CN116813729A - Rice endosperm flour related gene OsFLO24, encoding protein and application thereof - Google Patents

Abstract

The invention discloses a rice endosperm flour related protein FLO24, and a coding gene and application thereof. The invention passes through rice endosperm flour mutantflo24And (3) the phenotype analysis of the target gene and the preliminary positioning of the target gene, and finally cloning to obtain the endosperm flour related protein OsFLO24, wherein the related protein consists of an amino acid sequence shown in SEQ ID NO. 3. The protein related to the development of starch granules influences the synthesis process of rice endosperm starch, so that rice grains show a central pink phenotype, and the encoding gene of the protein is introduced into plants with abnormal starch granules to obtain starchThe powder fills normal transgenic plants, and therefore, the protein and the gene encoding the protein can be applied to genetic improvement of plants.

Description

Rice endosperm flour related geneOsFLO24And encoded proteins and uses thereof

Technical Field

The invention belongs to the field of genetic engineering, in particular to a rice endosperm flour related geneOsFLO24And encoding proteins and uses thereof.

Background

Rice is a staple food for nearly half of the population in the world. The continuous growth of the world population, particularly in asian regions, is continually placing higher demands on rice yield and quality. Ensuring the annual stable yield increase of rice yield, ensuring the safety and social stability of grains in the world, and improving the rice quality is also important. The amount of rice starch accumulation can affect seed size and weight, directly related to rice yield and quality. Meanwhile, the composition proportion of rice starch can influence the taste of the rice, and is closely related to the quality of the rice. In addition, starch is also a main energy source for seed germination and seedling emergence, and plays an important role in rice growth and development. Therefore, the rice starch forming mechanism is studied deeply, and the method has important practical application value and biological significance.

In higher plants, starch is the main carbohydrate of plant energy storage, present in large amounts in tubers, seeds, and is not only the main source of energy for humans, but also an important industrial raw material. Starch is the most important energy storage substance in plants, and although many enzymes and regulatory factors involved in starch synthesis have been identified, starch synthesis and starch granule development are complex processes. New key factors involved in regulating starch synthesis need further identification. The rice endosperm starch has the highest starch content and is the main energy source, and the structure and the property of the rice endosperm starch determine the appearance quality, the taste quality and the like of rice, so that the research of endosperm starch mutants has important significance.

Studies have shown that photosynthesis is the primary source of substances required for starch synthesis. The photosynthetic products are catalyzed and processed in plastids (chloroplasts and amyloplasts) by a series of enzymes to finally form starch. Key enzymes involved in starch synthesis mainly include: ADPG glucose pyrophosphorylase (AGPase), starch Synthase (SS), granule-bound starch synthase (Granule-bound starch synthase, GBSS), starch branching enzyme (Starch branching enzyme, SBE) and starch debranching enzyme (Debranching enzyme, DBE). Among them, GBSS is involved in amylose (amylose) synthesis, while SS, BE, DBE is associated with amylopectin (amylopectin) formation, and they are involved in the same starch synthesis pathway in chloroplasts and amyloplasts. The functions of these key enzymes are not only affected by the external environment (e.g., temperature, etc.), but they also have regulatory effects with respect to each other. The molecular mechanisms that regulate the starch synthesis pathway are still unclear. This requires us to locate and clone more regulatory factors to further reveal the molecular mechanism of starch synthesis.

Disclosure of Invention

The invention aims at disclosing a rice endosperm flour related geneOsFLO24And encoding proteins and uses thereof.

The gene provided by the inventionOsFLO24A DNA molecule as described in 1) or 2) or 3) or 4) below:

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

4) A DNA molecule which has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and which codes for a protein associated with starch synthesis in plants.

SEQ ID NO.2 of the sequence Listing consists of 3444 nucleotides.

The invention also provides a geneOsFLO24Encoded protein. Specifically, the protein provided by the invention is selected from any one of the following (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO.3, is related to starch synthesis and is derived from the SEQ ID NO. 3. SEQ ID NO.3 of the sequence Listing consists of 978 amino acids.

To facilitate purification of OsFLO24 in (b), a tag as shown in Table 1 may be attached to the amino-or carboxyl-terminus of a protein consisting of the amino acid sequence shown in SEQ ID NO. 3.

TABLE 1 sequence of tags

Label (Label)	Residues	Sequence(s)
			Poly-Arg	5-6 (usually 5	RRRRR
Poly-His	2-10 (in general) For 6	HHHHHH
			FLAG	8	DYKDDD DK
Strep-tag	8	WSHPQF EK
			c-myc	10	EQKLIS EEDL

The OsFLO24 in the above (b) may be synthesized artificially or may be obtained by synthesizing the encoding gene and then biologically expressing. The gene encoding OsFLO24 in (2) above can be obtained by deleting one or more amino acid residues in the DNA sequence shown in SEQ ID NO.1, and/or performing one or more base pair missense mutations, and/or ligating the coding sequences of the tags shown in Table 1 at the 5 '-end and/or the 3' -end thereof.

Recombinant expression vectors containing any of the above genes are also within the scope of the present invention.

Recombinant expression vectors containing the genes can be constructed using existing plant expression vectors.

The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal directs the addition of polyadenylation to the 3 'end of the mRNA precursor, and may be similarly functional in the untranslated regions transcribed from the 3' end of, for example, agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase Nos genes) and plant genes (e.g., soybean storage protein genes).

When the gene is used for constructing a recombinant plant expression vector, any one of an enhanced promoter or a constitutive promoter such as a cauliflower mosaic virus (CAMV) 35S promoter and a Ubiquitin promoter (Ubiquitin) of corn can be added before transcription initiation nucleotide, and the recombinant plant expression vector can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The recombinant over-expression vector can be obtained by inserting the gene into the recombination site of the restriction enzyme HindIII and BamHI double-enzyme cutting vector pCAMBIA1390OsFLO24) The recombinant plasmid obtained. Will containOsFLO24Named pCAMBIA1390-OsFLO24。The pCAMBIA139-OsFLO24Will be composed ofOsFLO24The genomic coding sequence was inserted into pCAMBIA by recombinant techniques together with the upstream 1960 bp promoter region and the downstream 662 bp fragment1390 between HindIII and BamHI (Clontech, information recombination kit).

Comprising any one of the above genesOsFLO24) The expression cassette, the transgenic cell line and the recombinant bacteria belong to the protection scope of the invention.

It is another object of the present invention to provide a method for the synthesis of starch from rice endosperm which fills normal transgenic plants.

The method for culturing transgenic plants with normal endosperm starch synthesis and filling provided by the invention is that the gene is introduced into plants with abnormal endosperm starch synthesis and filling to obtain transgenic plants with normal endosperm starch synthesis and filling; the transgenic plant with normal endosperm starch synthesis and filling is a transgenic plant with normal endosperm starch synthesis and filling capable of forming mature transparent endosperm. Specifically, the gene is introduced into an endosperm starch synthesis filling abnormal plant through the recombinant expression vector; the endosperm starch synthesis filling abnormality plant may beflo24Mutants.

The protein, the gene, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium or the method can be applied to rice breeding.

The gene encoding the protein is introduced into plant cells by using any vector capable of guiding the expression of exogenous genes in plants, and a transgenic cell line and a transgenic plant can be obtained. The expression vector carrying the gene may be transformed into plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants. The plant host to be transformed may be either a monocot or a dicot, such as: tobacco, radix et rhizoma Baimai, arabidopsis thaliana, rice, wheat, corn, cucumber, tomato, poplar, turf grass, alfalfa, etc.

The rice endosperm flour related protein of the invention affects the starch accumulation process in the rice endosperm. The coding gene of the protein is introduced into rice endosperm flour plants to obtain transgenic plants with normal endosperm starch filling. The protein and the coding gene thereof can be applied to genetic improvement of plants.

Drawings

FIG. 1 wild Ningjing No.3 and mutantflo24Wherein A, B is Ningjing No.3 dry seed and D, E is mutantflo24The dry seed and endosperm transection phenotype, C and F are Ningjing No.3 and mutant respectivelyflo24Cross-cutting endosperm to obtain a scanning electron microscope picture;

FIG. 2 wild Ningjing No.3 and mutantflo24Starch content determination and quality analysis, wherein A is starch viscosity spectrum, namely RVA spectrum, B is starch chain length distribution, C, D, E, F is total starch content, amylose content, fat content and total protein content of seeds respectively;

FIG. 3 wild Ningjing No.3 and mutantflo24Semi-thin section observation of developing endosperm, wherein A, B is wild Ningjing No.3 endosperm slice iodine-potassium iodide staining pattern, C is region enlargement of B pattern, D, E is mutantflo24Iodine-potassium iodide staining pattern, F is the enlarged region of E pattern;

FIG. 4 wild Ningjing No.3 and mutantflo24Transmission electron microscope observation of development endosperm, wherein A is starch granule morphology observed by Ningjing No.3 ultrathin transmission electron microscope, and B is mutantflo24Starch granule form observed by ultra-thin transmission electron microscope, C-G wild type is starch granule with different forms of Ningjing No.3, and H-L wild type is mutantflo24Starch granules of different morphology;

FIG. 5 map-based cloning of mutant genes, wherein A isflo24Fine positioning map, B isflo24Cloning the obtained gene and the mutation site thereof;

FIG. 6 phenotypic analysis of transgenic complementation lines, A is Ningjing No.3, mutantflo24And the whole and cross-section phenotype images of the dry seeds of the transgenic complementary families (L1, L2 and L3), B is a Western-Blot analysis image of the transgenic complementary families for detecting the protein content of the OsFLO24 by using Anti-FLO24, and the Anti-HSP82 is used as an internal correction reference.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.

Example 1 discovery of Rice starch Synthesis-related sites and genes encoding the same

1. Rice protein sorting mutantflo24Phenotypic analysis of (a)

Screening out mutant lines with opaque grain powder quality from MNU chemical mutagenesis mutant library of japonica rice variety Ningjing No.3flo24 . The wild type grain is transparent (see a in fig. 1, B in fig. 1), and compared to the wild type,flo24is mainly characterized by the quality of the grain, opacity (see D in FIG. 1, E in FIG. 1).flo24The endosperm is central opaque, which means that genetic mutations affect starch filling, resulting in changes in the structure and properties of the starch grains, which make the endosperm appear to be different in appearance.

For wild type and mutantflo24The cross section of the seeds is observed by a scanning electron microscope, the starch lamellar structure of the cross section of the wild type seeds is less different from that of the mutant, the arrangement is regular (see C in figure 1), and the mutantflo24The central portion exhibits a loose arrangement of starch particles (see F in fig. 1). For wild type and mutant flo24The rice quality measurement of (a) shows that the quality important parameter RVA spectrum (see A in figure 2) is greatly changed compared with the wild type, the chain length distribution of endosperm starch shows that the short chain starch in the mutant is obviously increased, the corresponding long chain starch is reduced, and the rice quality is obviously reduced (see B in figure 2). For wild type and mutantflo24Measurement of total starch, total fat, total protein and amylose in mature seeds revealed that the total starch content of endosperm in the mutant was significantly reduced (see C in FIG. 2), the amylose content was also reduced (see D in FIG. 2), and the protein and fat content was increased (see E, F in FIG. 2).

Semi-thin cutting observation of endosperm at early stages of development was performed to find wild-type developmentThe powder develops into uniform size, each powder contains several to more than ten starch particles, and the tortoise shell structure (see A, B and C in figure 3) of the powder can be clearly seen. In mutantsflo24In which dysplastic composite starch grains are seen, some endosperm cells in the central part are not filled or filled sparsely with starch grains, and the morphology of filled intact starch grains is also changed (see D, E, F in fig. 3). To resolve the morphology of starch granules, the endosperm of the metaphase stage was observed using a transmission electron microscope, and the morphology and structure of the wild-type starch granules were found to be complete (see a in fig. 4, C-G in fig. 4), whereas the starch granules in the mutant exhibited irregular morphology, and different types of starch granules were found to have dysplasia as shown in B in fig. 4, and H-L in fig. 4. It can be inferred from this that the mutant resulted in starch filling of the rice endosperm and that the development of starch granules was also affected, resulting in the center endosperm exhibiting a silhouette phenotype.

2. Map cloning of mutant Gene loci

1. Preliminary localization of target genes

By means of mutantsflo24Crossing with indica rice N22, inflo24Selecting 10 grains from F2 separation group of/N22flo24Recessive extreme individuals of phenotype (opaque grain quality) extract seed DNA. Linkage analysis of InDel and SSR markers using 182 covering the whole genome of rice will be responsibleflo24The mutant gene of the mutant phenotype is positioned between the InDel markers ID3-16 and ID3-21 of chromosome 3, and the interval is arranged near the centromere, and the physical distance is 7.5Mb.

2. Fine localization of target genes

According to the initial positioning result, searching a molecular marker on a public map between InDel markers ID3-16 and ID3-21, and automatically developing an SSR marker in the interval according to rice genome sequence information published by NCBI. And integrating the SSR markers of the public map with the rice genome sequence, and downloading BAC/PAC cloning sequences near the mutation sites. Searching for potential SSR sequences in clones (number of repetitions > 6) using SSRHENTER (Li Jiang et al, genetics, 2005, 27 (5): 808-810) or SSRIT on-line software (http:// archive. Gram. Org/db/markers/ssrtool); comparing the SSRs and sequences adjacent to 400-500 bp with corresponding indica rice sequences on line at NCBI through BLAST program, and preliminarily deducing that polymorphism exists between indica rice and japonica rice in PCR products of the SSR primers if the SSR repetition times of the SSR sequences are different; and then designing SSR primers by using Primer Premier 5.0 software, and synthesizing by Shanghai Yingjun biotechnology Co. The SSR paired primers designed by self are mixed in equal proportion, the polymorphism between N22 and Ningjing No.3 is detected, and the polymorphism is used as a molecular marker for fine positioning. Target genes were finely mapped using 1720 recessive extreme individuals (molecular markers for fine mapping are shown in Table 2).

TABLE 2 molecular markers for Fine localization

Finally, the target gene is obtainedOsFLO24Fine positioning is achieved between the marks Z-32 and Z-35 with a physical distance of 137 kb (see a in fig. 5). By sequencing the genes in this interval, it was found that single base substitutions exist on the 5 th exon of the 7 th ORF, resulting in single base substitutions of the target protein (B in FIG. 5).

3. Pink geneOsFLO24Is obtained by (a)

Extracting leaf cDNA of Ningjing 3 of japonica rice variety, using cDNA as template, adopting primer1 and primer2 to make PCR amplification, sequencing amplification product, its sequencing result is shown in SEQ ID NO.2, and its coded protein is shown in SEQ ID NO. 3.

primer1：5'-ATGGCCGCAGCGCCGCCGCTCGC-3'；

primer2：5'-TCAAACAGCCGGCAAAAATTTCTC-3'。

The protein shown in the sequence 3 in the sequence table is named as OsFLO24 protein and consists of 978 amino acid residues. The gene encoding OsFLO24 protein is named asOsFLO24The open reading frame of the gene is shown as SEQ ID NO. 2.

Example 2 OsFLO24 protein and application of encoding gene thereof

1. Recombinant expression vector construction (HindIII and BamHI cleavage vectors were used)

PCR amplification is carried out by taking genomic DNA of Ningjing No.3 (from rice germplasm resource library of Nanjing agricultural university) as a templateOsFLO24The sequences of the genes and PCR primers are as follows:

primer3：5'-CCGGCGCGCCAAGCTTTATCTCATTTTTGCGTCCGCCACTGG-3'；

primer4：5'-GAATTCCCGGGGA TCCAATAATTTGCCGCAAAACATTTTTGA-3'；

the amplification product of the above primer included the whole genome of the gene and a 2kb promoter region (SEQ ID NO.1 of the sequence Listing), and the PCR product was cloned into vector pCAMBIA1390 (vector digested with HindIII and BamHI) using INFUSION recombination kit (Japanese Takara Co.). Information recombination reaction System (10. Mu.L): 1.0. Mu.L of PCR product, 6.0. Mu.L of pCAMBIA1390, 2.0. Mu.L of 5X infusion buffer, infusion enzyme mix. Mu.L. After brief centrifugation, the mixture was subjected to a water bath at 50℃for 20 minutes, and 2.5. Mu.L of the reaction system was subjected to heat shock to transform E.coli DH 5. Alpha. Competent cells (Tiangen, beijing). All the transformed cells were uniformly spread on LB solid medium containing 50 mg/L kanamycin. After 16 h incubation at 37 ℃, clone positive clones were picked and sequenced. Sequencing results show that the recombinant expression vector containing the gene shown in SEQ ID NO.1 is obtained and containsOsFLO24Named pCAMBIA1390-OsFLO24，OsFLO24The gene fragment was inserted between HindIII and BamHI cleavage sites of the vector using the information recombination kit. .

2. Acquisition of recombinant Agrobacterium

pCAMBIA1390-OsFLO24 The Agrobacterium EHA105 strain (purchased from the United states of America, england) was transformed to obtain a recombinant strain, and the plasmid was extracted for PCR and restriction enzyme identification. The recombinant strain identified correctly by PCR and enzyme digestion is named EH-pCAMBIA1390-OsFLO24 。

The agrobacterium EHA105 strain was transformed using pCAMBIA1390 as control vector, as described above, to obtain a trans-empty vector control strain.

3. Acquisition of transgenic plants

EH-pCAMBIA1390 respectivelyOsFLO24Sum-turn no-loadMutant of body control strain transformed rice powder development abnormalityflo24The specific method comprises the following steps:

(1) EH-pCAMBIA1390 was cultured at 28 ℃OsFLO24(or a trans-empty vector control strain) for 16 hours, collecting the bacterial cells, and diluting the bacterial cells into an N6 liquid culture medium (Sigma Co., C1416) until the concentration is OD600 apprxeq 0.5 to obtain bacterial liquid;

(2) Will be cultured for one monthN65Mixing and infecting the mature embryo embryogenic callus of the rice with the bacterial liquid in the step (1) for 30 min, sucking the bacterial liquid by filter paper, transferring into a co-culture medium (N6 solid co-culture medium, sigma company), and co-culturing for 3 days at 24 ℃;

(3) Inoculating the callus of step (2) on N6 solid screening medium containing 100 mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100 mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 50 mg/L hygromycin for third screening, and carrying out secondary transfer every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; t of differentiated seedlings ₀ And (5) replacing positive plants.

4. Identification of transgenic plants

1. PCR molecular characterization

Hygromycin markers were used in this study to identify transgenic plants.

PCR reaction system for label analysis: DNA (20 ng/. Mu.L) 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmoL/. Mu.L) 2. Mu.L, 10xBuffer (MgCl) ₂ free) 2 μL，dNTP (10 mM) 0.4 μL， MgCl ₂ (25 mM) 1.2 μL，rTaq (5 U/μL) 0.4 μL，ddH ₂ O10. Mu.L, total volume 20. Mu.L.

The amplification reaction was performed on a PCR instrument: 94 ℃ for 3 min;94℃for 30 sec,56℃for 30 sec (primer difference, adjusted) for 1.5 min at 72℃for 34 cycles; and at 72℃for 5 min.

The PCR products were analyzed by agarose gel electrophoresis (1% agarose) and transgenic positive plants were determined based on the presence or absence of bands.

Primer5：5'- TAGGAGGGCGTGGATATGTC -3'；

Primer6：5'- TACACAGCCATCGGTCCAGA-3'

2. Phenotypic identification

Respectively T ₀ Substitution of pCAMBIA1390-OsFLO24 Positive plants, T ₀ Substitution-transfer empty vector control plants, mutantsflo24And Ningjing No.3 is planted in a transgenic test field of China academy of agricultural sciences. After seed maturation, seeds of each material were harvested and pCAMBIA1390 was observedOsFLO24 The presence of clear seeds in the seeds of the plants (see A in FIG. 6) and the Western-Blot analysis of the OsFLO24 protein content in the seeds using Anti-ClpB also demonstrated that the transgenic complementation lines restored the seed proteins (see B in FIG. 6). Thus proving thatflo24The mutant phenotype in (a) is that ofOsFLO24Is caused by the mutation of (a). pCAMBIA1390-OsFLO24 Can enableflo24The seeds of the strain regain a transparent phenotype.

Claims (10)

1. A rice endosperm flour related protein selected from any one of the group consisting of:

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) The amino acid sequence shown in SEQ ID NO.3 is substituted and/or deleted and/or added by one or a plurality of amino acid residues and still has gluten sorting related protein derived from the sequence 1.

2. The rice endosperm flour related protein of claim 1, characterized in that it is terminally augmented with a tag sequence, preferably Poly-Arg, poly-His, FLAG, strep-tag II, or c-myc.

3. A gene encoding the rice endosperm flour related protein of claim 1 or 2.

4. The gene according to claim 2, characterized in that: the gene is a DNA molecule as shown in any one of the following 1) to 4):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which codes for a protein according to SEQ ID NO. 3;

4) A DNA molecule which has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and which encodes a rice endosperm flour related DNA molecule.

5. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium comprising the gene of claim 3 or 4.

6. The recombinant expression vector of claim 5, wherein: the recombinant expression vector is a recombinant plasmid obtained by inserting the gene of claim 2 or 3 between the multiple cloning sites HindIII and BamHI of pCAMBIA1390 vector.

7. Use of at least one of the proteins of claim 1, the genes of claim 2 or 3, the recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria of claim 4 in plant breeding.

8. Use according to claim 6, characterized by its use for the cultivation of transgenic plants of good quality with normal starch synthesis.

9. A method for producing a transgenic plant having a normal starch synthesis pathway in rice, comprising introducing the gene of claim 2 or 3 into a plant having abnormal starch synthesis to obtain a transgenic plant having normal starch synthesis; wherein the starch synthesis is abnormal, which often results in abnormal endosperm filling and exhibits flouriness.

10. The method according to claim 8, wherein: the gene is introduced into a plant with abnormal starch synthesis through a recombinant expression vector, wherein the plant is a monocotyledonous plant or a dicotyledonous plant, preferably tobacco, a plant of the group consisting of Baimaigen, arabidopsis thaliana, rice, wheat, corn, cucumber, tomato, poplar, turf grass, and alfalfa.