CN116814630A

CN116814630A - Small RNA of Tze Huang for preventing and/or treating nonalcoholic fatty liver, small RNA composition, preparation method and application

Info

Publication number: CN116814630A
Application number: CN202310933809.9A
Authority: CN
Inventors: 王世聪; 于娟; 陈志亮; 郭宏源; 赵晨; 付正; 张辰宇
Original assignee: Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Current assignee: Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Priority date: 2023-07-27
Filing date: 2023-07-27
Publication date: 2023-09-29

Abstract

The invention provides a small RNA and a small RNA composition of a PIANZAIHUANG for preventing and/or treating nonalcoholic fatty liver, and a preparation method and application thereof, and belongs to the technical field of biological medicines. The small RNA is a nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO.2, and the small RNA composition consists of the nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 as components. The 3 small RNAs extracted from the Tze Huang can be effectively absorbed by ingestion and stably exist, and the effect of preventing and/or treating the nonalcoholic fatty liver is exerted. In addition, the composition obtained by combining the 3 small RNAs can effectively inhibit fat accumulation, and has good prevention and/or treatment effects on non-alcoholic fatty liver. The research of the invention discovers that the small RNA which is beneficial to preventing and/or treating the nonalcoholic fatty liver in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG.

Description

Small RNA of Tze Huang for preventing and/or treating nonalcoholic fatty liver, small RNA composition, preparation method and application

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a small RNA and small RNA composition of a PIANZAIHUANG for preventing and/or treating nonalcoholic fatty liver, a preparation method and application thereof.

Background

Non-alcoholic fatty liver disease (NAFLD) refers to a clinical pathological syndrome characterized mainly by excessive deposition of intracellular fat in liver cells, except for alcohol and other clear liver-damaging factors, and acquired metabolic stress liver injury closely related to insulin resistance and genetic susceptibility. Including Simple Fatty Liver (SFL), nonalcoholic steatohepatitis (NASH) and related liver cirrhosis. Along with the global epidemic trend of obesity and related metabolic syndrome, the non-alcoholic fatty liver disease has become an important cause of chronic liver disease in developed countries such as Europe and America and rich areas of China, and seriously threatens the physical and mental health of human beings.

Patent application with publication number of CN104042655A discloses that the Tze Huang and its preparation can be used for treating non-alcoholic fatty liver disease with excellent effect. The PIANZAIHUANG prescription is a national confidential prescription, is mainly prepared from various rare traditional Chinese medicines such as pseudo-ginseng, snake gall, bezoar, musk and the like, and has multiple functions of protecting liver cells, regulating liver lipid metabolism, reducing collagen deposition, relieving inflammatory reaction and the like. The Tze Huang has the advantages of wide pharmacological action, obvious curative effect, small toxic and side effects, multi-level and multi-target spot focusing on overall regulation, and is widely applied to protecting liver. However, the mechanism of the action of the Pianzaihuang is not clear.

Small RNA (sRNA) refers to a class of non-coding RNA molecules, including micro RNA (miRNA), small interference RNA (siRNA), piwi-interacting RNA (piRNA), typically below 200nt in length. The small RNA can regulate gene expression at the posttranscriptional level and plays an important role in physiological and pathological processes. Recently, research has found that small RNA in part of traditional Chinese medicines can enter blood and tissue organs of a human body through alimentary canal and play an important role in disease treatment. For example, MIR2911 in the honeysuckle decoction can enter the body of a mouse in a gastric feeding way, and can directly act on influenza virus. These findings suggest that the small RNA of the traditional Chinese medicine can be taken orally as a novel traditional Chinese medicine active ingredient which is ignored for a long time and can be absorbed through the alimentary canal to reach the target organ to exert the therapeutic value.

Disclosure of Invention

The invention aims to provide a small RNA and a small RNA composition of a PIANZAIHUANG for preventing and/or treating nonalcoholic fatty liver, and a preparation method and application thereof.

The invention provides a small RNA for preventing and/or treating non-alcoholic fatty liver disease, which is a nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO. 2.

The invention also provides application of the small RNA nucleotide sequence shown in any one of SEQ ID NO. 1-3 in preparing a medicament for preventing and/or treating non-alcoholic fatty liver disease;

preferably, the drug is a drug that inhibits fat accumulation;

and/or, the agent is an agent that inhibits TG, ALT, AST levels;

and/or the medicament is a medicament for inhibiting the expression level of FFA and ROS.

Further, the medicine prepared by the nucleotide sequence shown in SEQ ID NO.1 is a medicine for inhibiting PPARA gene expression;

and/or the medicine prepared by the nucleotide sequence shown in SEQ ID NO.2 is a medicine for inhibiting HNF4A gene expression;

and/or the medicine prepared by the nucleotide sequence shown in SEQ ID NO.3 is a medicine for inhibiting the expression of PCK1 genes and G6PC genes.

The invention also provides a small RNA composition for preventing and/or treating the non-alcoholic fatty liver disease, which consists of the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 as components.

Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 40-80%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 10-40%; the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 10-30%.

Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 66-67%, and the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 20%; the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 13-14%.

Further, the molar ratio of the nucleotide sequences shown in SEQ ID NO. 1-3 is 1:0.3:0.2.

The invention also provides a preparation method of the small RNA composition, which comprises the following steps:

mixing the nucleotide sequences shown in SEQ ID NO. 1-3.

The invention also provides application of the small RNA composition in preparing a medicament for preventing and/or treating the non-alcoholic fatty liver disease;

preferably, the drug is a drug that inhibits PCK1, G6PC, PPARA, HNF a gene expression.

Further, the medicament is a medicament for inhibiting fat accumulation;

and/or, the agent is an agent that inhibits TG, ALT, AST levels;

The invention also provides a medicine for preventing and/or treating the nonalcoholic fatty liver, which is a preparation prepared by taking the small RNA or the small RNA composition as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.

Compared with the prior art, the invention has the beneficial effects that:

the invention extracts 3 kinds of small RNA from traditional Chinese patent medicine PIANZAIHUANG, and the 3 kinds of small RNA can respectively inhibit genes related to the occurrence and development of nonalcoholic fatty liver, so that the invention can play a role in preventing and/or treating nonalcoholic fatty liver. In addition, the composition obtained by combining the 3 small RNAs can effectively inhibit fat accumulation, and has good prevention and/or treatment effects on non-alcoholic fatty liver. Meanwhile, the sRNA can be effectively absorbed by ingestion, and can exist stably, so that the sRNA is convenient and effective to use. The sRNA can also be used as a marker for quality control of the Tze Huang, and the Tze Huang with high sRNA content has better effect of preventing and/or treating the nonalcoholic fatty liver. The research of the invention discovers that the small RNA which is beneficial to preventing and/or treating the nonalcoholic fatty liver in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 is a flow chart of a small RNA high throughput sequencing experiment.

FIG. 2 shows Solexa sequencing to obtain the small RNA copy number of the Pianzaihuang.

Fig. 3 shows the distribution of small RNAs of each bolus in serum.

Fig. 4 shows the distribution of small RNAs of each bolus in the liver.

FIG. 5 shows the binding result of PTH-sRNA-37 to mRNA of PCK1 gene.

FIG. 6 shows the binding results of PTH-sRNA-37 to mRNA of G6PC gene.

FIG. 7 shows the binding results of PTH-sRNA-6 to PPARA gene mRNA.

FIG. 8 shows the binding result of PTH-sRNA-24 to HNF4A gene mRNA.

Fig. 9 shows the binding ability of small RNA of small bolus to target site through luciferase reporter assay.

Fig. 10 shows TG level detection results.

FIG. 11 shows the results of biochemical blood index detection.

Fig. 12 is liver FFA and ROS level detection.

Fig. 13 is a scale bar of H & E staining and oil red O staining of mouse livers: 100 μm.

Detailed Description

The materials and equipment used in the embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

The Tze Huang used in the invention is provided by Zhangzhou Tze Huang pharmaceutical industry Co., ltd.

In the invention, the total RNA of the Tze Huang is firstly extracted in the early-stage research, and then the total RNA is subjected to small RNA high-throughput sequencing; and then, carrying out intragastric bolus on the mice, extracting RNA from the serum of the mice, carrying out high-throughput sequencing on the small RNA, screening the small RNA with the drug source of the bolus, and selecting the small RNA with the copy number of more than 100 for research, so that the invention finally discovers that 3 kinds of the small RNA are related to the nonalcoholic fatty liver.

Example 1 verification of Small RNAs in Pianzaihuang

1. Extraction of total RNA in Pianzaihuang

Taking a proper amount of the Tze Huang, grinding the Tze Huang into 100 meshes of powder at normal temperature or low temperature, total RNA from the samples was extracted with Trizol reagent. The specific method comprises the following steps:

1) Grinding Tze Huang into powder by using a low-temperature grinder, weighing 50mg, putting into a 1.5ml centrifuge tube, adding 1ml of trizol vortex, and standing on ice for 10min;

2) Adding 200 μl of chloroform, shaking vigorously to mix them, and standing for 5min;

3) Centrifuging at 4deg.C and 14000g for 20min;

4) Sucking the supernatant into a new 1.5ml centrifuge tube, adding isopropanol with the volume of 1-2 times of the supernatant, uniformly mixing, and then placing into a-20 ℃ for precipitation for more than 1 hour;

5) Centrifuging at 4deg.C and 14000g for 20min;

6) Discarding the supernatant precipitate, adding 1ml of 75% alcohol prepared with DEPC water, and blowing;

7) Centrifuging at 4deg.C and 14000g for 20min;

8) Discarding the supernatant, inverting a 1.5ml centrifuge tube, and airing the alcohol for about 5-10min;

9) Dissolving in DEPC water, and preserving at-80deg.C.

2. Detection of the content of 3 kinds of small RNAs in the invention

After total RNA extraction of the Pianzaihuang, the Pianzaihuang can be detected by high-throughput sequencing technology, reverse transcription PCR (RT-PCR), real-time fluorescence quantitative PCR (qPCR), RNA chip, northern blotting, in situ hybridization and other technologies. The specific method of the embodiment is as follows:

extracting total RNA from Tze Huang, performing PAGE electrophoresis to recover 18-45nt RNA molecule, adding 3' joint, adding RT primer with UMI into the system, and performing reverse transcription extension to synthesize cDNA chain. The 3 small RNA sequences and the content of the invention are detected by a small RNA high-throughput sequencing technology (the experimental flow is shown in figure 1) (table 1). The RT primer with UMI is supplied by sequencing company (Shenzhen megagene Co., ltd.).

TABLE 1 names and sequences of small RNAs

The 3 small RNA copies are shown in FIG. 2. From table 1 and fig. 2, it can be seen that the 3 small RNAs of the invention are higher in the anti-inflammatory agent.

The beneficial effects of the present invention are demonstrated by specific test examples below.

Test example 1 stability study of the small RNA of Pianzaihuang of the invention into the body by ingestion

1. Experimental method

And detecting small RNA of the Pianzaihuang which enters the animal body through ingestion and exists stably by using an RT-qPCR method. Male C57 mice were randomly divided into PBS control group, single administration group of PIANZAIHUANG, and multiple administration group of PIANZAIHUANG. After 12h of fasted food, the Tze Huang is ground into 100-mesh powder, and then is prepared into suspension by PBS for gastric administration. The single administration group is only administrated by intragastric administration once, and the multiple administration group is administrated by intragastric administration once every 3 hours for three times. The dosage of the bolus for each time is 0.1g/100g. The PBS control group was perfused with an equivalent dose of PBS. After the last gastric lavage is finished for 6 hours, blood of the mice is taken to separate serum, and liver tissues are taken. RNA was extracted from serum and liver tissues, and the small RNA content (PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37) of each Pitaze Huang was detected by Real-time PCR. Primers for reverse transcription PCR and qPCR detection of small RNA of Pitahuang are shown in Table 2.

TABLE 2 reverse transcription PCR and qPCR detection primer list

Reverse transcription (10 μl) of sRNA of Pitahuang was performed using the system shown in Table 3.

TABLE 3 sRNA reverse transcription reaction System

After the system is prepared, the mixture is evenly mixed and put into a PCR instrument for reaction, and the reaction procedure is shown in Table 4.

TABLE 4 reverse transcription procedure for sRNA

After the reverse transcription is completed, quantitative detection is performed by using qPCR primers. qPCR system is shown in Table 5 and reaction procedure is shown in Table 6.

TABLE 5 sRNA fluorescent quantitative PCR reaction System

TABLE 6 fluorescent quantitative PCR reaction procedure

2. Experimental results

The results of the relative concentrations of the three small RNAs in the Tze Huang in serum and liver tissues are shown in the figures 3 and 4: the results show that the small RNA of the 3 Tze Huang can be absorbed through the alimentary canal and reach the serum and liver tissues. Experimental results show that the sRNA of the 3 anti-inflammatory and analgesic bolus of the invention can enter animals through ingestion and exist stably.

Test example 2 bioinformatics means analysis of the binding of small RNA of Pianzaihuang to target Gene

1. Experimental method

Whether the small RNA of the Pianzaihuang can be combined with PCK1 and G6PC, PPARA, HNF A target genes or not is studied, and the therapeutic value of the small RNA on the non-alcoholic fatty liver disease is exerted by inhibiting the expression of target genes. And analyzing the combination of the 3 small RNAs of the Pianzaihuang and the target genes of PCK1 and G6PC, PPARA, HNF A by using a bioinformatics means (RNA hybrid).

2. Experimental results

The binding capacity of PTH-sRNA-37 to the mRNA of the PCK1 gene is shown in FIG. 5, which illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-37 to the mRNA of the PCK1 gene. Among them, PTH-sRNA-37 has 4 binding modes with PCK 1.

The binding capacity of PTH-sRNA-37 to the mRNA of the G6PC gene is shown in FIG. 6, which illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-37 to the mRNA of the G6PC gene. There are 4 ways in which PTH-sRNA-37 binds to G6 PC.

The binding capacity of PTH-sRNA-6 to PPARA gene mRNA is shown in FIG. 7, which illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-6 to PPARA gene mRNA. There is 1 binding mode between PTH-sRNA-6 and PPARA.

The binding capacity of PTH-sRNA-24 to HNF4A gene mRNA is shown in FIG. 8, which illustrates the binding pattern, binding site and free energy of binding of PTH-sRNA-24 to HNF4A gene mRNA. There are 3 ways in which PTH-sRNA-24 binds to HNF 4A.

It is thought that the minimum free energy (mfe) is smaller than-20 and has an inhibitory effect, so that these 3 kinds of small RNAs have the function of specifically binding to mRNA of PCK1 and G6PC, PPARA, HNF A target genes and inhibiting gene expression according to the shown analysis result.

PCK1, G6PC, PPARA, HNF a genes play a role in promoting the development and progression of nonalcoholic fatty liver, PCK1 and G6PC are two key enzymes for de novo synthesis of glucose, a pathway extremely important in the progression of nonalcoholic fatty liver, inhibition of PPARA expression activates lipid oxidation to alleviate liver steatosis, HNF4A is a key transcription factor, and control of steatosis in the liver by regulating lipid catabolism. Thus, inhibition of the PCK1, G6PC, PPARA, HNF a genes can exert therapeutic effects on non-alcoholic fatty liver disease.

PTH-sRNA-6 can inhibit PPARA gene, PTH-sRNA-24 can inhibit HNF4A gene, PTH-sRNA-37 can inhibit PCK1 gene and G6PC gene, and PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 can be used for preventing and/or treating nonalcoholic fatty liver. The combination of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 can inhibit the expression of four genes of PCK1 and G6PC, PPARA, HNF A at the same time, and further play a role in preventing and/or treating non-alcoholic fatty liver.

Test example 3 inhibition effect of small RNA of Pianzaihuang on target Gene

1. Experimental method

The three small RNAs of the Pitaze Huang, namely PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37, are obtained from Pitaze Huang by adopting the method described in the embodiment 1, and can be directly synthesized by adopting a conventional technology.

The inhibition effect of the small RNA of the Pianzaihuang on the target gene is proved by a luciferase report experiment:

segment sequence fragments of PCK1, G6PC, PPARA, HNF4A target genes and three small RNAs of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 are respectively inserted into pMIR-REPORT Luciferase plasmids, so as to construct luciferase reporting plasmids of the genes. Positive clones were screened and sequenced for verification, clones were amplified and plasmids were purified.

Segment sequence fragments of PCK1 target gene binding to small RNAs:

ACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCCCACCTGCCTGACC

GCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTGC

TCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGG

AGGAAGGGTGGCTGGCAGAGCACATGCTGATTCTGGGTATAACCAACCCTGAGGGTGAGAAGA(SEQ ID NO.13)

segment sequence fragments of G6PC target gene binding to small RNAs:

TTCGCTTACCAGCCTCCTGTCGGATACAGAAGAGCAAGCCCAGGCTAG

AGATCCCAACTGAGAATGCTCTTGCGGTGCAGAATCTTCCGGCTGGGA

AAAGGAAAAGAGCACCATGCATTTGCCAGGAAGAGAAAGAAGGATCAGGAGGAGGGAGAGTGTTTTATG(SEQ ID NO.14)

segment sequence fragments of PPARA target genes binding to small RNAs:

GTCTTCATAGCCTGGGCTGGGTGGGAGCCAGTCACCCTGCGGATCGAG

AGAGGGGGTAGAGTCTTCTTCAAATGGCAGTTTTACTTCAAATGGCAGA

TTTCACAAGAGTTGGTTATTTTTTACAATGGTTTAGGTTGTTAAGTCTCCTTTGTATGTAAGGTAGTTTTT(SEQ ID NO.15)

segment sequence fragments of HNF4A target gene binding to small RNAs:

ACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGATGACAATGAGT

ATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCT

GAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTACATCAACGACCGCCA(SEQ ID NO.16)

the relevant cells are cultured and inoculated in a 24-well plate, and after 12-16 hours, the luciferase expression plasmid carrying the predicted target gene to be detected and the small RNA plasmids of Pitazahuang (three sRNA of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37) are co-transfected into the cells. After 24 hours, the cells were collected and lysed, and luciferase substrate was added and luciferase reacted with the substrate to produce luciferin. The activity of luciferase can be measured by detecting the intensity of fluorescence and compared with the transfected nonsense small RNA group, so that whether the predicted target spot can be inhibited by the small RNA of the Tze Huang or not is judged. Nonsense small RNAs are nonsensical small RNA sequences that do not bind to the target gene.

Nonsense small RNA sequence: GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 17).

2. Experimental results

The segment sequence fragments of PCK1, G6PC, PPARA, HNF A target genes and small RNA of Pianzaihuang are respectively inserted into pMIR-REPORT Luciferase plasmid to construct luciferase reporter plasmids of the genes. The report experimental result of luciferase shows (figure 9) that the 3 small RNA compositions of the invention have inhibition effect on four target genes of PCK1 and G6PC, PPARA, HNF A. And the nonsense small RNA has no inhibition effect on the four target genes.

Test example 4, cell level verification of inhibition of fat accumulation by sRNA of Pianzaihuang

1. Experimental method

The three small RNAs of the Pianzaihuang are directly synthesized by adopting the conventional technology.

HepG2 cells were transformed according to 2×10 ⁶ Cells/well were plated in 6-well plates. When HepG-2 cells reached 70% density, FFA was added to induce lipid droplet accumulation (FFA dose 1mmol FFA/well) while Tze was added (consisting of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 in a molar ratio of 1:0.3:0.2), tze sRNA dose 0.16nmol/g, and TG levels were detected after 24 hours incubation. Simultaneously setting a norm group and a control group, wherein the normol group is cells which are not induced by FFA and are not interfered by the sRNA of the Tze Huang, and the control group is cells which are induced by FFA and are used for establishing a non-alcoholic fatty liver cell model, and the sRNA of the Tze Huang is not interfered.

The Scramble RNA is nonsensical small RNA, and the sequence is shown as SEQ ID NO. 17.

2. Experimental results

The results showed (fig. 10) that cells were FFA-induced and TG levels were significantly elevated, but TG levels were inhibited after sRNA treatment with bolus. Therefore, the sRNA of the Pianzaihuang plays an important role in the process of inhibiting fat accumulation.

Test example 5 construction of non-alcoholic liver injury model and administration of treatment

1. Experimental method

(1) Construction of a non-alcoholic liver injury model:

male SD rats of 6 weeks of age were prepared and weighing 180+ -20 g, and the rats were divided into a normal group, a model group and a treatment group. Normal rats were fed normal diet (norm), model group (control) and dosing group (pthsrna) rats were fed high fat diet. After 8 weeks of continuous feeding, the rats in the dosing group were perfused with a mixture of 3 sRNAs (consisting of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 in a molar ratio of 1:0.3:0.2 and suspended in DEPC in water) at a dose of 0.16nmol/g for 1 treatment per day for 10 times and the remaining two groups were unchanged. During which the animals were fed water freely and kept in clean laboratory.

After 2 weeks, the rats were sacrificed and serum was isolated from whole blood to detect blood biochemical indicators. Simultaneously, the liver at the same part is fixed in 4% paraformaldehyde, and the rest liver is frozen and stored in a refrigerator at-80 ℃ for standby.

2. Experimental results

The results of blood biochemical index showed (fig. 11) that model group ALT, AST, TG levels were dramatically increased compared to the normal group, while the blood biochemical index was inhibited in the bolus sRNA administration group (PTH sRNA).

After that, FFA and ROS levels in rat livers are detected, abnormal fat metabolism, oxidative stress and lipid peroxidation can promote abnormal fat accumulation of livers, and free fatty acids and active oxygen can be abnormally increased in the process. Liver FFA and ROS detection results indicate (fig. 12) that rat liver FFA and ROS levels in the model group were dramatically increased compared to the normal group, while administration of the sRNA for the anti-inflammatory agent inhibited this increase.

HE staining indicated that the morphology and structure of liver tissue of normal group rats was normal; and obvious steatosis appears in the liver of the model group, the liver cells are swollen and round, the volume is obviously higher than that of the normal group, and a large amount of fat vacuoles exist in cytoplasm. And through the sRNA treatment of the Tze Huang, the fatty vacuole and saccule-like change of the liver of the NAFLD rat are improved. The results of oil red O staining showed (FIG. 13) that the normal liver tissue had few lipid droplets and the model liver tissue had a large accumulation of lipid droplets, indicating that the lipid droplets infiltrated the hepatocytes and fused into fragments. Lipid droplets were also deposited in liver tissue of rats in the treatment group, but to a significantly lower extent than in the model group.

In conclusion, 3 kinds of small RNAs are extracted from the traditional Chinese patent medicine Pianzaihuang, and the 3 kinds of small RNAs can respectively inhibit genes related to the occurrence and development of the non-alcoholic fatty liver, so that the invention can play a role in preventing and/or treating the non-alcoholic fatty liver. In addition, the composition obtained by combining the 3 small RNAs can effectively inhibit fat accumulation, and has good prevention and/or treatment effects on non-alcoholic fatty liver. Meanwhile, the sRNA can be effectively absorbed by ingestion, and can exist stably, so that the sRNA is convenient and effective to use. The sRNA can also be used as a marker for quality control of the Tze Huang, and the Tze Huang with high sRNA content has better effect of preventing and/or treating the nonalcoholic fatty liver. The research of the invention discovers that the small RNA which is beneficial to preventing and/or treating the nonalcoholic fatty liver in the PIANZAIHUANG has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.

Claims

1. A small RNA for preventing and/or treating non-alcoholic fatty liver disease, characterized in that: it is a nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO. 2.

Use of a microrna nucleotide sequence as set forth in any one of seq ID nos. 1 to 3 in the preparation of a medicament for the prevention and/or treatment of non-alcoholic fatty liver disease;

preferably, the drug is a drug that inhibits fat accumulation;

and/or, the agent is an agent that inhibits TG, ALT, AST levels;

3. Use according to claim 2, characterized in that: the medicine prepared by the nucleotide sequence shown in SEQ ID NO.1 is a medicine for inhibiting PPARA gene expression;

4. A small RNA composition for preventing and/or treating non-alcoholic fatty liver disease, characterized in that: it is composed of the nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 as components.

5. The small RNA composition of claim 4, wherein: the mol percentage of the nucleotide sequence shown in SEQ ID NO.1 is 40-80%, and the mol percentage of the nucleotide sequence shown in SEQ ID NO.2 is 10-40%; the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 10-30%.

6. The small RNA composition of claim 5, wherein: the mol percentage of the nucleotide sequence shown in SEQ ID NO.1 is 66-67%, and the mol percentage of the nucleotide sequence shown in SEQ ID NO.2 is 20%; the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 13-14%.

7. The small RNA composition of any one of claims 4 to 6, wherein: the mol ratio of the nucleotide sequences shown in SEQ ID NO. 1-3 is 1:0.3:0.2.

8. The method for producing a small RNA composition of any one of claims 4 to 7, wherein: it comprises the following steps:

mixing the nucleotide sequences shown in SEQ ID NO. 1-3.

9. Use of the small RNA composition of any one of claims 4 to 7 for the preparation of a medicament for the prevention and/or treatment of non-alcoholic fatty liver disease;

10. Use according to claim 9, characterized in that: the medicine is a medicine for inhibiting fat accumulation;

and/or, the agent is an agent that inhibits TG, ALT, AST levels;

11. A medicament for preventing and/or treating non-alcoholic fatty liver disease, characterized in that: the preparation is prepared by taking the small RNA as claimed in claim 1 or the small RNA composition as claimed in any one of claims 4 to 7 as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.