CN116751782A - Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application - Google Patents

Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application Download PDF

Info

Publication number
CN116751782A
CN116751782A CN202310933804.6A CN202310933804A CN116751782A CN 116751782 A CN116751782 A CN 116751782A CN 202310933804 A CN202310933804 A CN 202310933804A CN 116751782 A CN116751782 A CN 116751782A
Authority
CN
China
Prior art keywords
seq
nucleotide sequence
sequence shown
mol
mol percent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310933804.6A
Other languages
Chinese (zh)
Inventor
张辰宇
林丽敏
郭宏源
翁主清
苏媛媛
付正
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Original Assignee
Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhangzhou Pientzehuang Pharmaceutical Co Ltd filed Critical Zhangzhou Pientzehuang Pharmaceutical Co Ltd
Priority to CN202310933804.6A priority Critical patent/CN116751782A/en
Publication of CN116751782A publication Critical patent/CN116751782A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/14—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (1.14.14)
    • C12Y114/14001—Unspecific monooxygenase (1.14.14.1)

Abstract

The invention provides a small RNA and a small RNA composition of a PIANZAIHUANG for preventing and/or treating alcoholic liver injury, and a preparation method and application thereof, and belongs to the technical field of biological medicines. The small RNA of the invention is a nucleotide sequence shown in any one of SEQ ID NO. 1-3, SEQ ID NO.6, SEQ ID NO. 8-16, SEQ ID NO. 18-31 and SEQ ID NO.33, and the small RNA composition is composed of the nucleotide sequences shown in SEQ ID NO. 1-33 as components. The 33 kinds of small RNAs extracted from the Tze Huang can be effectively absorbed by ingestion and stably exist, so that the efficacy of preventing and/or treating alcoholic liver injury is exerted; and, the composition obtained by combining these 33 kinds of small RNAs has a preventive and therapeutic effect on alcoholic liver injury. The 33 small RNAs can also be used as markers for quality control of the Pianzaihuang. The research of the invention discovers that the small RNA in the PIANZAIHUANG is beneficial to preventing and treating alcoholic liver injury, which has important significance for further research and development and quality control of the PIANZAIHUANG.

