CN116769884A - Application of microdroplet digital PCR in visual detection of HIV positive cells - Google Patents
Application of microdroplet digital PCR in visual detection of HIV positive cells Download PDFInfo
- Publication number
- CN116769884A CN116769884A CN202310938493.2A CN202310938493A CN116769884A CN 116769884 A CN116769884 A CN 116769884A CN 202310938493 A CN202310938493 A CN 202310938493A CN 116769884 A CN116769884 A CN 116769884A
- Authority
- CN
- China
- Prior art keywords
- hiv
- pcr
- cells
- droplet
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 38
- 230000000007 visual effect Effects 0.000 title claims abstract description 33
- 238000007847 digital PCR Methods 0.000 title claims abstract description 23
- 210000004027 cell Anatomy 0.000 claims abstract description 92
- 210000003819 peripheral blood mononuclear cell Anatomy 0.000 claims abstract description 40
- 208000030507 AIDS Diseases 0.000 claims abstract description 19
- 230000003321 amplification Effects 0.000 claims abstract description 18
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 18
- 239000012295 chemical reaction liquid Substances 0.000 claims abstract description 14
- 238000004925 denaturation Methods 0.000 claims abstract description 7
- 230000036425 denaturation Effects 0.000 claims abstract description 7
- 238000000137 annealing Methods 0.000 claims abstract description 6
- 239000000523 sample Substances 0.000 claims description 86
- 108090000623 proteins and genes Proteins 0.000 claims description 38
- 239000008055 phosphate buffer solution Substances 0.000 claims description 15
- 238000006243 chemical reaction Methods 0.000 claims description 14
- 210000004369 blood Anatomy 0.000 claims description 12
- 239000008280 blood Substances 0.000 claims description 12
- 238000002156 mixing Methods 0.000 claims description 12
- 239000000243 solution Substances 0.000 claims description 11
- 239000000725 suspension Substances 0.000 claims description 9
- 210000005087 mononuclear cell Anatomy 0.000 claims description 8
- 238000007789 sealing Methods 0.000 claims description 8
- 238000007865 diluting Methods 0.000 claims description 7
- 238000005119 centrifugation Methods 0.000 claims description 6
- 210000003743 erythrocyte Anatomy 0.000 claims description 6
- 239000012997 ficoll-paque Substances 0.000 claims description 5
- 210000005259 peripheral blood Anatomy 0.000 claims description 5
- 239000011886 peripheral blood Substances 0.000 claims description 5
- 239000002504 physiological saline solution Substances 0.000 claims description 5
- 238000007664 blowing Methods 0.000 claims description 4
- 239000006166 lysate Substances 0.000 claims description 4
- 239000006228 supernatant Substances 0.000 claims description 3
- 108020004707 nucleic acids Proteins 0.000 abstract description 15
- 150000007523 nucleic acids Chemical class 0.000 abstract description 15
- 102000039446 nucleic acids Human genes 0.000 abstract description 15
- 239000011248 coating agent Substances 0.000 abstract description 2
- 238000000576 coating method Methods 0.000 abstract description 2
- 241000725303 Human immunodeficiency virus Species 0.000 description 72
- 238000012360 testing method Methods 0.000 description 12
- 108020004445 glyceraldehyde-3-phosphate dehydrogenase Proteins 0.000 description 9
- 238000005516 engineering process Methods 0.000 description 8
- 102100031181 Glyceraldehyde-3-phosphate dehydrogenase Human genes 0.000 description 7
- 239000007788 liquid Substances 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 230000003834 intracellular effect Effects 0.000 description 4
- 241000700605 Viruses Species 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 239000013610 patient sample Substances 0.000 description 3
- 101001117114 Leucoagaricus meleagris Pyranose dehydrogenase 1 Proteins 0.000 description 2
- 101001117112 Leucoagaricus meleagris Pyranose dehydrogenase 2 Proteins 0.000 description 2
- 108700005077 Viral Genes Proteins 0.000 description 2
- 210000000987 immune system Anatomy 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000012800 visualization Methods 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 101150112014 Gapdh gene Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 230000001133 acceleration Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 210000000170 cell membrane Anatomy 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000000432 density-gradient centrifugation Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000005284 excitation Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 210000002865 immune cell Anatomy 0.000 description 1
- 230000002934 lysing effect Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000004806 packaging method and process Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000010839 reverse transcription Methods 0.000 description 1
- 230000000630 rising effect Effects 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of microdroplet digital PCR application, and discloses an application of microdroplet digital PCR in visual detection of HIV positive cells, which comprises the steps of uniformly coating PCR reaction liquid containing a peripheral blood mononuclear cell sample of an AIDS patient by microdroplet generating oil to generate microdroplets with cells, and then carrying out denaturation and annealing in a ddPCR program, so that PCR of all nucleic acids in the coated single cells is realized, namely, the visual observation of HIV nucleic acid amplification condition inside each cell on a cell level is realized.
Description
Technical Field
The invention relates to the technical field of microdroplet digital PCR application, in particular to application of microdroplet digital PCR in visual detection of HIV positive cells.
Background
Human immunodeficiency virus (Human Immunodeficiency Virus, HIV), an AIDS virus, is a virus that causes defects in the human immune system. The HIV virus is one kind of RNA virus, and is used to infect immune cell in human body, to integrate its own sequence into human genome sequence after reverse transcription, and to utilize the transcription and translation system of host cell to replicate great amount of virus and destroy the immune system of human body seriously.
At present, the detection of HIV is mainly carried out by RNA detection in whole blood, and a plurality of quantitative and qualitative detection modes of RNA, such as common PCR or q-PCR technology, are available on the market, but the technologies only carry out relative quantitative detection on viral genes from a nucleic acid layer, and cannot reflect the number or proportion of positive cells infected by HIV.
Accordingly, the prior art is still in need of improvement and development.
Disclosure of Invention
In view of the shortcomings of the prior art, the invention aims to provide an application of microdroplet digital PCR in visual detection of HIV positive cells, and aims to solve the problem that the prior PCR technology cannot realize visual detection of HIV infected positive cells.
The technical scheme of the invention is as follows:
an application of microdroplet digital PCR in the visual detection of HIV positive cells, comprising the steps of:
preparing an HIV PCR reaction solution in advance, wherein the HIV PCR reaction solution comprises a pretreated HIV patient peripheral blood mononuclear cell sample, an HIV gene primer, an HIV gene probe, an internal reference gene primer and an internal reference gene probe;
in the droplet generation area, adding HIV PCR reaction liquid into the sample adding hole of the droplet generation card, and adding droplet generation oil into the oil adding hole of the droplet generation card;
uniformly mixing HIV PCR reaction liquid in a droplet generation card with droplet generation oil, sealing the droplet generation card by using a sealing gasket, and placing the droplet generation card into a micro-droplet generator;
starting a droplet generator to enable droplet generation oil to wrap a peripheral blood mononuclear cell sample of an AIDS patient to form droplet suspension;
transferring the droplet suspension to a 96-well PCR plate and performing ddPCR amplification;
after ddPCR amplification is finished, the 96-hole PCR plate is placed in a microdroplet analyzer for fluorescent signal reading, and analysis software is used for analyzing the intensity and the number of fluorescent signals, so that the visualized detection of the HIV positive cells is realized.
The application of the microdroplet digital PCR in the visual detection of HIV positive cells, wherein the step of preparing HIV PCR reaction liquid in advance comprises the following steps:
diluting the acquired peripheral blood sample of the AIDS patient by adopting normal-temperature PBS (phosphate buffer solution) to obtain a diluted blood sample;
carrying out gradient centrifugation on the diluted blood sample in a Ficoll-Paque PLUS to obtain a mononuclear cell layer;
adding erythrocyte lysate into the mononuclear cell layer, blowing and mixing uniformly, adding PBS (phosphate buffer solution) for centrifugal treatment, and discarding the supernatant to obtain Peripheral Blood Mononuclear Cells (PBMC);
re-suspending and diluting the PBMC with 0.9% physiological saline solution, and adjusting the cell concentration to obtain a peripheral blood mononuclear cell sample of the AIDS patient;
mixing the peripheral blood mononuclear cell sample of the AIDS patient, the HIV gene primer, the HIV gene probe, the internal reference gene primer and the internal reference gene probe to obtain the HIV PCR reaction liquid.
Application of microdroplet digital PCR in visual detection of HIV positive cells, wherein the cell concentration in the peripheral blood mononuclear cell sample of the HIV patient is 6×10 6 personal/mL-2X 10 7 And each mL.
The application of the microdroplet digital PCR in the visual detection of HIV positive cells, wherein the HIV gene primer comprises a forward primer shown as SEQ ID NO.1 and a reverse primer shown as SEQ ID NO. 2; the sequence of the HIV gene probe is shown as SEQ ID NO. 3; the internal reference gene primer comprises a forward primer shown as SEQ ID NO.4 and a reverse primer shown as SEQ ID NO. 5; the sequence of the reference gene probe is shown as SEQ ID NO. 6.
The application of the microdroplet digital PCR in the visual detection of HIV positive cells, wherein in the steps of transferring the microdroplet suspension into a 96-well PCR plate and performing ddPCR amplification, the conditions of ddPCR amplification are set as follows:
denaturation temperature, 94 ℃,30s,1 time;
annealing temperature, 94 ℃, for 5s;
the temperature was extended, 60℃and 35s, and the cycle was 49 times.
The beneficial effects are that: the invention provides an application of microdroplet digital PCR in visual detection of HIV positive cells, which comprises the steps of uniformly coating PCR reaction liquid containing peripheral blood mononuclear cell samples of an HIV patient by microdroplet generating oil to generate microdroplets with cells, and then carrying out denaturation and annealing in ddPCR program, thereby realizing PCR of all nucleic acids in the coated single cells, namely realizing visual observation of HIV nucleic acid amplification condition in each cell on a cell level.
Drawings
FIG. 1 is a flow chart showing the application of microdroplet digital PCR in the visual detection of HIV positive cells.
FIG. 2 is a schematic diagram of water-in-oil droplet generation.
FIG. 3A shows a positive/negative droplet scattergram of the internal gene GAPDH, and B shows HIV + cell/HIV - Cell scatter plots.
In fig. 4, a is a visual representation of a droplet for detecting intracellular reference GAPDH when the total number of sample cells is 30000 per well, and B is a visual representation of a droplet for detecting intracellular reference GAPDH when the total number of sample cells is 100000 per well.
HIV detection at 30000 cells/well in sample number 1A in FIG. 5 + Liquid of cells (LTR-Gag primer)Drop visual presentation diagram, and detection of HIV (human immunodeficiency Virus) when total number of cells loaded on sample No.1 is 100000/hole + The droplets of cells (LTR-Gag primer) are visualized.
In fig. 6, a is a visual representation of a droplet for detecting intracellular reference GAPDH when the total number of sample cells is 30000 per well, and B is a visual representation of a droplet for detecting intracellular reference GAPDH when the total number of sample cells is 100000 per well.
HIV detection at 30000 cells/well in sample number 5A in FIG. 7 + Liquid drop visual presentation diagram of cells (LTR-Gag primer), and detection of HIV (human immunodeficiency Virus) when total number of cells loaded on sample No.5 is 100000/hole + The droplets of cells (LTR-Gag primer) are visualized.
Detailed Description
The invention provides an application of microdroplet digital PCR in visual detection of HIV positive cells, which is further described in detail below in order to make the purposes, technical schemes and effects of the invention clearer and more definite. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
The conventional PCR or q-PCR technology only carries out relative quantitative detection on viral genes or genomic DNA from a nucleic acid layer, and the conventional ddPCR technology also directly carries out amplification on HIV nucleic acid, and the PCR technology does not directly wrap cells through liquid drops and carries out PCR on the DNA wrapped by the cells in a water-in-oil liquid drop environment, so that the amplification condition of the HIV nucleic acid inside each cell cannot be visually observed on the cell layer.
Based on this, the invention provides an application of microdroplet digital PCR in the visual detection of HIV positive cells, as shown in figure 1, comprising the steps of:
s10, preparing an HIV PCR reaction solution in advance, wherein the HIV PCR reaction solution comprises a pretreated HIV patient peripheral blood mononuclear cell sample, an HIV gene primer, an HIV gene probe, an internal reference gene primer and an internal reference gene probe;
s20, in a droplet generation area, adding an HIV PCR reaction solution into a sample adding hole of a droplet generation card, and adding droplet generation oil into an oil adding hole of the droplet generation card;
s30, uniformly mixing the HIV PCR reaction liquid in the droplet generation card with the droplet generation oil, sealing the droplet generation card by using a sealing gasket, and placing the droplet generation card into a micro-droplet generator;
s40, starting a droplet generator to enable droplet generation oil to wrap a peripheral blood mononuclear cell sample of an AIDS patient to form droplet suspension;
s50, transferring the droplet suspension into a 96-well PCR plate and performing ddPCR amplification;
s60, after ddPCR amplification is finished, placing the 96-hole PCR plate in a microdroplet analyzer for fluorescent signal reading, and analyzing the intensity and the number of fluorescent signals by using analysis software to realize the visual detection of the HIV positive cells.
The PCR reaction liquid containing the peripheral blood mononuclear cell sample of the AIDS patient is uniformly wrapped by the microdroplet generating oil to generate microdroplets with cells, then the cell membranes in the microdroplets are cracked by denaturation and annealing in a ddPCR program, namely in a 94 ℃ environment, and the PCR work flow is started, so that the PCR of all nucleic acids in the single cells wrapped by the microdroplets is realized, and the visible observation of the amplification condition of HIV nucleic acid in each cell on the cell level is realized.
In some embodiments, as shown in FIG. 2, the step of preparing the HIV PCR reaction solution in advance comprises: diluting the acquired peripheral blood sample of the AIDS patient by adopting normal-temperature PBS (phosphate buffer solution) to obtain a diluted blood sample; carrying out gradient centrifugation on the diluted blood sample in a Ficoll-Paque PLUS to obtain a mononuclear cell layer; adding erythrocyte lysate into the mononuclear cell layer, blowing and mixing uniformly, adding PBS (phosphate buffer solution) for centrifugal treatment, and discarding the supernatant to obtain PBMC (PBMC); re-suspending and diluting PBMC with 0.9% physiological saline solution, and adjusting concentration to obtain peripheral blood mononuclear cell sample of AIDS patient; mixing the peripheral blood mononuclear cell sample of the AIDS patient, the HIV gene primer, the HIV gene probe, the internal reference gene primer and the internal reference gene probe to obtain the HIV PCR reaction liquid containing the peripheral blood mononuclear cells of the AIDS patient.
In this example, the HIV gene primer includes a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.2, wherein the forward primer shown in SEQ ID NO.1 is denoted as LTR-gag-F, and the sequence thereof is: GCCTCAATAAAGCTTGCCTTGA; the reverse primer shown in SEQ ID NO.2 is denoted as LTR-gag-R, and the sequence thereof is: GGCGCCACTGCTAGAGTTTT; the sequence of the HIV gene probe is shown as SEQ ID NO.3, and is marked as LTR-gag-probe, and the sequence is as follows: TGTGACTCTGGTAACTAGAACCCTCAGAC; the internal reference gene primer comprises a forward primer shown as SEQ ID NO.4 and a reverse primer shown as SEQ ID NO.5, wherein the forward primer shown as SEQ ID NO.4 is named PDH-1, and the sequence of the forward primer is: the reverse primer shown in TGAAAGTTATACAAAATTGAGGTCACTGTT, SEQ ID No.5 was designated PDH-2, which has the sequence: TCCACAGCCCTCGACTAACC; the sequence of the reference gene probe is shown as SEQ ID NO.6, and is recorded as a PDH-probe, and the sequence of the reference gene probe is as follows: CCCCCAGATACACTTAAGGGATCAACTCTTAATTGT.
In this embodiment, the cell concentration in the peripheral blood mononuclear cell sample of the aids patient is: 6X 10 6 personal/mL-2X 10 7 And each mL.
The invention is further illustrated by the following examples:
an application of microdroplet digital PCR in the visual detection of hiv positive cells, comprising the steps of:
1. peripheral Blood Mononuclear Cells (PBMC) of an AIDS patient are isolated by adopting a Ficoll-Paque PLUS density gradient centrifugation method, and the method comprises the following steps of:
blood dilution: peripheral blood samples of aids patients were subjected to 1:1 diluting (in a blood collection tube), lightly and uniformly mixing by using a rubber head dropper to obtain a diluted blood sample, and slowly adding the diluted blood sample on 5mL of Ficoll-Paque PLUS;
gradient centrifugation: the diluted blood sample was centrifuged at 2000rpm for 20 minutes at 18-20 c, after which the centrifuge was set to pre-cool at 4 c (program 3), the up-down acceleration of the centrifuge was adjusted to the minimum as possible, and the parameters were adjusted as follows: the rising speed is 1, the falling speed is 0, and the brake vibration after the centrifugation is finished can be prevented, and the layering is disturbed;
white film absorption: transferring the mononuclear cell layer obtained by gradient centrifugation into a 15mL centrifuge tube containing 6mL of precooled PBS by using a sterile dropper carefully, and adding the precooled PBS to supplement to 15mL;
and (3) centrifuging: centrifuging at 1500rpm for 5 minutes at 4 ℃, leaving a layer of cells;
lysing erythrocytes: adding 3mL of erythrocyte lysate (EL buffer) into the cells, blowing and mixing the cells uniformly, cracking the erythrocytes at room temperature for 5min, adding PBS to 10mL, centrifuging at 1500rpm/min, and 5min;
re-suspending after washing with 0.9% physiological saline, counting, and sub-packaging with 200 μl/tube;
finally, the mixture is respectively mixed with 0.9 percent of physiological saline solution according to the ratio of 6 multiplied by 10 6 Per mL, 2X 10 7 The PBMC are diluted by one/mL to obtain peripheral blood mononuclear cell samples of the AIDS patients.
2. Droplet-type ddPCR experiments:
mu.L of HIV peripheral blood sample +1.25. Mu.L of LTR-gag-F (10. Mu.M) +1.25. Mu.L of LTR-gag-R (10. Mu.M) +0.625. Mu.L of LTR-gag-probe (10. Mu.M) +1.25. Mu.L of PDH-1 (10. Mu.M) +1.25. Mu.L of PDH-2 (10. Mu.M) +0.625. Mu.L of PDH-probe (10. Mu.M) +5. Mu.L of cell template (cell concentration 6X 10) 6 Per mL, 2X 10 7 Mixing the above materials with 1.25 mu L ddPCR water to obtain HIV PCR reaction solution;
wherein, the sequences of the LTR segment primer and LTR probe of the HIV gene and the internal reference GAPDH gene primer and GAPDH probe are shown in Table 1:
3. generation of droplets:
in the droplet-generating area, 25. Mu.L of HIV PCR reaction solution was added to the well of the droplet-generating card, and then 70. Mu.L of droplet-generating oil was added to the well of the droplet-generating card. After the reaction liquid of the microdroplet and the oil are uniformly mixed, sealing the microdroplet generating card by using a sealing gasket, placing the card into a microdroplet generator, starting the microdroplet generator and generating microdroplets; after about 2 minutes, droplet preparation was complete, the cartridge was removed, and 40 μl of droplet suspension was removed from the uppermost row of wells to a 96-well PCR plate.
4. Amplification read conditions and dd PCR condition settings:
PCR procedure:
denaturation temperature, 94 ℃,30s,1 time;
annealing temperature, 94 ℃, for 5s;
the temperature is extended, the temperature is 60 ℃, the temperature is 35s, and the cycle is 49 times;
after the PCR amplification is finished, the 96-well plate is placed in a microdroplet analyzer, and a FAM/HEX channel is selected for signal reading.
5. Analysis and statistics:
analyzing the intensity and the number of the fluorescent signals by using QuantaSoft analysis software; the proportion of the negative/positive droplets can be judged according to the presence or absence and the intensity of the fluorescent signal.
The implementation utilizes a method that a microfluidic technology in a droplet generator can generate 'water-in-oil' droplets, and the method is used for wrapping virus PCR reaction liquid containing Peripheral Blood Mononuclear Cells (PBMC) to form droplets; then carrying out a denaturation step at 94 ℃ in the PCR program, and carrying out lysis on cells wrapped in single liquid drops to expose nucleic acid components as templates for the next PCR; then, the enzyme, the template and the primer are combined in the PCR reaction system to react, so that PCR nucleic acid amplification reaction is carried out in the microdroplet wrapped by the single cell. The laser signal in the nucleic acid product of the droplet PCR system is passed through each droplet one by an excitation detector similar to a flow cytometer to form digital and pictorial signals. Finally, the visualization of positive cells and the differentiation of the proportion of positive cells from negative cells of the nucleic acid target fragment are realized through the reaction and the application of the technology. And because the liquid drop PCR detection device is provided with a plurality of fluorescent channels, the multi-target and multi-site detection of the same cell can be realized.
In the visual detection of samples 1-8 by using the microdroplet digital PCR method in example 1, samples 1-8 are all peripheral blood mononuclear cell samples of clinically confirmed AIDS patients. Wherein, samples 1-4 are from the same patient sample and samples 5-8 are from another patient sample. And the total number of cell loads in sample No.1, no.2, no.5, no.6 was 30000 cells/well. The total number of cell loads in sample No.3, sample No.4, sample No. 7, sample No. 8 was 100000 cells/well.
FIG. 3A shows a positive/negative droplet scattergram of the internal gene GAPDH, and FIG. 3B shows HIV + cell/HIV - Cell droplet scatter plot. From the figure it can be seen that ddPCR enables HIV virus visualization of PBMC.
In fig. 4, a is test data in a sample PB MC of an aids patient with a total number of 30000 cells/hole in sample No.1, B is test data in a sample PBMC of an aids patient with a total number of 100000 cells/hole in sample No.1, the test data is specifically a visual representation of a cell droplet of a ddPCR detection internal reference GAPDH, a blue negative droplet, and a orange positive droplet.
In fig. 5, a is test data in a sample PB MC of an aids patient with a total number of 1 sample cells of 30000 cells/well, B is test data in a sample PBMC of an aids patient with a total number of 1 sample cells of 100000 cells/well, and the test data is specifically a visual representation of a cell droplet of ddPCR detection HIV (LTR-Gag primer), a blue negative droplet, and a orange red positive droplet.
In fig. 6, a is test data in a sample PB MC of an aids patient with a total number of 30000 cells/hole in sample No.5, B is test data in a sample PBMC of an aids patient with a total number of 100000 cells/hole in sample No.5, the test data is specifically a visual representation of a cell droplet of a ddPCR detection internal reference GAPDH, a blue negative droplet, and a orange positive droplet.
In fig. 7, a is test data in a sample PB MC of an aids patient with a total number of 30000 cells/hole in sample No.5, B is test data in a sample PBMC of an aids patient with a total number of 100000 cells/hole in sample No.5, and the test data is specifically a visual representation of a cell droplet of a ddPCR detection HIV (LTR-Gag primer), a blue negative droplet, and a orange red positive droplet. The results of FIGS. 4-7 all illustrate that ddPCR can be directly visualized to detect HIV nucleic acid amplification within mononuclear cells of AIDS patients.
It is to be understood that the invention is not limited in its application to the examples described above, but is capable of modification and variation in light of the above teachings by those skilled in the art, and that all such modifications and variations are intended to be included within the scope of the appended claims.
Claims (5)
1. An application of microdroplet digital PCR in the visual detection of hiv positive cells, comprising the steps of:
preparing an HIV PCR reaction solution in advance, wherein the HIV PCR reaction solution comprises a pretreated HIV patient peripheral blood mononuclear cell sample, an HIV gene primer, an HIV gene probe, an internal reference gene primer and an internal reference gene probe;
in the droplet generation area, adding HIV PCR reaction liquid into the sample adding hole of the droplet generation card, and adding droplet generation oil into the oil adding hole of the droplet generation card;
uniformly mixing HIV PCR reaction liquid in a droplet generation card with droplet generation oil, sealing the droplet generation card by using a sealing gasket, and placing the droplet generation card into a micro-droplet generator;
starting a droplet generator to enable droplet generation oil to wrap a peripheral blood mononuclear cell sample of an AIDS patient to form droplet suspension;
transferring the droplet suspension to a 96-well PCR plate and performing ddPCR amplification;
after ddPCR amplification is finished, the 96-hole PCR plate is placed in a microdroplet analyzer for fluorescent signal reading, and analysis software is used for analyzing the intensity and the number of fluorescent signals, so that the visualized detection of the HIV positive cells is realized.
2. The use of microdroplet digital PCR in the visual detection of hiv positive cells according to claim 1, wherein the step of preparing in advance the hiv PCR reaction solution comprises:
diluting the acquired peripheral blood sample of the AIDS patient by adopting normal-temperature PBS (phosphate buffer solution) to obtain a diluted blood sample;
carrying out gradient centrifugation on the diluted blood sample in a Ficoll-Paque PLUS to obtain a mononuclear cell layer;
adding erythrocyte lysate into the mononuclear cell layer, blowing and mixing uniformly, adding PBS (phosphate buffer solution) for centrifugal treatment, and discarding the supernatant to obtain Peripheral Blood Mononuclear Cells (PBMC);
re-suspending and diluting the PBMC with 0.9% physiological saline solution, and adjusting the cell concentration to obtain a peripheral blood mononuclear cell sample of the AIDS patient;
mixing the peripheral blood mononuclear cell sample of the AIDS patient, the HIV gene primer, the HIV gene probe, the internal reference gene primer and the internal reference gene probe to obtain the HIV PCR reaction liquid.
3. The use of microdroplet digital PCR according to claim 2, wherein the concentration of cells in the peripheral blood mononuclear cell sample of the aids patient is between 6 x 106 cells/mL and 2 x 107 cells/mL.
4. The use of microdroplet digital PCR in the visual detection of hiv positive cells according to claim 2, wherein the hiv gene primers include a forward primer shown in SEQ ID No.1 and a reverse primer shown in SEQ ID No. 2; the sequence of the HIV gene probe is shown as SEQ ID NO. 3; the internal reference gene primer comprises a forward primer shown as SEQ ID NO.4 and a reverse primer shown as SEQ ID NO. 5; the sequence of the reference gene probe is shown as SEQ ID NO. 6.
5. Use of microdroplet digital PCR according to claim 1 for visualising hiv positive cells, wherein in the step of transferring the microdroplet suspension into a 96-well PCR plate and performing ddPCR amplification, the conditions for ddPCR amplification are set as follows:
denaturation temperature, 94 ℃,30s,1 time;
annealing temperature, 94 ℃, for 5s;
the temperature was extended, 60℃and 35s, and the cycle was 49 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310938493.2A CN116769884A (en) | 2023-07-27 | 2023-07-27 | Application of microdroplet digital PCR in visual detection of HIV positive cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310938493.2A CN116769884A (en) | 2023-07-27 | 2023-07-27 | Application of microdroplet digital PCR in visual detection of HIV positive cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116769884A true CN116769884A (en) | 2023-09-19 |
Family
ID=88008241
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310938493.2A Pending CN116769884A (en) | 2023-07-27 | 2023-07-27 | Application of microdroplet digital PCR in visual detection of HIV positive cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116769884A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN110684864A (en) * | 2018-07-06 | 2020-01-14 | 苏州云泰生物医药科技有限公司 | Microdroplet digital PCR kit for quantitatively detecting human cytomegalovirus and detection method |
| CN112813196A (en) * | 2020-12-31 | 2021-05-18 | 广州微远基因科技有限公司 | Capture probe set, method and kit for detecting pathogenic microorganisms and application |
| US20220228193A1 (en) * | 2017-07-10 | 2022-07-21 | Oxford University Innovation Limited | Methods to detect cells latently infected with hiv |
-
2023
- 2023-07-27 CN CN202310938493.2A patent/CN116769884A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| US20220228193A1 (en) * | 2017-07-10 | 2022-07-21 | Oxford University Innovation Limited | Methods to detect cells latently infected with hiv |
| CN110684864A (en) * | 2018-07-06 | 2020-01-14 | 苏州云泰生物医药科技有限公司 | Microdroplet digital PCR kit for quantitatively detecting human cytomegalovirus and detection method |
| CN112813196A (en) * | 2020-12-31 | 2021-05-18 | 广州微远基因科技有限公司 | Capture probe set, method and kit for detecting pathogenic microorganisms and application |
Non-Patent Citations (1)
| Title |
|---|
| 张丽丽 等: "艾滋病模型中关键指标SIV DNA绝对定量微滴式数字PCR技术的创新应用", 中国比较医学杂志, vol. 30, no. 05, pages 27 - 30 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20080241841A1 (en) | Method and apparatus for sample preparation | |
| AU2004209001B2 (en) | Bead emulsion nucleic acid amplification | |
| CA2996219C (en) | Emulsion chemistry and assays for encapsulated droplets | |
| US20200277653A1 (en) | Analyte Enrichment Methods and Compositions | |
| CN101736087A (en) | Method for digitally detecting micro-mutation by using micro-emulsion clone amplified bound water gel microsphere chip | |
| CN111500690A (en) | Method for detecting copy number of virus vector in CAR-T cell genome | |
| AU2024203320A1 (en) | Microdroplet manipulation method | |
| CN116769884A (en) | Application of microdroplet digital PCR in visual detection of HIV positive cells | |
| CN111718984A (en) | Method for STR typing of forensic mixed DNA sample | |
| Wang et al. | An integrated digital PCR system with high universality and low cost for nucleic acid detection | |
| US20150159224A1 (en) | Ultrasensitive detection and characterization of clustered kras mutations using peptide nucleic acid clamp pcr in drop-based microfluidics | |
| CN114921557A (en) | Primer probe combination and reaction system for T790M and C797S mutation and cis-trans detection | |
| US20230045126A1 (en) | Devices and methods for determining nucleic acids using digital droplet pcr and related techniques | |
| CN111893201A (en) | Reagent and kit for detecting 4 babesia by isothermal amplification and application of reagent and kit | |
| CN112779324A (en) | Method for single cell detection and analysis and uses thereof | |
| CN212955181U (en) | Digital PCR kit for detecting novel coronavirus nucleic acid | |
| US20100184024A1 (en) | Method of Characterizing Nucleic Acids in a Mixed Sample | |
| CN107083430A (en) | A kind of kit and its detection method for detecting mankind's KRAS gene mutation | |
| CN116064830B (en) | Multiple qPCR (quantitative polymerase chain reaction) cassava mealybugs identification method and application | |
| CN118166077A (en) | Method for detecting nucleic acid integrity based on digital PCR | |
| CN114752671A (en) | Digital PCR kit, primer and probe for detecting peripheral T cell lymphoma related gene mutation | |
| CN117867154A (en) | LAMP primer group for detecting plasmodium falciparum, microfluidic chip and detection method | |
| Shi et al. | A Microfluidic Chip for Circulating Tumor Cells RNA Sequencing at Single Cell Level | |
| EP4419711A1 (en) | High stokes shift fluorescence dyes for multiplex detection | |
| CN116479122A (en) | Human EZH2 gene Y646 locus mutation digital PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |