CN116769884A - Application of droplet digital PCR in visual detection of HIV-positive cells - Google Patents

Abstract

The invention relates to the technical field of microdroplet digital PCR application, and discloses an application of microdroplet digital PCR in visual detection of HIV positive cells, which comprises the steps of uniformly coating PCR reaction liquid containing a peripheral blood mononuclear cell sample of an AIDS patient by microdroplet generating oil to generate microdroplets with cells, and then carrying out denaturation and annealing in a ddPCR program, so that PCR of all nucleic acids in the coated single cells is realized, namely, the visual observation of HIV nucleic acid amplification condition inside each cell on a cell level is realized.

Description

A droplet digital PCR for visual detection of HIV-positive cells application

Technical field

The invention relates to the technical field of droplet digital PCR application, and in particular to the application of droplet digital PCR in the visual detection of HIV-positive cells.

Background technique

Human Immunodeficiency Virus (HIV), also known as AIDS (Acquired Immunodeficiency Syndrome) virus, is a virus that causes defects in the human immune system. HIV is an RNA virus that mainly infects immune cells in the human body. The HIV virus that enters the human body integrates its own sequence into the human genome sequence after reverse transcription, and then uses the transcription and translation system of the human host cell to replicate a large number of viruses. Seriously damage the body's immune system.

At present, HIV detection is still based on RNA detection in whole blood. There are many quantitative and qualitative detection methods of RNA on the market, such as ordinary PCR or q-PCR technology. However, these technologies only perform relatively quantitative detection of viral genes from the nucleic acid level. The number or proportion of positive cells that cannot reflect HIV infection.

Therefore, the existing technology still needs to be improved and developed.

Contents of the invention

In view of the shortcomings of the above-mentioned existing technologies, the purpose of the present invention is to provide an application of droplet digital PCR in the visual detection of HIV-positive cells, aiming to solve the problem that existing PCR technology cannot realize the visualization of HIV-positive cells. Detection issues.

The technical solution of the present invention is as follows:

An application of droplet digital PCR in visual detection of HIV-positive cells, which includes the following steps:

Preparing an HIV PCR reaction solution in advance, which includes pretreated peripheral blood mononuclear cell samples of AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes;

In the droplet generation area, add the HIV PCR reaction solution to the sampling hole of the droplet generation card, and add the droplet generation oil to the oil filling hole of the droplet generation card;

After the HIV PCR reaction solution and the droplet generation oil in the droplet generation card are evenly mixed, the droplet generation card is sealed with a sealing gasket and placed in the droplet generator;

Start the microdroplet generator to make the microdroplet generate oil to wrap the peripheral blood mononuclear cell sample of the AIDS patient to form a microdroplet suspension;

Transfer the droplet suspension to a 96-well PCR plate and perform ddPCR amplification;

After the ddPCR amplification is completed, place the 96-well PCR plate in a droplet analyzer to read the fluorescence signal, and use analysis software to analyze the intensity and number of the fluorescence signal to achieve visual detection of HIV-positive cells.

The application of droplet digital PCR in visual detection of HIV-positive cells, wherein the steps of pre-preparing HIV PCR reaction solution include:

Use normal temperature PBS to dilute the peripheral blood samples obtained from AIDS patients to obtain diluted blood samples;

Perform gradient centrifugation on the diluted blood sample in Ficoll-Paque PLUS to obtain a mononuclear cell layer;

Add red blood cell lysis solution to the mononuclear cell layer, mix by pipetting, then add PBS for centrifugation, and discard the supernatant to obtain peripheral blood mononuclear cells (PBMC);

Resuspend and dilute PBMC in 0.9% physiological saline solution, and adjust the cell concentration to obtain peripheral blood mononuclear cell samples from AIDS patients;

Mix the peripheral blood mononuclear cell samples of AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes to obtain an HIV PCR reaction solution.

The application of the droplet digital PCR in the visual detection of HIV-positive cells, wherein the cell concentration in the peripheral blood mononuclear cell sample of the AIDS patient is 6×10 ⁶ /mL-2×10 ⁷ /mL .

Application of the droplet digital PCR in visual detection of HIV-positive cells, wherein the HIV gene primers include the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.2 forward primer; the sequence of the HIV gene probe is shown in SEQ ID NO.3; the internal reference gene primer includes the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.5. primer; the sequence of the internal reference gene probe is shown in SEQ ID NO. 6.

The application of the droplet digital PCR in the visual detection of HIV-positive cells, wherein in the step of transferring the droplet suspension to a 96-well PCR plate and performing ddPCR amplification, the conditions for ddPCR amplification are set As follows:

Denaturation temperature, 94°C, 30s, 1 time;

Annealing temperature, 94°C, 5s;

Extension temperature, 60°C, 35s, 49 cycles.

Beneficial effects: The present invention provides an application of droplet digital PCR in the visual detection of HIV-positive cells. First, the PCR reaction solution containing the peripheral blood mononuclear cell sample of an AIDS patient is evenly wrapped with oil generated by the droplets to generate a cell-like reaction solution. The droplets are then denatured and annealed in the ddPCR program to achieve PCR of all the nucleic acids in the single cells they are wrapped in, that is, to visually observe the HIV nucleic acid amplification inside each cell at the cellular level.

Description of drawings

Figure 1 is a flow chart of the application of droplet digital PCR in visual detection of HIV-positive cells provided by the present invention.

Figure 2 is a schematic diagram of the generation of water-in-oil droplets.

In Figure 3, A is a scatter plot of positive droplets/negative droplets of the internal reference gene GAPDH, and B is a scatter plot of HIV ⁺ cells/HIV ^- cells.

In Figure 4, A is a visual representation of the liquid droplets used to detect the internal reference GAPDH when the total number of cells loaded in sample No. 1 is 30,000 cells/well, and B is the liquid droplet used to detect the internal reference GAPDH in the cells when the total number of cells loaded in sample No. 1 is 100,000 cells/well. Drop visualization diagram.

In Figure 5, A is a visual presentation of droplets for detecting HIV ⁺ cells (LTR-Gag primer) when the total number of cells loaded in sample No. 1 is 30,000 cells/well, and B is when the total number of cells loaded in sample No. 1 is 100,000 cells/well. Visual representation of droplets detecting HIV ⁺ cells (LTR-Gag primer).

In Figure 6, A is a visual representation of the droplet used to detect the internal reference GAPDH when the total number of cells loaded in sample No. 5 is 30,000 cells/well, and B is the liquid droplet used to detect the internal reference GAPDH in the cell when the total number of cells loaded in sample No. 1 is 100,000 cells/well. Drop visualization diagram.

In Figure 7, A is a visual presentation of droplets for detecting HIV ⁺ cells (LTR-Gag primer) when the total number of cells loaded in sample No. 5 is 30,000 cells/well, and B is when the total number of cells loaded in sample No. 5 is 100,000 cells/well. Visual representation of droplets detecting HIV ⁺ cells (LTR-Gag primer).

Detailed ways

The present invention provides an application of droplet digital PCR in the visual detection of HIV-positive cells. In order to make the purpose, technical solution and effect of the present invention clearer and clearer, the present invention is further described in detail below. It should be understood that the specific embodiments described here are only used to explain the present invention and are not intended to limit the present invention.

Ordinary PCR or q-PCR technology only performs relatively quantitative detection of viral genes or genomic DNA from the nucleic acid level. The existing ddPCR also directly amplifies HIV nucleic acid. These PCR technologies do not directly wrap cells through droplets and PCR is performed on the wrapped DNA in a water-in-oil droplet environment, so it is not possible to visually observe the HIV nucleic acid amplification inside each cell at the cellular level.

Based on this, the present invention provides an application of droplet digital PCR in visual detection of HIV-positive cells, as shown in Figure 1, which includes the steps:

S10. Prepare an HIV PCR reaction solution in advance. The HIV PCR reaction solution includes pretreated peripheral blood mononuclear cell samples of AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes;

S20. In the droplet generation area, add the HIV PCR reaction solution to the sampling hole of the droplet generation card, and add the droplet generation oil to the oil filling hole of the droplet generation card;

S30. After mixing the HIV PCR reaction solution and the droplet generation oil in the droplet generation card evenly, seal the droplet generation card with a sealing gasket and place it in the droplet generation instrument;

S40. Start the microdroplet generator to generate oil that wraps the AIDS patient's peripheral blood mononuclear cell sample to form a microdroplet suspension;

S50. Transfer the droplet suspension to a 96-well PCR plate and perform ddPCR amplification;

S60. After the ddPCR amplification is completed, place the 96-well PCR plate in a droplet analyzer to read the fluorescence signal, and use analysis software to analyze the intensity and number of the fluorescence signal to achieve visual detection of HIV-positive cells.

The present invention first uses microdroplets to generate oil to evenly wrap the PCR reaction liquid containing peripheral blood mononuclear cell samples of AIDS patients to generate microdroplets with cells, and then through denaturation and annealing in the ddPCR program, that is, in a 94°C environment, the liquid is The cell membrane in the droplet is lysed and begins to enter the PCR workflow, thereby realizing PCR of all nucleic acids in the single cell it is wrapped in, that is, the amplification of HIV nucleic acid inside each cell can be visually observed at the cellular level.

In some embodiments, as shown in Figure 2, the steps of pre-preparing the HIV PCR reaction solution include: diluting the peripheral blood samples obtained from AIDS patients with PBS at room temperature to obtain diluted blood samples; diluting the diluted blood samples in Ficoll -Carry out gradient centrifugation in Paque PLUS to obtain a mononuclear cell layer; add red blood cell lysis solution to the mononuclear cell layer, mix by pipetting, then add PBS for centrifugation, discard the supernatant to obtain PBMC; dissolve in 0.9% normal saline PBMC are resuspended and diluted, and the concentration is adjusted to obtain peripheral blood mononuclear cell samples from AIDS patients; mix the peripheral blood mononuclear cell samples from AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes. , to obtain the HIV PCR reaction solution containing peripheral blood mononuclear cells of AIDS patients.

In this embodiment, the HIV gene primers include a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.2, wherein the forward primer shown in SEQ ID NO.1 The forward primer is recorded as LTR-gag-F, and its sequence is: GCCTCAATAAAGCTTGCCTTGA; the reverse primer shown in SEQ ID NO.2 is recorded as LTR-gag-R, and its sequence is: GGCGCCACTGCTAGAGTTTT; the sequence of the HIV gene probe As shown in SEQ ID NO.3, it is recorded as LTR-gag-probe, and its sequence is: TGTGACTCTGGTAACTAGAACCCTCAGAC; the internal reference gene primer includes the forward primer as shown in SEQ ID NO.4 and the forward primer as shown in SEQ ID NO.5 The reverse primer shown in SEQ ID NO.4 is marked as PDH-1, and its sequence is: TGAAAGTTATACAAAATTGAGGTCACTGTT. The reverse primer shown in SEQ ID NO.5 is marked as PDH-2, and its sequence is: It is: TCCACAGCCCTCGACTAACC; the sequence of the internal reference gene probe is shown in SEQ ID NO. 6, recorded as PDH-probe, and its sequence is: CCCCCAGATACACTTAAGGGATCAACTCTTAATTGT.

In this embodiment, the cell concentration in the peripheral blood mononuclear cell sample of the AIDS patient is: 6×10 ⁶ cells/mL-2×10 ⁷ cells/mL.

The present invention will be further explained below through specific examples:

An application of droplet digital PCR in visual detection of HIV-positive cells, which includes the following steps:

1. Use Ficoll-Paque PLUS density gradient centrifugation to isolate peripheral blood mononuclear cells (PBMC) from AIDS patients, which includes the following steps:

Blood dilution: Dilute the peripheral blood sample of an AIDS patient 1:1 (in a blood collection tube) with PBS at room temperature, mix gently with a rubber dropper to obtain a diluted blood sample, and slowly add the diluted blood sample to 5 mL of Ficoll -PaquePLUS;

Gradient centrifugation: Centrifuge the diluted blood sample at 2000 rpm for 20 minutes at 18-20°C, then set the centrifuge to 4°C pre-cooling (program 3), and adjust the centrifuge's lifting acceleration to the lowest possible level. The parameters can be adjusted as follows: The speed increase is 1 and the speed decrease is 0, which can prevent brake vibration and disrupt stratification after centrifugation;

Aspirate the white film: Use a sterile dropper to carefully transfer the mononuclear cell layer obtained by gradient centrifugation into a 15mL centrifuge tube containing 6mL of pre-cooled PBS, and then add pre-cooled PBS to make up to 15mL;

Centrifuge: Centrifuge at 1500 rpm for 5 minutes at 4°C to leave a layer of cells;

Lyse red blood cells: Add 3 mL of red blood cell lysis buffer (EL buffer) to the cells, mix by pipetting and lyse red blood cells at room temperature for 5 minutes, add PBS to 10 mL, and centrifuge at 1500 rpm/min for 5 minutes;

Wash with 0.9% physiological saline, resuspend, count, and aliquot into 200 μL/tube;

Finally, the PBMC were diluted with 0.9% normal saline solution at 6×10 ⁶ cells/mL and 2×10 ⁷ cells/mL respectively to obtain peripheral blood mononuclear cell samples from AIDS patients.

2. Droplet ddPCR experiment:

12.5 μL of HIV peripheral blood sample + 1.25 μL LTR-gag-F (10 μM) + 1.25 μL LTR-gag-R (10 μM) + 0.625 μL LTR-gag-probe (10 μM) + 1.25 μL PDH-1 (10 μM )+1.25μL PDH-2 (10μM)+0.625μL PDH-probe (10μM)+5μL cell template (cell concentration is 6×10 ⁶ /mL, 2×10 ⁷ /mL)+1.25μL ddPCR water mixed, Prepare HIV PCR reaction solution;

Among them, the sequences of HIV gene LTR segment primers and LTR probes and internal reference GAPDH gene primers and GAPDH probes are shown in Table 1:

3. Generation of microdroplets:

In the droplet generation area, add 25 μL of HIV PCR reaction solution to the sampling hole of the droplet generation card, and then add 70 μL of droplet generation oil to the oil filling hole of the droplet generation card. After the droplet reaction solution and oil are evenly mixed, seal the droplet generation card with a sealing gasket, insert the droplet generator, start the droplet generator and generate droplets; after about 2 minutes, the droplet preparation is completed, take out the card slot , remove 40 μL of microdroplet suspension from the top row of wells to the 96-well PCR plate.

4. Amplification reading conditions, and dd PCR condition settings:

PCR procedure:

Denaturation temperature, 94°C, 30s, 1 time;

Annealing temperature, 94°C, 5s;

Extension temperature, 60℃, 35s, 49 cycles;

After the PCR amplification is completed, place the 96-well plate in the droplet analyzer and select the FAM/HEX channel for signal reading.

5. Analyze statistics:

Use QuantaSoft analysis software to analyze the intensity and number of fluorescent signals; the proportion of negative/positive droplets can be determined based on the presence and intensity of fluorescent signals.

This implementation uses the microfluidic technology in the droplet generator to produce "water-in-oil" droplets. This method is used to wrap the viral PCR reaction solution containing peripheral blood mononuclear cells (PBMC) to form droplets; Then, through the 94°C denaturation step in the PCR program, the cells wrapped in a single droplet are lysed to expose the nucleic acid components as templates for the next step of PCR; then, the enzymes in the PCR reaction system combine with the templates and primers to react, producing PCR nucleic acid amplification reactions are performed within microdroplets encapsulated by individual cells. The laser signal in the nucleic acid product of the droplet PCR system passes through each droplet one by one through an excitation detector similar to a flow cytometry instrument, forming digital and picture signals. Finally, through the application of the above reactions and technologies, it is possible to visualize the cells that are positive for the nucleic acid target fragment and to distinguish the proportion of cells that are positive for the nucleic acid target fragment. And because it has multiple fluorescence channels of droplet PCR, it can realize multi-target and multi-site detection of the same cell.

In the visual detection of samples No. 1-8 using the droplet digital PCR method in Example 1, samples No. 1-8 are peripheral blood mononuclear cell samples of clinically confirmed AIDS patients. Among them, samples No. 1-4 are from the same patient sample, and No. 5-8 are from another patient sample. And the total number of cells loaded in samples No. 1, 2, 5, and 6 is 30,000 cells/well. The total number of cells loaded in samples No. 3, 4, 7, and 8 is 100,000 cells/well.

A in Figure 3 is a scatter plot of positive droplets/negative droplets of the internal reference gene GAPDH, and B in Figure 3 is a scatter plot of HIV ⁺ cells/HIV ^- cells. It can be seen from the figure that ddPCR can visualize HIV virus in PBMC.

In Figure 4, A is the experimental data in the PBMC of the AIDS patient sample with a total number of sample No. 1 cells loaded at 30,000 cells/well, and B is the experimental data in the PBMC of the AIDS patient sample loaded with a total number of sample No. 1 cells, 100,000 cells/well. The test data is specifically a visual presentation of cell droplets using ddPCR to detect the internal reference GAPDH. Blue indicates negative droplets, and orange indicates positive droplets.

In Figure 5, A is the experimental data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 1 being 30,000 cells/well, and B is the experimental data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 1 being 100,000 cells/well. The test data is specifically a visual presentation of cell droplets for ddPCR detection of HIV (LTR-Gag primer), with blue as negative droplets and orange as positive droplets.

In Figure 6, A is the experimental data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 5 being 30,000 cells/well, and B is the experimental data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 5 being 100,000 cells/well. The test data is specifically a visual presentation of cell droplets using ddPCR to detect the internal reference GAPDH. Blue indicates negative droplets, and orange indicates positive droplets.

In Figure 7, A is the test data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 5 being 30,000 cells/well, and B is the test data in the PBMC of the AIDS patient sample with the total number of cells loaded in sample No. 5 being 100,000 cells/well. The test data is specifically a visual presentation of cell droplets for ddPCR detection of HIV (LTR-Gag primer), with blue as negative droplets and orange as positive droplets. The results in Figures 4 to 7 all illustrate that ddPCR can directly and visually detect HIV nucleic acid amplification inside the mononuclear cells of AIDS patients.

It should be understood that the application of the present invention is not limited to the above examples. Those of ordinary skill in the art can make improvements or changes based on the above descriptions. All these improvements and changes should fall within the protection scope of the appended claims of the present invention.

Claims (5)

1. An application of droplet digital PCR in the visual detection of HIV-positive cells, which is characterized by including the steps: Preparing an HIV PCR reaction solution in advance, which includes pretreated peripheral blood mononuclear cell samples of AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes; In the droplet generation area, add the HIV PCR reaction solution to the sampling hole of the droplet generation card, and add the droplet generation oil to the oil filling hole of the droplet generation card; After the HIV PCR reaction solution and the droplet generation oil in the droplet generation card are evenly mixed, the droplet generation card is sealed with a sealing gasket and placed in the droplet generator; Start the microdroplet generator to make the microdroplet generate oil to wrap the peripheral blood mononuclear cell sample of the AIDS patient to form a microdroplet suspension; Transfer the droplet suspension to a 96-well PCR plate and perform ddPCR amplification; After the ddPCR amplification is completed, place the 96-well PCR plate in a droplet analyzer to read the fluorescence signal, and use analysis software to analyze the intensity and number of the fluorescence signal to achieve visual detection of HIV-positive cells. 2. The application of droplet digital PCR in visual detection of HIV-positive cells according to claim 1, characterized in that the step of pre-preparing the HIV PCR reaction solution includes: Use normal temperature PBS to dilute the peripheral blood samples obtained from AIDS patients to obtain diluted blood samples; Perform gradient centrifugation on the diluted blood sample in Ficoll-Paque PLUS to obtain a mononuclear cell layer; Add red blood cell lysis solution to the mononuclear cell layer, mix by pipetting, then add PBS for centrifugation, and discard the supernatant to obtain peripheral blood mononuclear cells (PBMC); Resuspend and dilute PBMC in 0.9% physiological saline solution, and adjust the cell concentration to obtain peripheral blood mononuclear cell samples from AIDS patients; Mix the peripheral blood mononuclear cell samples of AIDS patients, HIV gene primers, HIV gene probes, internal reference gene primers, and internal reference gene probes to obtain an HIV PCR reaction solution. 3. The application of droplet digital PCR in visual detection of HIV-positive cells according to claim 2, characterized in that the cell concentration in the peripheral blood mononuclear cell sample of the AIDS patient is 6×106/mL- 2×107 pieces/mL. 4. Application of droplet digital PCR in visual detection of HIV-positive cells according to claim 2, characterized in that the HIV gene primers include forward primers as shown in SEQ ID NO.1 and SEQ ID NO. The reverse primer shown in ID NO.2; the sequence of the HIV gene probe is shown in SEQ ID NO.3; the internal reference gene primer includes the forward primer shown in SEQ ID NO.4 and the sequence shown in SEQ ID NO. The reverse primer shown in ID NO.5; the sequence of the internal reference gene probe is shown in SEQ ID NO.6. 5. The application of droplet digital PCR in visual detection of HIV-positive cells according to claim 1, characterized in that the step of transferring the droplet suspension to a 96-well PCR plate and performing ddPCR amplification , the condition settings for ddPCR amplification are as follows: Denaturation temperature, 94°C, 30s, 1 time; Annealing temperature, 94°C, 5s; Extension temperature, 60°C, 35s, 49 cycles.