Description

Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a small RNA and small RNA composition of a PIANZAIHUANG for preventing and/or treating alcoholic liver injury, a preparation method and application thereof.
Background
Alcoholic liver injury is a toxic liver disease caused by long-term high-volume drinking, and is the second largest liver disease in China, which is next to viral hepatitis. According to the degree of alcohol damage to liver, alcoholic liver damage can be divided into three phases, namely alcoholic fatty liver in the first phase, alcoholic hepatitis in the second phase and alcoholic liver cirrhosis in the third phase, and finally, the alcoholic liver injury can be possibly converted into liver cancer. At present, the treatment effect of chemical drugs on alcoholic liver injury is not ideal, and most of chemical drugs adopt a treatment mode which mainly takes abstinence and auxiliary nutrition support treatment, but often are influenced by bad psychological emotion, living habit and the like of patients, and the expected treatment effect cannot be achieved.
In order to solve the problems, the patent application with the publication number of CN104042656A utilizes the Tze Huang and the preparation thereof to treat alcoholic liver injury, thereby improving the effective rate and reducing the side effects. The formula of the PIANZAIHUANG is classified as the national standard, and is mainly prepared by refining various rare traditional Chinese medicines such as pseudo-ginseng, snake gall, bezoar, musk and the like, and has multiple functions of protecting liver cells, regulating liver lipid metabolism, reducing collagen deposition, relieving inflammatory reaction and the like. The formula of the traditional Chinese medicine composition is very consistent with traditional Chinese medicine treatment methods such as clearing heat, removing blood stasis, resolving masses and the like in liver diseases, and the medicine effect of the multi-way is likely to be related to the multi-component and multi-target-point action modes of traditional Chinese medicines. However, the mechanism of preventing and treating alcoholic liver injury of the Pianzaihuang is not clear.
Small RNA (sRNA) refers to a class of non-coding RNA molecules, including micro RNA (miRNA), small interference RNA (siRNA), piwi-interacting RNA (piRNA), typically below 200nt in length. The small RNA regulates and expresses at the level after transcription such as eukaryotic cell differentiation, proliferation and apoptosis, and has close relation with physiological and pathological processes such as organism metabolism, immunity, and the like. The sRNA has the characteristics of small molecular weight, mobility, more accurate targeting and the like, and is developed in the field of medicaments. The research shows that sRNA in partial Chinese medicine can be absorbed stably into body to exert its specific pharmacological action, such as small RNA in honeysuckle, has the capacity of inhibiting the replication of H5N1 and SARS-CoV-2 virus, and provides one new research direction for medicine research and development, chinese medicine quality control, etc. If sRNA for preventing and treating alcoholic liver injury can be found in the Pianzaihuang, the Pianzaihuang is certainly favorable for research and development and quality control of the Pianzaihuang.
Disclosure of Invention
The invention aims to provide a small RNA and a small RNA composition of a PIANZAIHUANG for preventing and/or treating alcoholic liver injury, and a preparation method and application thereof.
The invention provides a small RNA for preventing and/or treating alcoholic liver injury, which is a nucleotide sequence shown in any one of SEQ ID NO. 1-3, SEQ ID NO.6, SEQ ID NO. 8-16, SEQ ID NO. 18-31 and SEQ ID NO. 33.
The invention also provides application of the small RNA nucleotide sequence shown in any one of SEQ ID NO. 1-33 in preparing a medicament for preventing and/or treating alcoholic liver injury;
preferably, the drug is a drug that inhibits CYP2E1 gene expression.
Further, the medicine is a medicine for increasing the content of superoxide dismutase; and/or, the drug is a drug for reducing the content of malondialdehyde; and/or the medicament is a medicament for reducing ALT, AST, TBIL and LDH content in serum.
The invention also provides a small RNA composition for preventing and/or treating alcoholic liver injury, which consists of nucleotide sequences shown as SEQ ID NO. 1-33 as components.
Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 7-10%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 6 to 10 percent,
the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 4-10%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.7 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.8 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.9 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.10 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.11 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.12 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.13 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.14 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.15 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.16 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.17 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.18 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.19 is 1-7%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.20 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.21 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.22 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.23 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.24 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.25 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.26 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.27 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.28 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.29 is 0.5 to 6 percent,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.30 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.31 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.32 is 0.5-6%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.33 is 0.5-6%.
Further, the mol percent of the nucleotide sequence shown in SEQ ID NO.1 is 9-10%, the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 8-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 5 to 6 percent,
the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 4-5%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.5 is 4-5%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.6 is 4-5%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.7 is 4-5%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.8 is 3-4%;
the mol percent of the nucleotide sequence shown in SEQ ID NO.9 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.10 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.11 is 3-4%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.12 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.13 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.14 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.15 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.16 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.17 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.18 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.19 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.20 is 2-3%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.21 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.22 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.23 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.24 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.25 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.26 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.27 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.28 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.29 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.30 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.31 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.32 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.33 is 1-2%.
Further, the molar ratio of the nucleotide sequences shown in SEQ ID NOS.1 to 33 is 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17.
the invention also provides a preparation method of the small RNA composition, which comprises the following steps:
mixing the nucleotide sequences shown in SEQ ID NO. 1-33 to obtain the polypeptide.
The invention also provides application of the small RNA composition in preparing a medicament for preventing and/or treating alcoholic liver injury;
preferably, the drug is a drug that inhibits CYP2E1 gene expression.
Further, the medicine is a medicine for increasing the content of superoxide dismutase; and/or, the drug is a drug for reducing the content of malondialdehyde; and/or the medicament is a medicament for reducing ALT, AST, TBIL and LDH content in serum.
The invention also provides a medicine for preventing and/or treating alcoholic liver injury, which is a preparation prepared by taking the small RNA or the small RNA composition as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.
Compared with the prior art, the invention has the beneficial effects that:
according to the invention, 33 kinds of small RNAs are extracted from the traditional Chinese patent medicine Pianzaihuang, and the 33 kinds of small RNAs can play roles in preventing and/or treating alcoholic liver injury; and, the composition obtained by combining these 33 kinds of small RNAs has a preventive and therapeutic effect on alcoholic liver injury. Meanwhile, 33 kinds of small RNAs can be effectively absorbed through ingestion, exist stably and are convenient and effective to use. The 33 small RNAs can also be used as markers to control the quality of the Pianzaihuang, and the Pianzaihuang with high content of the 33 small RNAs has better effect of preventing and treating alcoholic liver injury. The research of the invention discovers that the small RNA in the PIANZAIHUANG is beneficial to preventing and treating alcoholic liver injury, which has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.
It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.
Drawings
FIG. 1 is a flow chart of a small RNA high throughput sequencing experiment.
Fig. 2 shows the absorption verification of the anti-inflammatory agent-derived small RNA in the serum.
FIG. 3 shows the concentration of small RNA of the anti-inflammatory agent in serum.
Fig. 4 shows the concentration of small RNA of the inventive bolus in the liver.
Fig. 5 shows the binding ability of small RNA of bolus to target site through luciferase reporter assay.
FIG. 6 is a graph showing the detection of SOD and MDA levels in the liver.
Fig. 7 is a scale bar of liver H & E staining and oil red O staining: 100 μm.
FIG. 8 shows biochemical marker detection of blood.
FIG. 9 is Western blot analysis of mouse liver CYP2E 1.
FIG. 10 shows the detection of mouse liver SOD activity and MDA level.
Fig. 11 is a scale bar of H & E staining and oil red O staining of mouse livers: 100 μm.
Detailed Description
The materials and equipment used in the embodiments of the present invention are all known products and are obtained by purchasing commercially available products.
The Tze Huang used in the invention is provided by Zhangzhou Tze Huang pharmaceutical industry Co., ltd.
In the invention, the total RNA of the Tze Huang is firstly extracted in the early-stage research, and then the total RNA is subjected to small RNA high-throughput sequencing; and then, carrying out intragastric bolus on the mice, carrying out high-throughput sequencing on small RNA extracted from serum of the mice, screening small RNA with the drug source of the bolus, and selecting small RNA with the copy number of more than 100 for research, and finally, finding that 33 small RNA are related to alcoholic liver injury.
Example 1 verification of 33 Small RNAs of the invention in Pianzaihuang
1. Extraction of total RNA in Pianzaihuang
Taking a proper amount of the Tze Huang, grinding the Tze Huang into 100 meshes of powder at normal temperature or low temperature, total RNA from the samples was extracted with Trizol reagent. The specific extraction method comprises the following steps:
1) Grinding Tze Huang into powder by using a low-temperature grinder, weighing 50mg, putting into a 1.5ml centrifuge tube, adding 1ml of trizol vortex, and standing on ice for 10min;
2) Adding 200 μl of chloroform, shaking vigorously to mix them, and standing for 5min;
3) Centrifuging at 4deg.C and 14000g for 20min;
4) Sucking the supernatant into a new 1.5ml centrifuge tube, adding isopropanol with the volume of 1-2 times of the supernatant, uniformly mixing, and then placing into a-20 ℃ for precipitation for more than 1 hour;
5) Centrifuging at 4deg.C and 14000g for 20min;
6) Discarding the supernatant precipitate, adding 1ml of 75% alcohol prepared with DEPC water, and blowing;
7) Centrifuging at 4deg.C and 14000g for 20min;
8) Discarding the supernatant, inverting a 1.5ml centrifuge tube, and airing the alcohol for about 5-10min;
9) Dissolving in DEPC water, and preserving at-80deg.C to obtain total RNA of PIANZAIHUANG.
2. Detection of the content of 33 Small RNAs of the present invention
After total RNA extraction of the Tze Huang, sequencing can be performed using high throughput sequencing techniques, reverse transcription PCR (RT-PCR), real-time fluorescent quantitative PCR (qPCR), RNA chips, northern Blotting, in situ hybridization, and the like. The specific method of the embodiment is as follows:
extracting total RNA from Tze Huang, performing PAGE electrophoresis to recover 18-45nt RNA molecule, adding 3' joint, adding RT primer with UMI into the system, and performing reverse transcription extension to synthesize cDNA chain. The 33 small RNA sequences and contents of the invention were detected by small RNA high throughput sequencing technology (experimental procedure is shown in FIG. 1) (Table 1). The RT primer with UMI is supplied by sequencing company (Shenzhen megagene Co., ltd.).
TABLE 1 names and sequences of small RNAs
The beneficial effects of the present invention are demonstrated by specific test examples below.
Test example 1 stability study of the small RNA of Pianzaihuang of the invention into the body by ingestion
1. Experimental method
And detecting small RNA of the Pianzaihuang which enters the animal body through ingestion and exists stably by using an RT-qPCR method. And (3) selecting small RNA design primers in the table 1, and detecting the small RNA from the Tze Huang in the serum to further verify the absorption condition of the small RNA in the serum. Primers for reverse transcription PCR and qPCR detection of small RNA of Pitahuang are shown in Table 2. qPCR detection only required forward primers, reverse primers were self-contained in the kit and had the sequence AGTGCAGGGTCCGAGGTATT (SEQ ID NO. 34).
Species of mice: c57BL/6J;
the early period in vivo absorption experiment is to irrigate the stomach with the Tze Huang;
the stomach-filling dosage of the PIANZAIHUANG: the stomach is irrigated once a day, and the dosage is 1g/kg once;
the content of each small RNA in the serum of the mice is detected 3 hours after the administration of the PIANZAIHUANG by intragastric administration for 10 days.
Control group: the same volume of PBS solution was filled in the stomach, and the content of each small RNA in the serum of the mice was detected 3 hours after the last administration of the solution was filled in the stomach for 10 days.
TABLE 2 reverse transcription PCR and qPCR detection primer list
Reverse transcription (10 μl) of sRNA of Pitahuang was performed using the system shown in Table 3.
TABLE 3 sRNA reverse transcription reaction System
/>
After the system is prepared, the mixture is evenly mixed and put into a PCR instrument for reaction, and the reaction procedure is shown in Table 4.
TABLE 4 reverse transcription procedure for sRNA
After the reverse transcription is completed, quantitative detection is performed by using qPCR primers. qPCR system is shown in Table 5 and reaction procedure is shown in Table 6.
TABLE 5 sRNA fluorescent quantitative PCR reaction System
TABLE 6 fluorescent quantitative PCR reaction procedure
2. Experimental results
The experimental results are shown in fig. 2, wherein Control is a mouse without intragastric administration, and PTH is a mouse after bolus administration. As can be seen from fig. 2: after the mice are perfused with the PIANZAIHUANG, most of the drug-derived small RNAs found by sequencing are significantly increased in the serum of the mice, and the result proves that the drug-derived small RNAs can be absorbed by mammals and enter the circulatory system.
Test example 2 detection of the content of sRNA in the serum and liver
1. Experimental method
Male C57 mice were randomly divided into PBS control group, single administration group of PIANZAIHUANG, and multiple administration group of PIANZAIHUANG. After 12h of fasted food, the Tze Huang is ground into 100-mesh powder, and then is prepared into suspension by PBS for gastric administration. The single administration group is only administrated by intragastric administration once, and the multiple administration group is administrated by intragastric administration once every 3 hours for three times. The dosage of the bolus for each time is 0.1g/100g. The PBS control group was perfused with equal dose volume of PBS. After the last gastric lavage is finished for 6 hours, blood of the mice is taken to separate serum, and liver tissues are taken. The total content of 33 sRNAs shown in table 1 in serum and liver of each group of mice is detected by RT-qPCR, the primer sequences are shown in table 2, and the reaction system and the procedures are shown in tables 3-6.
2. Experimental results
The experimental results are shown in fig. 3 and 4: the results show that the 33 small RNAs of the Tze Huang can be absorbed through the alimentary canal and reach the serum and liver tissues. Experimental results show that 33 sRNAs of the Tze Huang can enter animals through ingestion and exist stably.
Test example 3 inhibition effect of small RNA of Pianzaihuang on target Gene
1. Experimental method
The 33 small RNAs of the Pianzaihuang are obtained from the Pianzaihuang by adopting the method described in the embodiment 1, and can also be directly synthesized by adopting a conventional technology.
The inhibition effect of the small RNA of the Pianzaihuang on the target gene (CYP 2E1 gene) is proved by a luciferase report experiment:
the CYP2E1 target gene is combined with 33 small RNAs of the Pianzaihuang (the 33 small RNAs of Pianzaihuang are PTH sRNAs, from PTH-cRNA-1 to PTH-cRNA-33 in a molar ratio of 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17:0.17: constitutive) is inserted into the pMIR-REPORT Luciferase plasmid, constructing a luciferase reporter plasmid. Positive clones were screened and sequenced for verification, clones were amplified and plasmids were purified. The relevant cells are cultured and inoculated in a 24-well plate, and after 12-16 hours, the cells are co-transfected by the luciferase expression plasmid carrying the predicted target gene to be detected and the small RNA plasmid of the Pianzaihuang. After 24 hours, the cells were collected and lysed, and luciferase substrate was added and luciferase reacted with the substrate to produce luciferin. The activity of luciferase can be measured by detecting the intensity of fluorescence and compared with the transfected nonsense small RNA group, so that whether the predicted target spot can be inhibited by the small RNA of the Tze Huang or not is judged.
The specific sequence of the segment sequence fragment of the CYP2E1 target gene combined with 33 small RNAs of the Tze Huang of the invention is as follows:
CTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGATTTGAAG
GATATTCCCAAGTCTTTAACCAAGTTGGCAAAGCGCTTCGGGCCAGTGT
TCACACTGCACCTGGGTCAGAGGCGCATCGTGGTCCTGCATGGCTACA
AGGCTGTCAAGGAGGTGCTACTGAACCACAAGAATGAGTTCTCTGGCC
GAGGGGACATTCCTGTGTTCCAGGAGTACAAGAACAAGGGGATTATTT
TCAATAATGGACCCACATGGAAGGACGTGCGGAGGTTTTCCCTAAGTAT
CCTCCGTGACTGGGGAATGGGGAAACAGGGTAATGAGGCCCGCATCCA
AAGAGAGGCACACTTCCTGGTGGAGGAGCTCAAAAAGACCAAAGGCC
AGCCTTTTGACCCTACCTTTCTGATTGGCT(SEQ ID NO.101)
nonsense small RNAs are nonsensical small RNA sequences that do not bind to the target gene. Nonsense small RNA sequence: GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 102)
2. Experimental results
The results of the luciferase reporter assay are shown in FIG. 5, control refers to a grouping of small sense RNA transfected as a control. Fig. 5 shows that: the small RNA composition of the Pianzaihuang has obvious inhibition effect on CYP2E1 genes.
Test example 4 recovery of small RNA from Pianzaihuang to alcoholic liver injury
1. Experimental method
The 33 small RNAs of the Pianzaihuang are directly synthesized by adopting a conventional technology.
(1) Constructing an alcoholic liver injury mouse model:
a number of 8 week old male C57 mice were purchased and after 2 weeks of adaptive rearing at the animal experiment center, molding was started. The first stage: the control liquid diet (without ethanol) was fed for 5 days, the feeding tube was cleaned and the diet was changed daily, during which no additional diet or water was added. The special feeding tube is used, a hand wearing gloves is used, the thumb is placed on the hole of the tube mouth, the tube is filled, and the feeding tube cover is screwed. And a second stage: the control diet was changed to Lieber-DeCarli ethanol liquid diet on day 6 and the diet was changed during 3-5 pm daily, ensuring that the mice had fresh diet available at the beginning of their maximum food intake period. During feeding, 2 feeding tubes were checked daily for blockage or leakage. And a third stage: the mice were subjected to modeling of alcoholic liver injury by alcohol feeding (i.e., 31.5% alcohol gavage = mouse body weight (g) ×20 μl) at a dose of 5g alcohol/body weight kg by 7-9 a.m. alcohol infusion on day 16. Mice lose temperature after being filled with gastric alcohol solution, so the cage needs to be placed on a heating pad.
(2) Therapeutic administration:
the model mice were randomly divided into a control group (control), a nonsense small RNA group (Scramble RNA) and a Pitahuang sRNA group (PTH sRNA, the mole ratio of PTH-sRNA-1 to PTH-sRNA-33 is as follows 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17), after the molding is completed, the mice are correspondingly treated according to the grouping. The control group was not treated; the mixed solution of 33 sRNAs is infused into the stomach of the sRNA group of the Pianzaihuang, the sRNA infusion dosage is 0.16nmol/g, and the treatment is carried out 1 time per day for 10 times in total; the stomach-filling amount of the nonsense small RNA is 0.16nmol/g, and the treatment is carried out 1 time per day for 10 times; wild mice without molding were also used as controls (WT).
The 33 microRNAs were synthesized as dry powders by the company, and then an equal amount of DEPC water was added for dissolution, and the 33 microRNAs solutions were mixed and administered to mice by intragastric administration at a dose of 0.16 nmol/g.
Nonsense small RNAs were also synthesized as dry powders by the company, added with equal amounts of DEPC water for dissolution, and administered to the lavage at a dose of 0.16 nmol/g. The sequence of the Scramble RNA is shown as SEQ ID NO. 102.
(3) Index detection
Mice were sacrificed after treatment, livers of the mice were collected, and the content of superoxide dismutase (SOD) and Malondialdehyde (MDA) in the livers was detected. The mouse livers were simultaneously H & E stained and oil red O stained.
2. Experimental results
As shown in FIG. 6, the SOD and MDA content results show that compared with the control group (control), the SOD content of the sRNA group of the Tze Huang is obviously increased, and the MDA content is obviously reduced, which indicates that the small RNA in the Tze Huang has positive effect on liver repair of alcoholic liver injury.
The results of H & E staining and oil red O staining are shown in FIG. 7, the liver cells of the wild mice are orderly arranged, the cell nuclei are round and clear, the cytoplasm is rich, the liver of the control mice shows hepatic lobule destruction after alcohol-induced oxidative stress, the volume of the liver cells is increased, the cell nuclei are slightly cracked, and the oil red O staining shows obvious lipid drop accumulation. Compared with a control group, the liver of the sRNA administration group mice has no obvious histological lesions in tissue morphology, the cell nucleus edge is clear, the accumulation quantity of lipid droplets is correspondingly reduced, and the degree of steatosis is relieved to a certain extent. The small RNA composition can effectively treat alcoholic liver injury.
Test example 5, verification of the protective Effect of small RNA of Pianzaihuang on alcoholic liver injury
1. Experimental method
The 33 small RNAs of the Pianzaihuang are directly synthesized by adopting a conventional technology.
The C57BL/6J mice were first fed an adaptive liquid diet (without ethanol) for 5 days, and on day 6, were fed with a liquid diet containing 5% ethanol (Lieber-DeCarli ethanol diet) for a total of 10 days. Meanwhile, at day 6, the sham mice were randomly divided into 3 groups, control group (control), nonsense small RNA group (Scramble RNA) and bolus sRNA administration group (PTH sRNA), respectively. The control group was not treated; mixed liquor of 33 sRNAs of Pianzaihuang sRNA group intragastric administration (PTH-sRNA-1-PTH-sRNA-33 is prepared according to mole ratio) 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17:0.17 composition: composition; the nonsense small RNA group perfuses stomach with nonsense small RNA solution.
The 33 microRNAs were synthesized as dry powders by the company, and then an equal amount of DEPC water was added for dissolution, and the 33 microRNAs solutions were mixed and administered to mice by intragastric administration at a dose of 0.16 nmol/g.
The nonsense small RNA sequence is shown as SEQ ID NO.102, and dry powder is synthesized by the company, and is added with equal amount of DEPC water for dissolution, and is administrated into the stomach at a dosage of 0.16 nmol/g.
The alcohol feed is administered once daily during the feeding period, after 9 hours of filling the alcohol solution in the morning on the 16 th day, blood separation serum of the mice is taken and stored in a refrigerator at-80 ℃ for standby, liver is taken, half of the liver is frozen in the refrigerator at-80 ℃, and the half of the liver is fixed by 4% paraformaldehyde. Wild mice without molding were also used as controls (WT).
Measuring biochemical indicators using mouse serum (ALT, AST, LDH, TBIL); part of the livers are fixed for HE staining and oil red O staining, and part of the livers are used for detecting liver activity (SOD and MDA) and detecting CYP2E1 content by western blotting.
2. Experimental results
Control mice were fed a Lieber-DeCarli diet to cause alcoholic liver injury, with rapid increases in serum ALT, AST, TBIL and LDH levels, and with decreased blood biochemical levels following prophylactic administration of PTH sRNA to mice. The results indicate that the small RNA of the Pianzaihuang has liver protection activity in the context of alcoholic liver injury (figure 8).
The CYP2E1 protein is induced by ethanol and exacerbates oxidative damage by accelerating ROS production. As shown in fig. 9, compared with wild-type mice, the CYP2E1 protein level of the control group was increased, and the CYP2E1 protein level of mice administered with the anti-inflammatory agent sRNA was decreased to be close to the normal mice level.
In addition, levels of SOD and MDA in the liver were examined, which are important factors reflecting the body's oxidation and antioxidant capacity. As shown in fig. 10, ethanol induced a decrease in liver SOD levels and an increase in MDA levels in mice, while prophylactic administration of the drug reduced the oxidative damage of the liver to some extent.
The results of the tissue section staining showed (fig. 11) that hepatocytes of wild-type mice were intact, free of fat voids, and free of inflammatory infiltrates. In the control group, steatosis was evident, and there was a large area of fat void and inflammatory infiltrate, and fat droplets were severely accumulated. Compared with the control group, the liver slice of the sRNA group of the Tze Huang has a few inflammatory cells and has lower fat accumulation degree. The small RNA composition can effectively prevent alcoholic liver injury.
In conclusion, 33 small RNAs are extracted from the traditional Chinese patent medicine Pianzaihuang, and the 33 small RNAs can play roles in preventing and/or treating alcoholic liver injury; and, the composition obtained by combining these 33 kinds of small RNAs has a preventive and therapeutic effect on alcoholic liver injury. Meanwhile, 33 kinds of small RNAs can be effectively absorbed through ingestion, exist stably and are convenient and effective to use. The 33 small RNAs can also be used as markers to control the quality of the Pianzaihuang, and the Pianzaihuang with high content of the 33 small RNAs has better effect of preventing and treating alcoholic liver injury. The research of the invention discovers that the small RNA in the PIANZAIHUANG is beneficial to preventing and treating alcoholic liver injury, which has important significance for further research and development and quality control of the PIANZAIHUANG. According to the small RNA molecule pointer screened, the product quality of each batch of the Pianzaihuang can be checked and controlled.

Claims (11)

1. A small RNA for preventing and/or treating alcoholic liver injury, characterized in that: it is a nucleotide sequence shown in any one of SEQ ID NO. 1-3, SEQ ID NO.6, SEQ ID NO. 8-16, SEQ ID NO. 18-31 and SEQ ID NO. 33.
Use of a microrna nucleotide sequence as set forth in any one of seq ID nos. 1 to 33 in the preparation of a medicament for the prevention and/or treatment of alcoholic liver injury;
preferably, the drug is a drug that inhibits CYP2E1 gene expression.
3. Use according to claim 2, characterized in that: the medicine is used for increasing the content of superoxide dismutase; and/or, the drug is a drug for reducing the content of malondialdehyde; and/or the medicament is a medicament for reducing ALT, AST, TBIL and LDH content in serum.
4. A small RNA composition for preventing and/or treating alcoholic liver injury, characterized in that: it is composed of the nucleotide sequences shown as SEQ ID NO. 1-33 as components.
5. The small RNA composition of claim 4, wherein: the mol percentage of the nucleotide sequence shown in SEQ ID NO.1 is 7-10%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 6 to 10 percent,
the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 4-10%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.5 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.6 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.7 is 3-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.8 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.9 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.10 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.11 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.12 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.13 is 2-8%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.14 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.15 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.16 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.17 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.18 is 1-7%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.19 is 1-7%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.20 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.21 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.22 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.23 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.24 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.25 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.26 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.27 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.28 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.29 is 0.5 to 6 percent,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.30 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.31 is 0.5-6%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.32 is 0.5-6%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.33 is 0.5-6%.
6. The small RNA composition of claim 5, wherein: the mol percentage of the nucleotide sequence shown in SEQ ID NO.1 is 9-10%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.2 is 8-9%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.3 is 5 to 6 percent,
the mol percent of the nucleotide sequence shown in SEQ ID NO.4 is 4-5%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.5 is 4-5%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.6 is 4-5%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.7 is 4-5%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.8 is 3-4%;
the mol percent of the nucleotide sequence shown in SEQ ID NO.9 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.10 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.11 is 3-4%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.12 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.13 is 3-4%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.14 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.15 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.16 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.17 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.18 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.19 is 2-3%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.20 is 2-3%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.21 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.22 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.23 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.24 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.25 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.26 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.27 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.28 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.29 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.30 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.31 is 1-2%,
the mol percentage of the nucleotide sequence shown in SEQ ID NO.32 is 1-2%,
the mol percent of the nucleotide sequence shown in SEQ ID NO.33 is 1-2%.
7. The small RNA composition of any one of claims 4 to 6, wherein: the mol ratio of the nucleotide sequences shown in SEQ ID NO. 1-33 is 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17.
8. the method for producing a small RNA composition of any one of claims 4 to 7, wherein: it comprises the following steps:
mixing the nucleotide sequences shown in SEQ ID NO. 1-33 to obtain the polypeptide.
9. Use of the small RNA composition of any one of claims 4 to 7 in the manufacture of a medicament for the prevention and/or treatment of alcoholic liver injury;
preferably, the drug is a drug that inhibits CYP2E1 gene expression.
10. Use according to claim 9, characterized in that: the medicine is used for increasing the content of superoxide dismutase; and/or, the drug is a drug for reducing the content of malondialdehyde; and/or the medicament is a medicament for reducing ALT, AST, TBIL and LDH content in serum.
11. A medicament for preventing and/or treating alcoholic liver injury, characterized in that: the preparation is prepared by taking the small RNA as claimed in claim 1 or the small RNA composition as claimed in any one of claims 4 to 7 as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.
CN202310933804.6A 2023-07-27 2023-07-27 Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application Pending CN116751782A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310933804.6A CN116751782A (en) 2023-07-27 2023-07-27 Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310933804.6A CN116751782A (en) 2023-07-27 2023-07-27 Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application

Publications (1)

Publication Number Publication Date
CN116751782A true CN116751782A (en) 2023-09-15

Family

ID=87949850

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310933804.6A Pending CN116751782A (en) 2023-07-27 2023-07-27 Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application

Country Status (1)

Country Link
CN (1) CN116751782A (en)

Similar Documents

Publication Publication Date Title
US9752148B2 (en) Extraction, preparation, and application of plant micro-ribonucleic acid
US20190153446A1 (en) Mir-149-3p and method for treating metabolic disease using the same
CN108610409B (en) Application of ETV5 in preparation of medicine for preventing or treating obesity and related metabolic diseases
WO2017181857A1 (en) Composition for fat reduction and liver protection, and application thereof
CN113069445A (en) Application of bovine ledebouriella seseloides as effective component in preparing medicine for treating hepatitis B
CN116751782A (en) Small RNA of Tze Huang for preventing and/or treating alcoholic liver injury, small RNA composition, preparation method and application
Lu et al. The function of miR-122 in the lipid metabolism and immunity of grass carp (Ctenopharyngodon idellus)
CN107858355B (en) miRNA marker of non-alcoholic fatty liver disease and application thereof
CN116814630A (en) Small RNA of Tze Huang for preventing and/or treating nonalcoholic fatty liver, small RNA composition, preparation method and application
CN111705061B (en) Antisense nucleotide of piRNA-P1 and piRNA-P1 related to heart disease, application and medicament
CN110302209B (en) miR-451a antisense chain inhibitor and application thereof
CN116855499A (en) Small RNA of PIANZAIHUANG for preventing and/or treating hepatic fibrosis, small RNA composition, and preparation method and application thereof
KR20040062832A (en) Pharmaceutical composition for medical treatments and prevention of obesity including herbal medicine extracts
KR102208777B1 (en) Composition comprising inhibitors of miR-210 for inhibiting age-related metabolic disease and its screening method
Sa et al. Inhibitory effects of Mongolian medicine Yihe-Tang on continuous darkness induced liver steatosis in zebrafish
CN110652522B (en) Application of miR-2052in preparation of anti-liver cancer drugs
CN117802096A (en) Small RNA and small RNA composition of anti-hepatoma bolus for preventing and/or treating hepatoma, and preparation method and application thereof
CN110302380B (en) Application of litchis water extract radiotherapy sensitizer
CN111000852B (en) Application of withanolide extract in physalis angulata in preparation of drugs for preventing or treating non-alcoholic fatty liver diseases
CN116059210B (en) Application of LY294002 in preparation of cyprinid herpesvirus II inhibitor
CN111035645B (en) Application of Physalin B in preparation of medicine or health product for preventing and treating non-alcoholic fatty liver disease
CN114917217B (en) Application of phosphodiesterase 4 inhibitor ZL-n-91 in preparation of medicine for treating triple negative breast cancer
CN107375317B (en) Application of miR-149-3p and mimic thereof in preparation of medicines for preventing and treating obesity, atherosclerosis and hyperlipidemia
JP2018526457A (en) Medicinal Ambrosia plant extract
CN107604065A (en) A kind of liver cancer miRNA labels

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination