CN116836247A - PbPCZ zinc finger protein, encoding gene and application thereof - Google Patents

PbPCZ zinc finger protein, encoding gene and application thereof Download PDF

Info

Publication number
CN116836247A
CN116836247A CN202310846344.3A CN202310846344A CN116836247A CN 116836247 A CN116836247 A CN 116836247A CN 202310846344 A CN202310846344 A CN 202310846344A CN 116836247 A CN116836247 A CN 116836247A
Authority
CN
China
Prior art keywords
pbpcz
gene
plasmid
zinc finger
mycophenolic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310846344.3A
Other languages
Chinese (zh)
Inventor
熊志
魏巍
安坤
王京京
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD
East China University of Science and Technology
Original Assignee
GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD, East China University of Science and Technology filed Critical GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD
Priority to CN202310846344.3A priority Critical patent/CN116836247A/en
Publication of CN116836247A publication Critical patent/CN116836247A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/385—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Penicillium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/80—Penicillium

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a PbPCZ protein and application of a coding gene thereof. The PbPCZ is a zinc finger protein, and the quantity of conidia produced by the strain is influenced by knocking out or over-expressing the gene Pbpcz in penicillium brevicompactum, and meanwhile, the yield of mycophenolic acid is obviously changed. The strain is changed from 2.74g/L of the wild strain to 3.57g/L, and the strain is increased by 30.3 percent. The invention researches the pbpcz gene in penicillium brevicompactum through a genetic engineering technology and provides a new strategy for the production of industrial mycophenolic acid.

Description

PbPCZ zinc finger protein, encoding gene and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a penicillium brevicompactum PbPCZ zinc finger protein, and a coding gene and application thereof.
Background
Mycophenolic acid (Mycophenolic Acid, MPA), also known as mycophenolic acid, with the chemical name E-4-methyl-6- (1, 3-dihydro-7-methyl-hydroxy-6-methoxy-3-oxo-5-isobenzofuranyl) -4-hexenoic acid; mycophenolic acid has reversible inhibition effect on hypoxanthine mononucleotide dehydrogenase and selective inhibition effect on lymphocyte activity. Its 2-morpholinoethyl derivative mycophenolate (Morpholinoethyl Ester of Mycophenolic Acid, MMF) is a new generation immunosuppressant. The 5 month mycophenolate mofetil was approved by the U.S. Food and Drug Administration (FDA) in 1995 for use in clinical therapy in the prevention of acute rejection in renal transplant patients and achieved superior results. Mycophenolic acid is an immunosuppressant which is widely used at present. In addition, mycophenolic acid has antiviral, antifungal, antibacterial, antitumor and psoriasis treating activities, and has wide medicinal application.
At present, industrial production with a certain scale is not formed at home, and domestic documents related to mycophenolate mofetil and mycophenolic acid fermentation production are fewer. Internationally, the production method of mycophenolate mofetil has two approaches, mainly total chemical synthesis and biosynthesis. The chemical synthesis method has certain defects, mainly including multiple steps and low yield, and is difficult to industrialize. The biosynthesis method mainly comprises the steps of producing mycophenolic acid by fermenting penicillium microorganisms, and obtaining mycophenolate through esterification reaction.
The production of mycophenolic acid in the market at present mainly focuses on the production of mycophenolic acid by a biological fermentation method. Mycophenolic acid is an antibiotic produced by Penicillium sp, specifically Penicillium brevicompactum, penicillium paxilli, penicillium olivicolor, penicillium rugulosum, penicillium canescens, penicillium roqueforti, penicillium viridicatum, etc., and through fermentation experiments, it is verified that p.brevicomasum and p.rugulosum are the two species of Penicillium with the highest yield, and the yield ranges from 100 mg/L to 630mg/L. Thus, the filamentous fungus Penicillium breve (Penicillium brevicompactum) is an important industrial strain for the production of mycophenolic acid.
Another common method for improving mycophenolic acid production is to divide natural breeding, mutation breeding, protoplast fusion, cross breeding, genetic engineering and the like according to the genetic characteristics of the strain. Mutation breeding is a biological breeding method widely used by researchers. Strain mutagenesis equipment such as ultraviolet lamps are relatively common equipment and have remarkable effects, and thus are widely used in industrial microorganism breeding.
Disclosure of Invention
The invention aims to overcome at least one defect in the prior art, and provides a PbPCZ zinc finger protein, a coding gene and application thereof, wherein the coding gene of the PbPCZ protein can be operated by a genetic means so as to further improve the yield of mycophenolic acid of penicillium brevicompactum genetically engineered bacteria, a construction method and application thereof, and the improvement of the genetic characteristics of the bacteria is enhanced.
In order to solve the technical problems, the invention provides the following technical scheme:
the invention provides a PbPCZ zinc finger protein, which is mainly characterized in that the amino acid sequence is shown as SEQ ID NO: 1.
The invention also provides a coding gene of the PbPCZ zinc finger protein, which is mainly characterized by comprising the following nucleotide sequences:
1) As set forth in SEQ ID NO:2 is shown in the figure; or (b)
2) Sequences having more than 90% homology with the gene of 1).
According to the genome and transcriptome information found in the JGI database, the pbpcz gene sequence shown in SEQ NO.2 is obtained by comparison. Primers were designed based on this sequence information and the sequence was cloned using penicillium breve NRRL864 as template and sequenced. There are 6 conserved cysteine residues at amino acid positions 365-402.
The invention also provides a recombinant plasmid which is mainly characterized by comprising a nucleotide sequence for encoding the PbPCZ zinc finger protein and a vector plasmid.
Preferably, the vector plasmid is a plasmid constructed by taking RNAi plasmid pCAMBIA1303 as a framework; alternatively, the vector plasmid is a plasmid constructed by taking pPK2 as a framework.
The invention provides a transgenic cell line or an expression cassette, which is mainly characterized by comprising a nucleotide sequence for encoding the PbPCZ zinc finger protein.
The invention provides a recombinant bacterium which is mainly characterized by comprising a host bacterium and the recombinant plasmid, wherein the host bacterium is penicillium brevicompactum.
The invention provides an application of PbPCZ zinc finger protein or a coding gene thereof as a regulatory factor in promoting growth and development of penicillium brevicompactum or producing mycophenolic acid.
The invention provides application of the recombinant bacterium in producing mycophenolic acid.
Preferably, the mycophenolic acid is obtained by fermenting and culturing recombinant bacteria.
The invention provides a method for promoting the growth of penicillium brevicompactum or improving the yield of mycophenolic acid, which is mainly characterized in that the encoding gene of PbPCZ zinc finger protein is introduced or overexpressed in penicillium brevicompactum.
The invention provides a construction method of recombinant plasmid p1303 dual-RNAi-delta pbpcz, wherein the vector plasmid takes RNAi plasmid pCAMBIA1303 as a framework, and specifically comprises the following steps:
1. cloning of part of the pbpcz gene, promoter Pcit (shown as SEQ NO. 3) and terminator Tcit (shown as SEQ NO. 4):
based on the genomic sequence information of Penicillium breve published in JGI database and the sequence information of the pbpcz gene and the citrate synthase published by Genebank, primers were designed and synthesized:
Tcit-F：tttcgaccgaattGAGCTCTCTCTTCCTGGTTGTTTTGTAGTATACGCAG
Tcit-R：ctgctagcaacgtttGCGCCTAATGTCCCAACCGTTTC
Pcit-F：acatcaccatggTTCGCCAAAAAATAATAATAGATGGGGAGATGG
Pcit-R：agctggtcaccAGATGTACAGCCTAGAGCGTTCTTC
pbpcz400-F：cttgagcagacatcaACGAGTAGCTCGGTGGTCC
pbpcz400-R：ttattttttggcgaaCGTGAGATGGTTGGCAGCC
the reaction system of PCR is: ddH 2 O18. Mu.L, P.brevis genome template 1. Mu.L, upstream and downstream primers 2. Mu. L, buffer 25. Mu. L, dNTPs 1. Mu.L, and Hi-Fi 1. Mu.L, respectively. PCR reaction conditions: pre-denaturation at 95℃for 3min; 35 cycles were performed: denaturation at 95℃for 20s, annealing at 60℃for 20s, and extension at 72℃at a rate of 1kb/30 s. Finally, the temperature is kept at 72 ℃ for 10min, and the temperature is kept at 4 ℃ after the reaction is finished. After the reaction was terminated, 1% agarose gel electrophoresis was performed.
2. Transformation is carried out by taking pCAMBIA1303 as a basic framework to obtain a vector p1303dual-RNAi; specifically, kpnI enzyme-cutting pCAMBIA1303 is added with a Tcit fragment and a NcoI/BstEII double enzyme-cutting carrier, and Pcit is added to obtain a reverse double-promoter carrier p1303dual-RNAi;
3. the reverse double promoter vector p1303dual-RNAi is connected with partial pbpcz gene sequence to obtain recombinant plasmid p1303 dual-RNAi-delta pbpcz.
The recombinant plasmid p1303 dual-RNAi-delta pbpcz can be transferred into penicillium brevicompactum by a method mediated by agrobacterium tumefaciens.
The invention also provides a construction method of the recombinant plasmid pPK2-PXT-pbpcz, wherein the vector plasmid is pPK2, can recombine the target gene pbpcz, realizes the overexpression of the pbpcz gene in the penicillium brevicompactum, and specifically comprises the following steps: and (3) modifying according to the pPK2, deleting an XbaI cleavage site, encoding by fusion PCR, adding a gene overexpression box of a strong promoter of Pgpd-XbaI-Ttrpc (PXT) at the same position, constructing a plasmid pPK2-PXT, and finally carrying out XbaI cleavage on the plasmid pPK2-PXT to form a recombinant plasmid pPK2-PXT-pbpcz and form an expression box Pgpd-pbpcz-Ttrpc of the pbpcz gene.
The recombinant plasmid pPK2-PXT-pbpcz enters penicillium brevicompactum through the mediation of agrobacterium tumefaciens, and has obvious influence on conidium and secondary metabolite MPA.
Drawings
FIGS. 1a and 1b are, respectively, a conserved region and phylogenetic tree of the PCZ protein of a filamentous fungus, wherein FIG. 1a shows the sequence alignment of the conserved region of 6 Cys residues of the PCZ protein; FIG. 1b shows a phylogenetic tree of the PbPCZ protein.
FIG. 2a is an electrophoretogram of the pbpcz400 gene fragment (lanes 5-6) and the p1303dual-RNAi NcoI restriction enzyme fragment (lanes 7-12).
FIG. 2b shows the results of the E.coli DH 5. Alpha. P1303dual-RNAi-pbpcz400 transformant verification (lanes 2-5).
FIGS. 3a to 3d are illustrations of the construction of p1303dual-RNAi of a gene silencing vector.
FIGS. 4a and 4d are construction process maps of the gene overexpression vector.
FIGS. 5a to 5d show the effect of the pbpcz gene on mycelium growth. Wherein FIG. 5a shows the transcript level of the pbpcz gene; FIG. 5b shows the effect of a pbpcz gene deletion on the transcriptional levels of the central conidial pathway genes brlA, wet A and abaA; FIG. 5c shows sporulation of Penicillium breve WT, SE4, M2 in Czapek medium; FIG. 5d shows the sporulation of P.brevicompactum WT and SE4, M2 in Power medium.
FIGS. 6a to 6c are transcriptional level analyses of the penicillium breve NRRL864 mycophenolic acid production and MPA gene cluster. Among them, FIG. 6a shows the results of reverse transcription PCR electrophoresis of cDNA extracted from SE2, SE4, WT, M2 and M4 strains with respect to Pbg3p, mpaB, mpaG and mpaH genes; FIG. 6b shows MPA yields for SE2, SE4, WT, M2 and M4 strains; FIG. 6c shows transcript level analysis of three genes, mpaB, mpaG and mpaH, in MPA synthesis gene clusters for SE2, SE4, WT, M2 and M4 strains.
Detailed Description
The invention is further described in connection with the following embodiments in order to make the technical means, the creation features, the achievement of the purpose and the effect of the invention easy to understand.
The test methods described in the following examples, unless otherwise specified, are all conventional; the reagents and consumables referred to, unless otherwise specified, are commercially available. Experiments were divided into clones: the conditions described in the laboratory Manual (NewYork Cold Spring Harbor Laboratory Press, 1989) or according to the manufacturer's recommendations.
Bacterial strain and culture thereof
Starting strain: penicillium breve (Penicillium brevicompactum).
The media and solution information used in the following examples of the invention are as follows:
potato dextrose agar medium: weighing 300g of peeled potatoes, adding 1000mL of deionized water, boiling on an electromagnetic oven, keeping for 20-30min, filtering with gauze, discarding filter residues, supplementing the filtrate to 1000mL, and then adding 20g of glucose and 18g of agar powder;
seed culture medium: 80g/L glucose, 20g/L peptone, 10g/L soybean powder, KH 2 PO 4 1.0g/L，MgSO 4 ·7H 2 O1g/L；
Fermentation medium: 120g/L glucose, 15g/L glycine, 15g/L peptone, 5g/L yeast extract, feSO 4 ·7H 2 O 0.2g/L，MnSO 4 ·H 2 O 0.1g/L，ZnSO 4 ·H 2 O 1g/L，CaCl 2 0.5g/L；
LB medium: yeast extract 5g/L, sodium chloride 10g/L, peptone 10g/L, agar powder 18g/L, 1000mL deionized water and sterilizing with 121 deg.C high pressure steam. Is used for culturing escherichia coli.
Strain culture: spores of NRRL864 of penicillium breve were washed off PDA slants incubated at 25 ℃ for 7 days with 10% glycerol solution, inoculated into 1mL of bacterial liquid in seed medium, mycelia were collected after 7 days of cultivation for genome extraction: inoculating toothpick into fermentation medium, culturing at 28deg.C for 5 days, and collecting mycelium for total RNA extraction.
Genome extraction
The following examples of the present invention provide the following procedures for genome extraction:
the tool used is first: the mortar, pestle, bacteria shovel, etc. are put into liquid nitrogen in advance for precooling.
A proper amount of culture solution containing penicillium breve coccoid mycelium is taken from malt yeast extract culture medium, and centrifuged at 13000rpm for 5min, and the supernatant is discarded. Collecting 200mg thallus, transferring the thallus precipitate into mortar, adding liquid nitrogen, freezing, adding liquid nitrogen for several times, and coolingGrinding to powder with a pestle after freezing. The resulting bacterial cells were transferred as a powder to a sterile EP tube, to which 200mL of 0.9% NaCl solution was added, and vortexed for 30s. 0.4mL of PC solution and 0.4mL of TE solution were added, and the mixture was vortexed for 1min.12000rpm, and centrifuged for 5min. The supernatant 570. Mu.L was carefully removed to a new EP tube. 1.4mL of absolute ethanol pre-cooled in advance is added, and the mixture is inverted and mixed uniformly. 12000rpm, and centrifuged for 5min. The supernatant was discarded and the EP tube was inverted over absorbent paper to blot residual liquid. Then 400. Mu.L of TE solution was added for dissolving the nucleic acid precipitate. 10 mu L of 4mol/L ammonium acetate solution and 1mL of absolute ethyl alcohol are sucked, and the mixture is repeatedly and reversely mixed. 12000rpm, and centrifuged for 5min. The supernatant was discarded, the residual liquid was sucked dry, and the mixture was placed in an oven at 50℃for 3min, and the liquid was dried. Add 50. Mu.L ddH 2 O, dissolving the precipitate. Placing in a refrigerator at-40deg.C, and freezing for preservation.
Total RNA extraction
The procedure for total RNA extraction in the following examples of the invention is as follows:
pretreatment: and selecting a position with weak air flow to clean the experiment table. Alcohol is used to kill table top, instrument, etc. and the mask and the sterile glove are worn. Preparing a gun head without RNAase, centrifuging a tube and a reagent.
Fresh sample 750. Mu.L was centrifuged at 13500rpm in a RNAase-free centrifuge tube for 10min and the supernatant discarded. Pouring the precipitate into a mortar, adding liquid nitrogen, freezing, and fully grinding with a pestle. The dry powder was transferred to a new RNAase-free centrifuge tube with a pre-frozen spatula and 1mL of Trizol reagent was added. Vortex and shake, and stand at room temperature for 5min. After centrifugation at 12000rpm for 5min, the supernatant was transferred to a new tube. 200. Mu.L of chloroform was added thereto, and the mixture was vortexed for 15s and allowed to stand for 3 minutes. 12000rpm, and centrifuged for 10min. The uppermost aqueous phase (volume V: about 500. Mu.L) was taken and added with 0.5V ethanol (250. Mu.L) and mixed well. Centrifuging at 12000rpm for 30s at low temperature, and discarding the waste liquid. mu.L of RW solution was added thereto, and the mixture was left at room temperature for 2 minutes. Followed by centrifugation at 12000rpm for 2min. The previous one step is repeated once. Without addition of solution, the tube with the collection column was centrifuged at 12000rpm for 2min at low temperature. The column was inverted and the residual liquid was drained off on a paper towel for 2min. The collection column was placed in a new centrifuge tube, 100. Mu.L of distilled water treated with DEPC was added thereto, and the mixture was allowed to stand at room temperature for 2 minutes. Centrifuge at 12000rpm for 2min at 4 ℃. The resulting RNA solution was stored in a-80℃refrigerator for use.
Example 1
Amplification of the pbpcz Gene
Corresponding PbPCZ sequence information (shown as SEQNO. 1) was obtained from Penicillium breve using conserved sequence and genomic data analysis. This sequence is 87.69% similar to the sequence of the PCZ1 protein in p.roqueforti FM 164. (PCZ 1 protein sequence accession number: CDM 35469.1).
Amino acid sequence alignment of proteins from penicillium and aspergillus homologous to PbPCZ showed that the two genera are highly similar. As shown in FIG. 1, the corresponding PbPCZ protein obtained from the NCBI blastp alignment (JGI database) showed 87.69% similarity to the PCZ1 protein of P.roqueforti FM164 (PCZ 1 protein sequence accession No. CDM 35469.1), a similarity of 89.30% to P.rubens Wisconsin 54-1255 (PrWPCZ, accession No. XP_ 002565184.1), a similarity of 88.38% to the PaPCZ protein of P.arizonense (accession No. XP_ 022486847.1), a similarity of 88.32% to the P.expansum PePCZ protein (accession No. XP_ 016594822.1), a similarity of 88.16% to the PflPCZ protein of P.flaverium (accession No. OQE 22246.1), a similarity of 88.07% to the PPCZ protein of P.rubens Wisconsin 54-1255 (accession No. F95), a similarity of 88.38% to the P.Kacusin Kacusn protein (accession No. XP_ 022486847.1), a similarity of 88.32% to the P.7% to the PCZ protein of P.p.flansin (accession No. 52), a similarity of 463-52% to P.37% to the PCZ protein of P.p.p flag (accession No. 45).
The PbPCZ protein is encoded by the PbPCZ gene, and synthetic primers are designed according to the information related to the PbPCZ gene and the construction vector:
pbpcz400-F：cttgagcagacatcaACGAGTAGCTCGGTGGTCC
pbpcz400-R：ttattttttggcgaaCGTGAGATGGTTGGCAGCC
the cDNA sequence of part of the pbpcz gene is cloned by matching with high-fidelity enzyme to 400bp. The 400 pbpcz band is a p1303dual-RNAi linearization fragment cloned and constructed into the Nco I restriction endonuclease site, 12240bp in length. On the other hand, this primer was used to verify that E.coli DH 5. Alpha. -p1303 dual-. DELTA.pbpcz-RNAi and A.tumefaciens GV3101-p1303 dual-RNAi-. DELTA.pbpcz positive transformants were obtained, as shown in FIGS. 2a and 2 b.
Overexpression of this Strain the full length was cloned using the pbpcz-F/pbpcz-R primer and ligated between the pPK 2-PXT-XbaI enzyme tangential fragments.
pbpcz-F：tgagcagacatcaccATGTCAAATGTTGATTTATCTAGCGATGGC
pbpcz-R：cggtcggcatctactTTAGTTGGCGCGAATGACAAGTC
In addition, the pair of primers can be used for positive transformant verification of E.coli pPK2-PXT-pbpcz strain and A.tumefaciens GV3101-pPK2-PXT-pbpcz strain.
Example 2
Recombinant plasmid
According to the gene sequence of the penicillium breve citrate synthase published by Genebank, the sequence information of upstream and downstream Pcit (shown as SEQ NO. 3) and Tcit (shown as SEQ NO. 4) is found, and the synthetic primer is designed:
Tcit-F：tttcgaccgaattGAGCTCTCTCTTCCTGGTTGTTTTGTAGTATACGCAG
Tcit-R：ctgctagcaacgtttGCGCCTAATGTCCCAACCGTTTC
Pcit-F：acatcaccatggTTCGCCAAAAAATAATAATAGATGGGGAGATGG
Pcit-R：agctggtcaccAGATGTACAGCCTAGAGCGTTCTTC
two sections of plasmids with the lengths of 1545bp and 509bp are cloned by taking the penicillium brevicompactum genome as a template, and the plasmids are respectively: p1303 dual-RNAi-. DELTA.pbpcz and pPK2-PXT-pbpcz.
Recombinant plasmid p1303dual-RNAi- Δpbpcz:
RNAi knockout plasmid p1303dual-RNAi can be connected with partial pbpcz gene sequence to form recombinant plasmid p1303 dual-RNAi-delta pbpcz, and the recombinant plasmid p1303 dual-RNAi-delta pbpcz is transferred into P.brevicaulis through a rhizobium mediated method.
The p1303 dual-RNAi-. DELTA.pbpcz was constructed by engineering according to pCAMBIA1303 (FIG. 3a, commercial plasmid, novagen). As shown in fig. 3a to 3d, the construction method of the plasmid specifically comprises: cloning to obtain the upstream and downstream gene sequences of the penicillium brevicompactum citrate synthase, which are respectively used as a promoter Pcit and a terminator Tcit; subsequently, kpnI digestion pCAMBIA1303 is added with a Tcit fragment to form a plasmid, ncoI/BstEII double digestion cleavage vector is added with Pcit, and a reverse double promoter vector p1303dual-RNAi shown in figure 3c is obtained; subsequently, a partial fragment of the pbpcz gene was added at the NcoI cleavage site to obtain a plasmid of p1303dual-RNAi-pbpcz400 shown in FIG. 3 d.
Recombinant plasmid pPK2-PXT-pbpcz
The recombinant plasmid can realize the overexpression of the target gene pbpcz of pbpcz in penicillium brevicompactum.
Also, as described above, primers were designed and synthesized based on the genomic sequence information of P.brevicompactum published in the JGI database and the sequence information of the pbpcz gene sequence published in Genebank:
Pgpd-F：gaggtaatccttcttAATACGTCGAGCCTGCTCCG
Pgpd-R：gcatctacttctagaGGTGATGTCTGCTCAAGCGGG
TtrpC-F：gacatcacctctagaAGTAGATGCCGACCGGGAT
TtrpC-R：cagtacacgaggactaagaaGGATTACCTCTAAACAAGTGTACCTGT
pbpcz-F：tgagcagacatcaccATGTCAAATGTTGATTTATCTAGCGATGGC
pbpcz-R：cggtcggcatctactTTAGTTGGCGCGAATGACAAGTC
the XbaI cleavage site was deleted by engineering according to pPK2 (FIG. 4a, commercial plasmid, biovector NTCC). By fusion PCR, a gene overexpression cassette of a strong promoter of Pgpd-XbaI-TttrpC (PXT) was added at the same position. Following the above procedure, a plasmid pPK 2-Pgpd-XbaI-TttrpC (abbreviated as pPK 2-PXT) was constructed as shown in FIG. 4 b. The above plasmid was digested with XbaI to finally form the plasmid map of pPK2-PXT-pbpcz in FIG. 4 c.
The invention also comprises an expression cassette Pgpd-pbpcz-TttrpC of the pbpcz gene. Wherein the promoter Pgpd is a promoter sequence from glyceraldehyde-3-phosphate dehydrogenase in Aspergillus nidulans. The terminator TtrpC is derived from the aspergillus nidulans tryptophan synthesis gene trpC.
Example 3
Coli and Agrobacterium tumefaciens transformation of genetically manipulated plasmids
The preparation of competence of escherichia coli and agrobacterium tumefaciens comprises the following specific steps:
the frozen E.coli DH 5. Alpha. And Agrobacterium tumefaciens (A.tumefaciens) GV3101 strains were selected and activated by plate streak culture. Single colonies were picked and inoculated into 10mL of LB liquid medium, and cultured at 200rpm at 37℃and 28℃respectively. Due to the difference in physiological states of E.coli DH 5. Alpha. And Agrobacterium tumefaciens GV3101 strain, the former only needs to be cultured for 12-18 hours without any antibiotics, and the latter needs to be cultured for about 24 hours with gentamicin added. Then, 500. Mu.L of the bacterial liquid is sucked into 50mL of LB liquid medium for expansion culture until OD 600 Reaching about 0.6.
Preparing a 50mL centrifuge tube sterilized at high temperature and high pressure in advance, and 0.1mol/L CaCl 2 Solution, 0.1mol/L MgCl 2 Solution, 20% glycerol solution and 0.1mol/L CaCl 2 The mixed solution was ice-bathed for 30min. The corresponding competence of the escherichia coli and the agrobacterium tumefaciens is obtained by using low-temperature calcium ion induction conditions, and the escherichia coli and the agrobacterium tumefaciens are stored at ultralow temperature after being frozen by liquid nitrogen.
The two plasmids constructed in example 2 were screened for E.coli DH 5. Alpha. Amplification by the following procedure:
taking out the prepared E.coli DH5 alpha competence, putting the competence on ice, and adding 1/10 volume of connecting liquid after the competence is melted. Light blowing and sucking, mixing, and placing in ice bath for 30min. Adding 900 μl of LB liquid medium, mixing, and incubating in a shaker at 37deg.C at 200rpm for 45-60min. The mixed culture solution was taken out, centrifuged at 4000rpm for 3min, and the supernatant was discarded. The pellet was air-sucked and mixed and then spread on LB solid plates containing 1% kanamycin. Placing the strain in an incubator at 37 ℃ in an inverted manner for culturing for 12-18 hours, and allowing a single colony to grow. Single colonies were picked and dissolved in 10. Mu.L of sterile water as templates for colony PCR.
Cloning of the target fragment in E.coli using Taq enzyme confirmed successful construction.
Two plasmids constructed in example 2 were electrotransformed into Agrobacterium tumefaciens GV3101, as follows:
the electric shock cup is taken, firstly rinsed by deionized water, then 75% ethanol is used for cleaning the electric shock cup by ultrasonic waves for 10min. Placing the electric shock cup on an ultra-clean workbench to blow for 30-60min, and drying the water.
Agrobacterium tumefaciens GV3101 stored at-80℃was placed on ice while the plasmid and cuvette were pre-chilled on ice. Draw Agrobacterium competent 50. Mu.L and split into sterile 1.5mL EP tubes, add 3. Mu.L of constructed plasmid, mix gently, and mark each tube. Transferring into a electric shock cup, 2.5KV and manually shocking. Then 600. Mu.L of precooled LB culture solution was added to the ultra-clean bench, and the mixture was poured into a sterile tube by aspiration and incubated at 28℃for 1 hour. Centrifuging at 4000rpm for 3min, and collecting precipitate. Spread on LB plate containing kanamycin and gentamicin resistance, and cultured at 28℃for 48h. After the transformant grows out, a single colony is picked, colony PCR is carried out, and the success of the construction of the transformant is verified.
Example 4
Recombinant bacterium
10mL of the liquid LB medium (0.1% gentamicin and 0.1% kanamycin were added) was inoculated with the Agrobacterium tumefaciens GV3101 transformant obtained in example 3, and cultured at 220rpm at 28℃for about 24 hours. Taking 1mL of bacterial liquid the next day, measuring OD 600 When the bacterial liquid grows to more than 0.8, transferring an IM culture medium containing MES and 0.1 per mill acetosyringone AS, and diluting the bacterial liquid to OD 600 About 0.15, culturing at 28deg.C for 3-4 hr at 220rpm in dark condition, and measuring OD 600 When it OD 600 And when the total bacterial strain is larger than 0.6, co-culturing to obtain recombinant bacterial spore suspension, and obtaining the gene knockout strains M2 and M4 of the pbpcz and the gene overexpression strains SE2 and SE4 of the pbpcz respectively.
Wherein, the co-culture operation comprises the following specific steps: collected wild-type fungal spores (concentration 10 8 cfu/mL) was diluted 100-fold, 100 μl of post-induction bacterial fluid was aspirated and 100 μl of spores after dilution were mixed. The pre-sterilized Whatman cellulose filter paper was clamped and placed on an IM solid plate containing MES and AS. Homogenizing the mixed bacterial liquidSpot on filter paper, place in incubator at 25 deg.c for culture (first day, after bacterial liquid is absorbed by culture medium, the culture medium is allowed to continue culture for 24 hr. After 48h of co-cultivation, the cellulose film was transferred to PDA solid medium containing both cephalosporin (Cef, 200. Mu.L 0.2%) and hygromycin (Hyg, 100. Mu.L 0.1%) for continued cultivation, which remained at 25℃for about 5 days with transformants outgrowing; the transformants were picked up on new PDA plates containing hygromycin, an antibiotic, grown until spores grew, the spores were broken up with sterile water, spread in eggplant flasks of PDA, and expanded.
Example 5
Determination of meristematic spore yield of recombinant bacteria
Culturing recombinant bacteria on a spore-forming medium, and measuring the yield of conidium.
The spore-forming culture medium is as follows:
charles medium (Czapek medium): naNO 3 3g，KCl 0.5g，0.5g MgSO 4 ·7H 2 O，0.5g K 2 HPO 4 ，0.01g FeSO 4 And 20g glucose pH 6.0, solid culture, 2% agar.
PW medium (Power medium): mixing 1:1 (v/v) standard Chart's medium and PM1 medium, pH 6.5 was adjusted, and 1.8% agar was added. Sterilizing at 115 deg.C under high temperature and high pressure for 15min;
PM1 medium: lactose 30g, peptone 5g, corn steep liquor 0.5g,NaCl 4g,CuSO 4 ·5H 2 O 1mg，FeCl 3 ·6H 2 O 3mg，MgSO 4 ·7H 2 O 50mg，KH 2 PO 4 60mg was dissolved in 1L of deionized water as distilled water.
The recombinant bacteria are cultured as follows:
solid plates of 50mm diameter Charles' and PW media were prepared separately from 100. Mu.L of the conidium suspension (5X 10) of equivalent viability from that obtained in example 4 5 cfu/mL) were spread on the surface of a petri dish with sterile spreading bars and used to analyze the conidium production of wild-type as well as pbpcz knocked-out and overexpressed transformants. Culturing at 28deg.CConidia were collected for 5 and 7 days, 5ml of NT buffer (0.9% NaCl, 0.05% Triton X-100) was added, colonies were aspirated with an inverted Pasteur pipette, and 3ml of NT buffer was added to repeat the above procedure. Conidia were counted by ordinary light microscopy cytometry. The numerical value is per mm 2 Number of conidia produced by surface area. The results of spore counts are shown in figures 5c-d, where the error bars represent the standard deviation of three replicates in three different experiments.
Meanwhile, RT-qPCR verifies the pbpcz gene transcription level of the recombinant bacterium:
RT-qPCR confirmed the transcription levels of the pbpcz gene of WT (P.brewagani wild-type strain), M2 and M4 (pbpcz gene knockout strain) derived from example 4, and SE2 and SE4 (pbpcz gene overexpression strain) derived from example 4.
Based on Genebank gene library sequence information and Primer-BLAST in NCBI, primers specific to RT-qPCR were designed:
Pbg3p-qPCR-F：AAGTATGACTCCACCCACGG
Pbg3p-qPCR-R：GTTGTTGACACCCATGACGAA
brlA-qPCR-F：TTCAGAATGGCCGACCTCAC
brlA-qPCR-R：CGTCCTGTTGAAGCCAAAGC
abaA-qPCR-F：ATCACGCCTCGGTATTCAGC
abaA-qPCR-R：TGGTCTTGGGAAGTTCGTGG
wetA-qPCR-F：CCTACCACTTCACACGGCAT
wetA-qPCR-R：AAGGTTGGAAGAGCGCATCA
RT-qPCR
SYBR fluorescent dye is used for verifying the transcription level, the concentration of the cDNA sample obtained through reverse transcription is measured by a micro nucleic acid concentration detection instrument, 5-10 times dilution is carried out according to different conditions, and the threshold cycle number, namely Ct value, is 15-30 under the optimal template addition amount.
Tables 1 and 2 show the real-time quantitative fluorescent PCR reaction system and the amplification procedure, respectively.
Table 1 real-time quantitative fluorescent PCR reaction System
TABLE 2 real-time quantitative fluorescence PCR amplification procedure
Use 2 -ΔΔCt The method for calculating the transcription level of the target gene in the sample to be detected is specifically as follows:
delta Ct (n) =ct (target gene of sample to be measured) -Ct (reference gene of sample to be measured);
Δct (1) =ct (control sample target gene) -Ct (control sample reference gene);
ΔΔCt＝ΔCt(n)-ΔCt(1)。
housekeeping genes are typically used as reference genes because substantially constant transcript levels are maintained at any stage of the growth of this type of gene. In this experiment, pbg p gene was used as an internal reference gene as determined by preliminary screening, and the wild strain of Penicillium breve was used as a control.
The result of the gene transcription level of the pbpcz of the recombinant bacterium is shown in fig. 5a, specifically, as shown in fig. 5a, the M2 and M4 transformants which knock out the pbpcz gene successfully reduce the gene transcription level of the pbpcz with the expression level of the pbpcz gene in the wild-type strain as 1, and the gene transcription level of the two strains with the lowest transcription level in the selected 5 transformants is respectively reduced to 52.6% and 18.0% of the wild-type strain; the transcript levels of the pbpcz genes of the transformants SE2 and SE4 over-expressing the pbpcz gene can reach 4.16,4.93 times that of the wild-type strain, respectively. FIG. 5b shows that deletion of the pbpcz gene also has a down-regulated effect on the transcriptional levels of the central conidial pathway genes brlA, wet A and abaA.
As shown in FIGS. 5c and 5d, the conidium yield of the recombinant strain WT is different from that of the transformant SE4 or M2, and it is known that silencing of the pbpcz gene results in a sharp decrease in the conidium yield of P.breve, and that over-expression of the pbpcz gene can increase the conidium yield of P.breve.
Specifically, as shown in FIG. 5c, in Charles' mediumIn which the spore numbers of SE4 and M2 reached 2.7X10 on day 5, respectively 4 cfu/mL、3.3×10 3 cfu/mL, spore count of WT 1.3X10 4 cfu/mL; the spore numbers of SE4 and M2 reached 2.1X10 on day 7, respectively 5 cfu/mL、7.2×10 4 cfu/mL, spore count of WT 1.4X10 5 cfu/mL. Spore yield of the M2 transformant was 55.5% of that of the wild type strain. While the spore yield of SE4 was increased by 37.8% compared to WT.
As shown in FIG. 5d, on day 5 in PW medium, the number of spores of WT was 2.8X10% 4 The spore numbers of cfu/mL, SE4 and M2 were 3.8X10 respectively 4 cfu/mL、1.5×10 4 cfu/mL; on day 7, the spore numbers of SE4, M2 and WT were 3.3X10, respectively 5 、1.1×10 5 And 2.2X10 5 cfu/mL。
Example 6
Determination of mycophenolic acid yield of recombinant bacteria
The produced mycophenolic acid was measured by fermenting and culturing the recombinant bacterium, and the yield was calculated.
(1) Fermentation culture of recombinant bacteria with silencing of pbpcz gene
Culture medium involved in fermentation culture:
shake flask medium: glucose 80g/L, peptone 20g/L, soybean powder 10g/L, KH 2 PO 4 1.0g/L and MgSO 4 ·7H 2 O1.0g/L。
Fermentation medium: 120g/L glucose, 15g/L glycine, 15g/L peptone, 5g/L, feSO yeast extract 4 ·7H 2 O0.2g/L、MnSO 4 ·H 2 O 0.1g/L、ZnSO 4 ·H 2 O1 g/L and CaCl 2 0.5g/L。
The specific process of fermentation culture comprises the following steps: 1mL of the seed containing 10 obtained in example 4 was inoculated 8 cfu/mL spore suspension to 50mL shake flask seed medium, at 28 degrees C incubator, 220rpm conditions for 72 hours to observe hypha growth. If the seed medium is relatively thin after 72 hours of cultivation, a suitable extension of the cultivation time is required. When the bacterial liquid is thick, 12% of the bacterial liquid can be inoculated without obvious bacterial pellet aggregationThe amount is added into the fermentation medium. That is, 6mL of the seed culture was aspirated, and 50mL of the shake flask fermentation medium was added. The level of knockdown was highest around 120h in fermentation based on the previous level of RNAi transcription. RNA samples were extracted and the transcription level of the gene hmgcl was determined. Under this condition, a round of fermentation was completed for 192 hours, MPA was extracted therefrom, and MPA yield was calculated.
The extraction and calculation of MPA specifically comprises the following steps: sucking 750 mu L of samples of the wild strain and the engineering strain of the penicillium brevicompactum fermented for 192 hours, adding the equal volume of pure ethanol into the samples, uniformly mixing the samples, and then placing the samples at 37 ℃ for incubation for 4 hours; followed by centrifugation at 15000rpm for 5min with a small high-speed centrifuge. From which 500. Mu.L of the supernatant was removed, and the preceding centrifugation was repeated again; filtering the obtained supernatant with 0.22 μm organic filter membrane, and placing in a liquid phase vial for detection; the preparation method uses a C18 reversed-phase high-performance liquid chromatographic column, wherein the formula of a mobile phase is 70% methanol and 30% aqueous solution, and 30% child ha water contains 0.4% glacial acetic acid. The flow rate of the mobile phase was set at 0.6mL/min and the retention time was about 9.3min. The mycophenolic acid detection is carried out at 250nm, and quantitative analysis is carried out by adopting an external standard method.
(2) Fermentation culture of recombinant bacteria over-expressing pbpcz gene
The recombinant bacterium overexpressing the pbpcz gene obtained in example 4 was fermented according to the fermentation culture method in (1) above, and after completion of fermentation, MPA was extracted and the MPA yield was calculated according to the extraction and calculation method in (1) above.
As shown in FIG. 6b, showing the yields of mycophenolic acid after fermentation of the modified strains M2, M4, SE2, SE4 and wild-type WT strains, it can be seen that modification of the PbPCZ gene has a significant effect on the yield of mycophenolic acid, the secondary metabolite of P.brevicompactum, i.e., the regulatory factor PbPCZ has a significant effect on MPA.
Specifically, in the Penicillium breve wild type strain WT, the average yield of mycophenolic acid was 2.74g/L; the yield of mycophenolic acid of the recombinant strain SE2 reaches 2.86g/L, the yield of mycophenolic acid of the recombinant strain SE4 reaches 3.57g/L, and the yield is 30.3 percent higher than that of the wild strain WT; the mycophenolic acid production of recombinant bacteria M2 and M4 was 0.42g/L and 0.37g/L, respectively, i.e., the amount of MPA was drastically decreased due to the decreased expression of the pbpcz gene.
Meanwhile, RT-qPCR verifies three gene changes of MPA synthetic gene cluster
The transcript levels of the three genes (mpaB, mpaG and mpaH, respectively) associated with the mycophenolic acid synthesis gene cluster in wild-type strain WT, recombinant strain (pbpcz gene knockout and overexpressing transformant) were quantitatively determined to understand the effect of the pbpcz gene on MPA synthesis in secondary metabolism at the transcript level.
The PCR was performed by RT-qPCR as in example 5, and bacterial RNA was extracted and reverse transcribed into cDNA template. The primers involved therein are as follows:
mpaB-qPCR-F：GTCCCAGATCCCAAGAACCG
mpaB-qPCR-R：CATCGCCTTCCTCAACCGAT
mpaG-qPCR-F：GTCATCAACAGCATTCCCGC
mpaG-qPCR-R：GAGGAGCACACGGGAGTAAC
mpaH-qPCR-F：GGAGACGCTTCGACCTTCAT
mpaH-qPCR-R：CCACCAATACCTGATCCGCA
by electrophoresis, the band brightness was observed, and as shown in FIG. 6a, RNA extraction from P.brevicompactum was confirmed to be successful.
The transcript levels of the three genes of the gene cluster are shown in FIG. 6c, in M2, the transcript levels of mpaB, mpaG and mpaH were 0.32 fold, 0.67 fold and 0.75 fold, respectively, compared to WT; in M4, the transcript levels of mpaB, mpaG and mpaH were 0.02-fold, 0.41-fold and 0.62-fold higher than that of WT, and thus in both of the pbpcz gene-silenced strains M2 and M4, the transcript levels of mpaB, mpaG and mpaH were reduced compared to wild-type strain WT, and in M4, to a greater extent, which was in full agreement with the results of the higher M2 strain than the M4 strain in MPA yield.
In this specification, the invention has been described with reference to specific embodiments thereof. It will be apparent, however, that various modifications and changes may be made without departing from the spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense.

Claims (10)

1. A PbPCZ zinc finger protein, characterized in that the amino acid sequence is as set forth in SEQ ID NO: 1.
2. A gene encoding a PbPCZ zinc finger protein according to claim 1, characterized by the nucleotide sequence:
1) As set forth in SEQ ID NO:2 is shown in the figure; or (b)
2) Sequences having more than 90% homology with the gene of 1).
3. A recombinant plasmid comprising a nucleotide sequence encoding the PbPCZ zinc finger protein of claim 1 and a vector plasmid.
4. The recombinant plasmid according to claim 3, wherein the vector plasmid is a plasmid constructed by taking RNAi plasmid pCAMBIA1303 as a backbone; alternatively, the vector plasmid is a plasmid constructed by taking pPK2 as a framework.
5. A transgenic cell line or expression cassette comprising a nucleotide sequence encoding the PbPCZ zinc finger protein of claim 1.
6. A recombinant bacterium, which is characterized by comprising a host bacterium and the recombinant plasmid of claim 3, wherein the host bacterium is Penicillium breve.
7. Use of the PbPCZ zinc finger protein or the gene encoding it according to claim 1 for promoting the growth of penicillium brevicompactum or increasing the yield of mycophenolic acid.
8. The use of the recombinant bacterium of claim 6 for producing mycophenolic acid.
9. The use according to claim 8, wherein mycophenolic acid is obtained by fermentation of recombinant bacteria.
10. A method for promoting the growth of penicillium brevicompactum or increasing the yield of mycophenolic acid, wherein the gene encoding the PbPCZ zinc finger protein of claim 1 is introduced or overexpressed in penicillium brevicompactum.
CN202310846344.3A 2023-07-11 2023-07-11 PbPCZ zinc finger protein, encoding gene and application thereof Pending CN116836247A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310846344.3A CN116836247A (en) 2023-07-11 2023-07-11 PbPCZ zinc finger protein, encoding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310846344.3A CN116836247A (en) 2023-07-11 2023-07-11 PbPCZ zinc finger protein, encoding gene and application thereof

Publications (1)

Publication Number Publication Date
CN116836247A true CN116836247A (en) 2023-10-03

Family

ID=88166840

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310846344.3A Pending CN116836247A (en) 2023-07-11 2023-07-11 PbPCZ zinc finger protein, encoding gene and application thereof

Country Status (1)

Country Link
CN (1) CN116836247A (en)

Similar Documents

Publication Publication Date Title
CN111454924B (en) Trichoderma viride histone acetylase encoding gene TvGCN5 and application thereof
US10612007B2 (en) Method for increasing citric acid production by Aspergillus niger fermentation
CN106715679A (en) Method for producing acetoin
CN105420154A (en) Double knockout recombinant rhodococcus as well as construction method and application thereof
WO2021143696A1 (en) Factor regulating protein expression efficiency of trichoderma reesei, and regulation method and use thereof
CN113106028A (en) Construction method and application of genetically engineered bacterium for high yield of cephalosporin C
CN110791439B (en) Recombinant aspergillus niger strain for fermentation production of malic acid by genetic engineering construction and application
CN102021185A (en) Function and usage of magnaporthe oryzae MoCHS1 gene and coded protein thereof
CN109666690B (en) Method for over-expressing non-trace trichoderma fungus gene
CN103834681B (en) A kind of method of Agrobacterium tumefaciens-mediated Transformation rice aspergillus
CN113969270A (en) Application of plant infection-related protein TaCIPK14 in regulation and control of stripe rust resistance of plants
CN116515649A (en) Transgenic method for improving heat stress resistance of beauveria bassiana
CN114107327B (en) Trichoderma viride high-temperature stress response key enzyme gene TvHSP70, recombinant expression vector, engineering bacteria and application thereof
CN116836247A (en) PbPCZ zinc finger protein, encoding gene and application thereof
CN105349441A (en) Trichoderma sp T23-Ovell bacterial strain high in spore yield, and construction method thereof
CN105062906B (en) A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme
CN115197957A (en) Gene fragment for improving crop straw decomposition of trichoderma guizhouense NJAU4742 in adversity and application thereof
CN102140446A (en) Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape
CN105524849A (en) Construction and application of cephalosporin high-yield gene engineering strain independent from methionine
CN113667688A (en) Trichoderma longibrachiatum plasmid vector and construction method and application thereof
CN106432497A (en) Method of using safflower carthamus suspension cells for producing CD20 antibody
CN106244614B (en) The structure of Trichoderma harzianum engineered strain with strong parasitic broad-spectrum fungi and its application
CN116751804B (en) Application of VdCreA gene in verticillium dahliae growth, pathogenicity and carbon metabolism inhibition
CN116751803B (en) Application of VdCreC gene in verticillium dahliae growth, pathogenicity and carbon metabolism inhibition
CN113980945B (en) Trichoderma viride histone deacetylase and encoding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination