.

In addition, the present invention provides a DNA targeting method comprising the step of administering a composition for DNA targeting according to the present invention to isolated eukaryotic cells or eukaryotic organisms other than humans.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Experimental Example One: TERT reporter with wild / -124 mutant (C>T) promoter plasmid making

To obtain the Wild / -124 mutant (C>T) TERT promoter, genomic DNA was extracted from Hep3B (wild TERT promoter) and Huh-7.5 (-124 (C>T) mutant TERT promoter) cells. After 200 μl of Quick Extract DNA Extraction solution (Epicentre) was added to 1 x 10 ⁶ cells, the mixture was reacted at 65° C. for 6 minutes and then vortexed for 15 seconds. After reacting at 98°C for 2 minutes, genomic DNA was extracted and used as a template for TERT promoter PCR. After mixing 2µl genomic DNA, 5X buffer, 200uM dNTP, 0.2uM forward primer, 0.2uM reverse primer, and 0.4U phusion DNA polymerase (NEB), it is 30 under conditions of 95℃ 30sec, 58℃30sec, 72℃30sec. The cycle was repeated to obtain wild/mutant TERT promoter DNA having a length of 290bp. The obtained TERT promoter DNA was cloned into a pGL3-flrefly luciferase (F.luci) plasmid using an in-fusion HD cloning kit.

Experimental Example 2: In vitro DNA cleavage assay

TERT promoter DNA cleavage was confirmed on an agarose gel with sgRNA targeting the mutant TERT promoter produced by E. coli purified Cas9 protein and in vitro transcription. As the substrate DNA, DNA obtained by linearizing the pGL3-wild/mutant TERT promoter-F.luci vector with a ScaI restriction enzyme was used. After mixing 100ng of Substrate DNA, Cas9 reaction buffer (20mM Tris-HCl, pH 7.5, 150mM KCl, 10mM MgCl ₂ , 1mM DTT), 0.5 pmole Cas9 protein, 1 pmole sgRNA in 10 µl volume and react for 1 hour at 37℃. Ordered. 3X DNA dye containing 250 mM EDTA was added to the reaction solution to stop the reaction, and then the reaction solution was loaded onto a 1% TBE gel to confirm the cleaved DNA by EtBr staining.

Experimental Example 3: Luciferase assay

After culturing 1 x 10 ⁵ Huh-7.5 cells in a 12-well plate, opti-MEM for 50ng pTK-renilla luciferase plasmid, 500ng wild or mutant TERT promoter-firefly luciferase plasmid, 1μg sgRNA expressing plasmid, 500ng dCas9 expressing plasmid The mixture was mixed with the medium to a volume of 50 ul and reacted at room temperature for 5 minutes. At the same time, 2 ug of polyethylenimine (PEI) was mixed with opti-MEM medium to a volume of 100 ul, and then reacted at room temperature for 5 minutes. Each plasmid DNA solution and PEI solution were mixed and reacted at room temperature for 20 minutes. After 20 minutes, the reaction solution was put in each cell and cultured for 6 hours in a CO ₂ incubator. After 6 hours, the culture medium containing plasmid DNA and PEI was removed, replaced with a new culture medium, and cultured in a CO ₂ incubator for 48 hours. After 48 hours, the culture was removed, washed with 1X PBS solution, and 100 μl of passive lysis buffer (Promega) was added, followed by reaction at room temperature for 15 minutes. Cell lysate was transferred to a micro-tube and centrifuged at 13000 rpm for 1 minute. 10 ul of the lysate was measured using a dual-luciferase assay kit (Promega) in a luminometer (Berthold).

Experimental Example 4: Western blot

After culturing 3 x 10 ⁵ Huh-7.5 and Hep3B cells in a 6-well plate, plasmid DNA expressing sgRNA and KRAB-dCas9 was transfected with PEI. 2 μg of pTZ-U6+1-sgRNA plasmid DNA and 1 μg of 3xFlag-KRAB-dCas9 plasmid DNA were mixed with an opti-MEM medium to a volume of 100 μl and reacted at room temperature for 5 minutes. Simultaneously, 2ug of PEI was mixed with opti-MEM medium to a volume of 100 µl, and then reacted at room temperature for 5 minutes. Each plasmid DNA solution and PEI solution were mixed and reacted at room temperature for 20 minutes. After 20 minutes, the reaction solution was put in each cell and cultured for 6 hours in a CO ₂ incubator. After 6 hours, the culture medium containing plasmid DNA and PEI was removed, replaced with a new culture medium, and cultured in a CO ₂ incubator for 48 hours. After 48 hours, remove the culture solution, wash with 1X PBS solution, add 150 μl RIPA buffer (50mM Tris-HCl, pH 8.0, 150mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS) and add 4℃. Was reacted for 20 minutes. The lysed cells were transferred to a 1.5 ml microtube, rotated at 4°C for 30 minutes, centrifuged at 15000 rpm for 15 minutes, and then the supernatant was picked and transferred to a new microtube. After obtaining the total protein quantitative value using the Smart ^TM BCA protein assay kit, 30 μg of total protein was loaded onto 10% SDS-PAGE. Thereafter, transfer was performed with a PVDF membrane, followed by blocking with a blocking solution at room temperature for 1 hour. After replacing with the blocking solution containing the primary antibody, the reaction was carried out at 4°C for 16 hours, and washed 6 times with 5% solution of 0.1% Tween-20 and 1X PBS. Subsequently, it was replaced with a blocking solution containing a secondary antibody for 1 hour at room temperature, washed 6 times for 5 minutes with 0.1% Tween-20, 1X PBS solution, and then the membrane was reacted for 1 minute in an ECL solution and x-ray. After photosensitive to the film, the protein band was identified by dipping in a developer. The antibodies used are as follows. Primary antibodies: Anti-3xFlag antibody (Sigma), anti-human telomerase reverse transcriptase (TERT) (Fitzgerald), anti-tubulin (MBL), secondary antibodies: Goat anti-mouse-HRP conjugated (Santa cruz), Anti- rabbit-HRP conjugated.

Experimental Example 5: TERT Gene RT- PCR

After culturing 3 x 10 ⁵ Hep3B and Huh-7.5 cells in 6-well plates, adenovirus expressing sgRNA and KRAB-dCas9 were infected. Hep3B cells were infected with 10 MOI adenovirus and Huh-7.5 cells were mixed with 100 MOI adenovirus. After 48 hours, the culture solution was removed, washed with 1X PBS solution, and 500 μL TRIZOL reagent was added and reacted at room temperature for 3 minutes. After transferring TRIZOL reagent and cells to a 1.5 ml microtube, add 100 μl chloroform solution, mix by vortexing, react for 5 minutes at room temperature, centrifuge at 4° C. for 10 minutes, pick only the supernatant again Transferred to a microtube. The same amount of isopropanol solution was added and reacted at room temperature for 20 minutes, followed by centrifugation at 4°C for 40 minutes to obtain total RNA precipitate of cells. Quantitative values were obtained after melting the precipitated RNA in DEPC-treated DW. After mixing 500ng of random primer (5'-NNNNNN-3') with dNTP and reverse transcriptase in 5µg of total RNA, the mixture was reacted for 50 minutes at 42℃. 2 µl of cDNA obtained by reverse transcription was used for PCR. cDNA 2µl, 10pmole 5'primer (5'-CATTTCATCAGCAAGTTTGGAAG), 10pmole 3'primer (5'-TTTCAGGATGGAGTAGCAGAGG-3') mixed with 2x SYBR PCR master mix, 95℃ 30sec, 58℃ 30sec, 72℃ 30 Second, 40 cycle conditions were amplified in ABI StepOne Plus real-time PCR instrument.

Experimental Example 6: Cell proliferation assay

After culturing 1×10 ⁴ cells in a 96-well plate, sgRNA and KRAB-dCas9 expressing adenovirus were infected. After 72 hours, 20% of CellTiter 96 Aqueous one solution reagent (MTS, Promega) was added to Opti-MEM 100ul, added to each well, and then incubated in a 37% 5% CO ₂ incubator for 1-4 hours, and absorbance at 490 nm. By measuring the cell viability was confirmed.

Example 1: -124 C>T mutant TERT that can act specifically on promoter DNA sgRNA making

To produce an sgRNA that can target only the mutant TERT promoter in which the -124th of the TERT promoter is C>T mutated, nine protospacer sequences containing the -124th mutation that can be applied to the CRISPR/Cas9 system through sequencing It was selected (Fig. 1).

The nine sgRNAs that have the selected protospacer sequence as a guide sequence are 100% identical to the -124 C>T mutant TERT promoter, but have one mismatch with the wild TERT promoter. 9 mutant TERT promoter target sgRNAs with these characteristics were constructed.

In vitro DNA cleavage assay was performed to confirm that the mutant TERT promoter with -124 C>T mutation specifically works. Of 9 sgRNAs, it was confirmed that sgRNAs 2-1 and 2-2 did not act on the wild TERT promoter and induced -124 C>T mutant TERT promoter specific DNA cleavage (FIG. 2). Through this, it was confirmed that the sgRNAs having the 2-1 and 2-2 protospacers as guide sequences act specifically on the -124 C>T mutant TERT promoter. The 2-1 and 2-2 sgRNA guide sequences are as follows.

2-1: 5'-GGGGCUGGGAGGGCCCGGAA-3'(SEQ ID NO: 1)

2-2: 5'-GGGCUGGGAGGGCCCGGAAG-3'(SEQ ID NO: 2)

Example 2: CRISPRi System creation and optimal combination confirmation

We produced a CRISPRi system that introduced a nuclease-free dead Cas9 (dCas9) and epigenetic editor with a D10A / H840H mutation to target the -124 C>T mutant TERT promoter and suppress the expression of the TERT gene. (Fig. 3). In addition, based on dCas9, various combinations of CRISPRi systems were prepared in which KRAB, an epigenetic editor, and DNA methyltransgerase 3A (DNMT3A) were introduced at the N-terminal/C-terminal (FIG. 4). Then, whether the CRISPRi system composed of the dCas9- epigenetic editor protein and sgRNA works, was confirmed in a cell experiment through a reporter assay (FIG. 5).

As shown in A and B of Fig. 5, the mutant TERT promoter-luciferase reporter value was significantly lower than that of the wild TERT promoter-luciferase reporter by 2-1, 2-2 sgRNA, which is a specific sgRNA of the Mutant TERT promoter, 2- It is confirmed that 1, 2-2 sgRNA effectively reduces luciferase expression. Among various combinations of dCas9- epigenetic editors, the combination of KRAB-dCas9 was found to inhibit the expression of mutant TERT promoter specifically than other dCas9- epigenetic editor combinations, confirming that the combination of KRAB-dCas9 is optimal for the CRISPRi system. .

Example 3: Transient DNA transfection through TERT Decreased gene expression Cell death Induction confirmation

In order to confirm that the CRISPRi system prepared above inhibits endogenous TERT gene expression by acting on the TERT promoter on the chromosome, the TERT protein expression change was measured. Specifically, 2-1, 2-2 sgRNA and KRAB- targeting -124 C>T mutant TERT promoter are targeted to Hep3B liver cancer cell line with wild TERT promoter and Huh-7.5 liver cancer cell line with -124 C>T mutant TERT promoter. After the DNA expressing dCas9 was co-transfected into each cell, the change in the expression level of TERT protein was confirmed (FIG. 6 ).

As shown in FIG. 6, it was confirmed that the TERT protein expression was decreased in the Huh-7.5 cell line having -124 C>T mutant TERT promoter by the introduced CRISPRi system. On the other hand, it was confirmed that the Hep3B cell line carrying the wild TERT promoter did not change the TERT protein. Through the above results, it was confirmed that the CRISPRi system according to the present invention specifically works on the -124 mutant TERT promoter.

In addition, it was confirmed through cell proliferation assay whether cell death can be induced through a decrease in the expression of TERT protein (FIG. 7 ).

As shown in FIG. 7, when 2-2 sgRNA was introduced, it was confirmed that Huh-7.5 cell line induces more cell death than other sgRNAs. On the other hand, it was confirmed that 2-2 sgRNA did not induce cell death in the Hep3B cell line. Through this, it was confirmed that the CRISPRi system of the 2-2 sgRNA and KRAB-dCas9 combination acts on the -124 C>T mutant TERT promoter to induce TERT gene expression inhibition and cell death. The sequence of 2-8 sgRNA used as a control is as follows.

2-8: 5'-GUCCCCGGCCCAGCCCCUUC-3'(SEQ ID NO: 5)

Example 4: sgRNA Through the introduction of point mutations in the guide sequence CRISPRi system optimization

To further optimize the CRISPRi system targeting the -124 C>T mutant TERT promoter, a single base mutation is introduced into P19 (PAM distal region) of the sgRNA guide sequence so that two mismatches are formed in the wild TERT promoter sequence. (Fig. 8A). In addition, it was confirmed whether the activity of mutant sgRNAs is changed through in vitro DNA cleavage using the prepared sgRNAs (FIG. 6B ). The sequence of the sgRNA used is shown below.

2-1: 5'- GGGGCUGGGAGGGCCCGGAA -3' (SEQ ID NO: 1)

2-2: 5'- GGGCUGGGAGGGCCCGGAAG -3' (SEQ ID NO: 2)

2-1 P19: 5'- G C GGCUGGGAGGGCCCGGAA -3' (SEQ ID NO: 3)

2-2 P19: 5'-G C GCUGGGAGGGCCCGGAAG -3' (SEQ ID NO: 4)

(A point mutation of G>C was introduced at the P19 site of each sgRNA, and the mutant sites are indicated by underlining and Bold.)

As shown in Figure 8B, it was confirmed that the prepared mutant sgRNAs induce better DNA cleavage activity than the original sgRNA (Figure 8B).

The mutant sgRNAs were introduced into the Hep3B liver cancer cell line with wild TERT promoter and Huh-7.5 liver cancer cell line with -124 C>T mutant TERT promoter by DNA transfection (Fig. 9).

As shown in Figure 9B, in the case of 2-1 sgRNA, it was confirmed that the sgRNA introducing the P19U mutation in the Huh-7.5 hepatocellular carcinoma cell line having -124 C>T mutant TERT promoter reduced the expression of TERT protein. In the case of 2-2 sgRNA, it was confirmed that the sgRNA introducing the P19C and P19A mutations further reduces the expression of TERT protein than the original 2-2 sgRNA (P19G).

On the other hand, as shown in Figure 9A, 2-1, 2-2 sgRNA in both Hep3B hepatocellular carcinoma cell line having a wild TERT promoter was confirmed that there is no effect on TERT protein expression by the CRISPRi system. Through this, it was confirmed that the CRISPRi system targeting the TERT promoter according to the present invention specifically inhibits the expression of the intrinsic TERT protein by acting specifically on the -124 C>T mutant TERT promoter.

Example 5: Adenovirus Used CRISPRi system verification

The optimized forms identified in the above examples, KRAB-dCas9 and sgRNA targeting the -124 C>T mutant TERT promoter were introduced into the adenovirus vector system to form KRAB-dCas9 and sgRNA in a single adenovirus. Adenovirus was produced (Figure 10). It is an adenovirus expressing sgRNA that introduces a point mutation at the P19 region of 2-1 sgRNA and 2-1, 2-2 sgRNA. Hep3B (wild TERT promoter) and Huh-7.5 (-124 C>T mutant TERT promoter) The liver cancer cell line was infected and the expression level of TERT mRNA was observed (FIG. 11 ).

As shown in Figure 11, it was confirmed that the expression of intracellular TERT mRNA is reduced in the liver cancer cell line by CRISPRi system delivery using the adenovirus expressing the sgRNA and KRAB-dCas9. Specifically, in the Huh-7.5 cell line having a -124 C>T mutant TERT promoter, TERT by adenoviruses expressing sgRNAs targeting the mutant TERT promoter, compared to adenoviruses not expressing sgRNA but only KRAB-dCas9 It was confirmed that the expression of the gene was reduced by 90% or more. On the other hand, the Hep3B cell line with wild TERT promoter was found to have very little reduction effect compared to the Huh-7.5 cell line. Through the above results, it was confirmed that when a mutation is introduced into the guide sequence of the sgRNA, the activity of the sgRNA can be changed.

In addition, a cell proliferation assay was performed to confirm whether cell death can be induced by reducing TERT gene expression (FIG. 12 ).

As shown in Figure 12, it was confirmed that no adenovirus induces cell death in Hep3B with wild TERT promoter. On the other hand, it was confirmed that in the Huh-7.5 cell line having a -124 C>T mutant TERT promoter, 50% of cell death was induced in adenovirus carrying a CRISPRi system expressing 2-2 P19 sgRNA.

Through the above results, the CRISPRi system combining 2-2 P19 sgRNA and KRAB-dCas9 targeting -124 C>T mutant TERT promoter simultaneously inhibited the expression of TERT gene in cancer cells with -124 C>T mutant TERT promoter. It was confirmed that it is the optimal system to induce even cell death. That is, when the CRISPRi system according to the present invention is used, cell-specific treatment is possible by targeting only cancer cells having -124 or -146 C>T mutation of the TERT promoter, and thus can be usefully utilized as a new cancer treatment method.

<110> Industry-Academic Cooperation Foundation, Dankook University <120> CRISPR system specific for TERT promoter mutation and use thereof <130> DANKOOK1-4P-1 <150> KR 10-2017-0172385 <151> 2017-12-14 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 2-1 sgRNA <400> 1 ggggcuggga gggcccggaa 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 2-2 sgRNA <400> 2 gggcugggag ggcccggaag 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 2-1 sgRNA P19 <400> 3 gcggcuggga gggcccggaa 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 2-2 sgRNA P19 <400> 4 gcgcugggag ggcccggaag 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 2-8 sgRNA <400> 5 guccccggcc cagccccuuc 20

Claims (17)

A guide RNA comprising a nucleotide sequence complementary to a -124 C>T mutant Telomerase reverse transcriptase (TERT) promoter, or DNA encoding the guide RNA; And
A composition for inhibiting DNA expression and comprising a DNA target, comprising a Cas9 polypeptide or a polynucleotide encoding the same. The method according to claim 1,
The TERT promoter is a composition comprising at least one point mutation. The method according to claim 1,
The nucleotide is a composition of 20 nucleotides comprising a base complementary to the -124 C>T mutation of the TERT promoter. The composition of claim 3, wherein the nucleotide comprises a base complementary to the -124 C>T mutation of the TERT promoter at the 1 or 2 position from the 3'end. The method according to claim 4, wherein the nucleotide is composed of the nucleotide sequence of SEQ ID NO: 1 (5'-GGGGCUGGGAGGGCCCGGAA-3') or SEQ ID NO: 2 (5'-GGGCUGGGAGGGCCCGGAAG-3'). delete delete The composition according to claim 1, wherein the Cas9 is a biologically inactivated Cas (dCas). The method according to claim 1, wherein the Cas9 polypeptide is C-terminal, N-terminal or C-terminal and N-terminal, KRAB (Kruppel associated box), KOX (Kruppel-type zinc finger factor), SID (mSin interaction domain) , MBD2 (methyl-CpG binding domain protein 2), MBD3, DNMT1 (DNA Methyltransferase 1), DNMT3A (DNA methyltransferase 3A) and one or more domains selected from the group consisting of DNMT3B (DNA methyltransferase 3B), the composition. The composition according to claim 9, wherein the Cas9 polypeptide is a KRAB domain linked to the N-terminus. A composition for preventing or treating cancer, comprising the composition of claim 1. A composition for diagnosis of cancer, comprising the composition of claim 1. An imaging composition for cancer, comprising the composition of claim 1. delete delete delete A method for inhibiting DNA expression and targeting DNA comprising the step of administering the composition for inhibiting DNA expression and targeting DNA of claim 1 to isolated eukaryotic cells or eukaryotic organisms other than humans.

Images