CN116732235A - InDel molecular marker for white pepper variety breeding and application thereof - Google Patents

InDel molecular marker for white pepper variety breeding and application thereof Download PDF

Info

Publication number
CN116732235A
CN116732235A CN202310951424.5A CN202310951424A CN116732235A CN 116732235 A CN116732235 A CN 116732235A CN 202310951424 A CN202310951424 A CN 202310951424A CN 116732235 A CN116732235 A CN 116732235A
Authority
CN
China
Prior art keywords
pepper
white
breeding
molecular marker
white pepper
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310951424.5A
Other languages
Chinese (zh)
Inventor
欧阳波
沈心彦
唐亚萍
石春美
周玉红
陈蓉
吴新胜
卢永恩
叶志彪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202310951424.5A priority Critical patent/CN116732235A/en
Publication of CN116732235A publication Critical patent/CN116732235A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application belongs to the technical field of pepper breeding, and particularly relates to an InDel molecular marker for white pepper variety breeding and application thereof. The InDel molecular marker for breeding the white pepper variety is positioned at 9888972bp of chromosome 10 of a CA59 reference genome of a pepper inbred line, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1. The InDel molecular marker provided by the application is closely linked with the phenotype of the white pepper, can be applied to identification of the fruit color character of the pepper and breeding of the white pepper variety, and can be used for rapidly identifying or screening white pepper fruit plants from genotype level by detecting the existence of the molecular marker, so that the selection accuracy and efficiency in breeding are effectively improved, the development period of the white pepper variety is shortened, and the breeding workload is reduced.

Description

InDel molecular marker for white pepper variety breeding and application thereof
Technical Field
The application relates to the technical field of pepper breeding, in particular to an InDel molecular marker for white pepper variety breeding and application thereof.
Background
Capsicum (Capsicum annuum l.) is one of the important vegetable crops, and its fruit color is rich in diversity. Fruit color is one of the most important quality traits of capsicum, capsicum fruits form different colors due to accumulation of different chlorophyll, carotenoid and anthocyanin components and contents, the colors contribute to visual attractiveness of the fruits, and the pigments are also beneficial to human diet and have important health care and economic values. So far, pepper varieties with different colors including green, red, yellow, orange, milky white, purple and the like have been bred in production. At present, genetic researches on the color of pepper fruits mainly focus on the development and metabolic differences of fruit pigments and the like. Mutation of pigment gene can make pigment structure, abundance and fruit colour show various changes. For example, the identification of Phytoene Synthase (PSY) and capsorubin/capsorubin synthase (CCS) in the carotenoid biosynthetic pathway results in the formation of orange and yellow peppers, respectively; ANTHOCYANIN accumulation is controlled by homologous gene of transfer factor gene ANTHOCYANIN2 in Capsicum annuum; brown ripe fruits are formed by controlling chlorophyll retention in red ripe fruits by the star-GREEN (SGR) gene. In addition to qualitative variation in fruit color, quantitative variation in pigment content and color intensity also exists in pepper germplasm resources, resulting in a change in color intensity from light green to dark green and from light red to dark red, but there is a great variation in pigment content in fruits, the genetic basis of which is not clear.
The white pepper has good causal color glossiness, tender quality and delicious taste and has good popularization and application prospect. However, white pepper resources in nature are very rare, and only yellow lantern in Hainan, white jade in Anhui, guangxi Tai yellow pepper, white pepper in Jinhua Jihua Ji and Longzu Ji Gao, white pepper in Zhejiang Ke Cheng Qiyi and Zhejiang Lishui, cloud white pepper and the like exist, and the varieties are excellent local varieties preserved in special regions, so that the existing white pepper varieties are deficient in resources and relatively miscellaneous in species, and researches on the forming mechanism of the characteristics of the gingko are fresh.
The breeding of pepper varieties with different fruit colors to meet different consumer groups is one of important breeding targets of peppers. The traditional breeding work mainly utilizes a method of crossing green peppers and white peppers and then backcrossing to create white pepper germplasm materials, or combines technical means such as mutagenesis, the method needs to rely on the fruit phenotype observation of plants, and the target property materials can be selected only by long-time observation, so that the breeding process is complex, time and labor are wasted, the influence of environmental factors is easy, and the cost is high. With the development of molecular biology, the use of molecular marker assisted selection (Marker Assisted Selection, MAS) technology has become an important tool for breeding efforts. The molecular markers linked with the pepper fruit color genes are used for detecting plant DNA to predict the pepper fruit phenotype, so that the breeding process can be greatly accelerated, the breeding period can be reduced, the breeding efficiency can be improved, and the breeding cost can be saved.
Molecular marker assisted selective breeding has become an important direction for pepper breeding. At present, the main focus of molecular breeding in capsicum is the introduction, polymerization and fertility screening of resistance genes. In recent years, although fruit color trait linked markers of green pepper fruits (also called commercial mature fruits) have been used in transformation studies, such as InDelP146, CAMS 454, CAPS 78 708, etc., most of the markers linked to purple traits of green pepper fruits have not been reported for linked molecular markers related to white fruit traits of capsicum. Therefore, research is conducted aiming at the white fruit character of the capsicum, and the development of an effective white fruit color molecular marker has important strategic significance and market application prospect for creating new germplasm of the capsicum, and has important biological significance for revealing the molecular mechanism of white color formation of capsicum fruits.
Disclosure of Invention
Aiming at the problems existing in the prior art, the application provides an InDel molecular marker for white pepper variety breeding, a detection primer and a kit for detecting the InDel molecular marker, and application of the molecular marker, the detection primer and the kit in identifying or breeding white pepper varieties, and aims to solve a part of problems in the prior art or at least alleviate a part of problems in the prior art.
The application is realized by the following technical scheme:
the first aspect of the application provides an InDel molecular marker for white pepper variety breeding, which is positioned at 9888972bp of chromosome 10 of a CA59 reference genome of a pepper inbred line, and has a nucleotide sequence as shown in SEQ ID NO: 1.
The second aspect of the application provides the application of the InDel molecular marker for white pepper variety breeding in the identification or breeding of white pepper varieties.
Further, detecting whether InDel molecular markers for breeding the white pepper variety exist in the pepper plants to be detected, judging the fruit characters of the pepper plants to be detected according to detection results, and when the pepper plants to be detected lack the InDel molecular markers as shown in SEQ ID NO:1, wherein fruits of the pepper plants to be detected appear white.
Further, the method for detecting the InDel molecular marker of the white pepper variety breeding comprises a gene sequencing method, a DNA molecular hybridization method or a PCR amplification method.
The third aspect of the application provides a detection primer for detecting the InDel molecular marker for white pepper variety breeding, wherein the detection primer comprises an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are respectively shown in SEQ ID NO:3-4.
In a fourth aspect, the application provides a kit for detecting the InDel molecular marker for white pepper variety breeding as described above, which comprises the detection primer as described above.
In a fifth aspect, the present application provides the use of a detection primer as described above or a kit as described above for identifying or breeding white pepper varieties.
The sixth aspect of the present application provides a method for identifying or breeding white pepper varieties, comprising the steps of:
s1, extracting genome DNA of a pepper plant to be detected;
s2, using the sequence shown in SEQ ID NO:3-4, performing PCR amplification by using the detection primer;
s3, judging the fruit character of the pepper plant to be detected according to the size of the PCR amplification product, wherein when the length of the PCR amplification product is 122bp, the fruit phenotype of the pepper plant to be detected is white before the color conversion period, when the length of the PCR amplification product is 145bp, the fruit phenotype of the pepper plant to be detected is green before the color conversion period, and when the length of the PCR amplification product simultaneously shows two bands of 145bp and 122bp, the fruit phenotype of the pepper plant to be detected is intermediate green before the color conversion period.
Further, in step S1, genomic DNA is extracted by a CTAB method.
Further, in step S2, the reaction system for PCR amplification comprises, in 10 μl: 1. Mu.L of genomic DNA, 5. Mu.L of 2X FineTaq PCR SuperMix (+dyne), 0.2. Mu.L of upstream primer, 0.2. Mu.L of downstream primer and 3.6. Mu.L of ddH 2 O, the reaction procedure of the PCR amplification comprises: pre-denaturation at 94.0 ℃ for 3min; denaturation at 94.0 ℃ for 30s, renaturation at 59.0 ℃ for 30s, extension at 72.0 ℃ for 30s, and circulation for 34 times; extension at 72.0℃for 5min and storage at 4 ℃.
The application has the advantages and positive effects that:
the application utilizes the hybridization of commercial capsicum germplasm Yulong capsicum and cultivated capsicum germplasm MiniPep to construct F 2 Separating the population, selecting green fruits and young fruits of white fruit phenotype plants for grouping and mixing, screening based on BSR and recombination event analysis strategies to obtain an InDel molecular marker closely linked with the color of the white fruits, and constructing F by using the InDel molecular marker 2 Population verification is carried out on individuals of 246 plants of the population, wherein non-ginkgo fruits all show to contain molecular markers, the molecular markers are absent in single plants of ginkgo fruits, the plant genotype is highly consistent with the fruit color phenotype, and the coincidence rate of the detected ginkgo fruit samples reaches more than 98%. Therefore, the InDel molecular markers of the application can be appliedIn the identification of the pepper fruit color character and the breeding of the white pepper variety, the existence of the molecular marker is detected, so that the white fruit pepper plants can be rapidly identified or screened from the genotype level, the accuracy and the efficiency of selection in breeding are effectively improved, the breeding period of white pepper variety materials is shortened, the breeding workload is reduced, a new idea is provided for creating new germplasm of the white pepper, and scientific basis is provided for the research of the development biology of the pepper fruits.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for the description of the embodiments will be briefly described below, and it is apparent that the drawings in the following description are only some embodiments of the present application, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a chart showing the phenotype of the pepper fruits in different growth periods according to the embodiment of the application, wherein the charts A-C are the phenotype of the fruits of young fruits, green fruits and fruits from the color conversion period to the red period, respectively, and the charts A-C are male, female and F respectively 1 Hybrid offspring F respectively representing cultivated pepper germplasm MiniPep, yulong pepper and Yu Long Jiao ×MiniPep 1 The scale bar is 1cm;
FIG. 2 shows the BSR analysis results of the color population of the fruits of Zanthoxylum bungeanum in the embodiment of the application, wherein, the graph A is a linear regression fit curve of all 12 chromosomes, and the graph B is a linear regression fit curve of chromosome 10;
FIG. 3 is a diagram of PCR amplification results of InDel molecular markers based on white pepper variety breeding in an embodiment of the application; wherein lane M represents Marker, lane P 1 Lane P, representing the male parent capsicum germplasm miniep 2 Represents female parent Yulong pepper, lane F 1 Represents F 1 Population individuals, lane N represents H 2 Amplification results with O as template as negative control, lane F 2 Represents F 2 Population individuals, G/G represents a recessive genotype, G/G represents a dominant genotype, and G/G represents a heterozygous genotype.
Detailed Description
The present application will be described in further detail with reference to the following examples, in which the apparatus and reagents used in the respective examples and test examples are commercially available unless otherwise specified, in order to make the objects, technical schemes and advantages of the present application more apparent. The specific embodiments described herein are to be considered in an illustrative sense only and are not intended to limit the application.
Various modifications to the precise description of the application will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit or scope of the appended claims. It is to be understood that the scope of the application is not limited to the defined processes, properties or components, as these embodiments, as well as other descriptions, are merely illustrative of specific aspects of the application. Indeed, various modifications of the embodiments of the application which are obvious to those skilled in the art or related fields are intended to be within the scope of the following claims.
For a better understanding of the present application, and not to limit its scope, all numbers expressing quantities, percentages, and other values used in the present application are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
In order that the above-recited objects, features and advantages of the present application will become more readily apparent, a more particular description of the application briefly described above will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings.
The embodiment of the application provides an InDel molecular marker for white pepper variety breeding, which is positioned at 9888972bp of chromosome 10 of a CA59 reference genome of a pepper inbred line, and has the nucleotide sequence as follows: CGAAATGGCCTTACCAACCCCAC (consisting of 23bp base, see SEQ ID NO: 1).
Specifically, the reference genome of the pepper inbred line CA59 (see, for specific genomic information, liao Yi, wang Juntao, zhu Zhangsheng, liu Yuanlong, chen Jinfeng, zhou Yongseng, liu Feng, lei Jianjun, gaut S.Brandon, cao Bihao, emerson J.James, chen Changminging. The 3D architecture of the pepper genome and its relationship to function and evolution.Nature Communications,2022,13:3479) was used as the reference sequence, the InDel molecular marker was located at 9888972bp of chromosome 10 of the reference sequence, and the aforementioned 23bp nucleotide fragment (homozygous deletion) was deleted in the genome of the white pepper variety at 9888961bp (inclusive) -9888983bp (inclusive), i.e., 9888972bp was the center of the InDel molecular marker. Whereas the aforementioned 23bp nucleotide fragment is present in non-white pepper varieties.
It should be noted that the fruit color of the white pepper variety is white or yellowish-white before the color transition period, the fruit color of the non-white pepper variety is green (including the intermediate green described below) before the color transition period, and the fruit color of the aforementioned variety appears red from the color transition period to the mature period.
The application utilizes commercial capsicum germplasm Yulong capsicum and cultivated capsicum germplasm MiniPep to construct F 2 Segregating the population, phenotyping the fruit color of the segregating population, selecting 30 plants with fruit phenotypes of green fruit phenotype and ginkgo fruit phenotype in the fruit setting period, selecting one fruit for each plant, cutting the pericarp equivalent mixed sample of the fruit, based on BSR analysis strategy (Bulked segregant RNA-sequencing, BSR), initially positioning the white fruit color control gene within 175.41Mb range between 8069287bp-183480718bp of the CA59 reference genome of the pepper, finely positioning by using the maize peppers and Minipep resequencing data, based on recombination event analysis, positioning the white fruit color control gene within 560kb range between 9.32Mb-9.88Mb of chromosome 10, and obtaining a molecular marker closely linked with the white fruit color, which is positioned at 9888972bp of chromosome 10, closely linked with the white fruit character, and generating an InDel deletion of 23bp (nucleotide sequence see SEQ ID NO: 1) in the white fruit sample, which is M7.
F constructed by using the molecular marker M7 pair of the application 2 Group of peopleThe leaves of 246 individuals are subjected to population verification, wherein non-ginkgo is represented by a nucleotide sequence containing a molecular marker M7, a dominant genotype (marked as G/G) or a heterozygous genotype (marked as G/G) is presented, only one of the ginkgo individuals is represented by a nucleotide sequence containing the molecular marker M7, the rest of the ginkgo individuals are detected to be homozygous for M7, and the other ginkgo individuals are represented by a recessive genotype (marked as G/G), so that the high coincidence of the genotype of the pepper plants and the color phenotype of fruits is confirmed, and the coincidence rate is up to more than 98%. Therefore, the molecular marker M7 provided by the application can be used as a genetic marker for identification of pepper fruit color characters and breeding of white fruit varieties, can be used for rapidly identifying or screening white fruit pepper plants from genotype level by detecting whether the molecular marker exists or not, specifically, can be used for detecting whether the nucleotide sequence of the molecular marker M7 exists on the 10 th chromosome of the pepper variety to be detected, judging that the pepper variety is white when the sequence is deleted, and judging that the pepper variety is non-white when the sequence is deleted, so that the fruit character expression of the pepper variety to be detected can be rapidly and accurately predicted according to the genotype, the accuracy and efficiency of selection in breeding are effectively improved, the breeding period of white pepper variety materials is greatly shortened, the breeding workload is reduced, a new idea is provided for creating new germplasm of white peppers, and scientific basis is provided for research on the fruit development biology of the peppers.
Based on the same inventive concept, the embodiment of the application also provides application of the InDel molecular marker for white pepper variety breeding in identification or breeding of white pepper varieties.
The application converts screening and identification of white fruit characters into the detection of the existence of InDel molecular marker M7 by gene level, can determine the fruit phenotype of plants in advance in the seed stage or seedling stage after sowing, greatly reduces the planting scale and breeding time of breeding materials, improves the breeding efficiency and saves the production cost. Namely, whether InDel molecular markers exist in the pepper plants to be detected is detected, the fruit characters of the pepper plants to be detected are judged according to detection results, and when the InDel molecular markers selected from the white pepper varieties are deleted from the pepper plants to be detected, the fruits of the pepper plants to be detected are white.
Biological methods for detecting the presence or absence of the molecular marker M7 include, but are not limited to: direct sequencing of genome, hybridization of DNA molecule with targeting molecular marker M7 DNA probe, PCR amplification, etc.
In a preferred embodiment, this method may be a PCR amplification method: taking genome DNA of the capsicum to be detected as a template, taking a primer pair on the upstream and downstream of the targeting molecular marker M7 as an amplification primer, carrying out PCR amplification, detecting an amplification product, if the molecular marker M7 can be amplified, the capsicum to be detected is a non-white capsicum variety, and if the detection is that the M7 marker is homozygous missing, the capsicum to be detected is a white capsicum variety. The method for detecting the amplification product includes agarose gel electrophoresis or gene sequencing, etc., and the present application is not particularly limited thereto, and may be performed according to a well-known procedure in the art.
In a further embodiment of the present application, there is provided a detection primer for detecting InDel molecular markers for white pepper variety breeding as described above, the detection primer comprising an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer and the downstream primer are respectively set forth in SEQ ID NOs: 3-4, the specific sequence is as follows:
M7-F: GGCCCATTGGCGCCACTTC (see SEQ ID NO: 3);
M7-R: CTCGGGGTGAACCAGGGGTTC (see SEQ ID NO: 4).
By utilizing InDel molecular marker M7 locus and upstream and downstream specific sequences, a pair of primer pairs is developed, and SEQ ID NO:3-4, wherein the amplified fragment contains sequence fragments at the upstream and downstream of the molecular marker M7, the amplified fragment of the white pepper variety is smaller than the amplified fragment of the non-white pepper variety due to the deletion of 23bp, specifically, 145bp (see SEQ ID NO: 2) of the amplified product is singly generated or 145bp and 122bp of the amplified product are simultaneously generated, the pepper to be detected is the non-white pepper variety, the fruit color of the pepper to be detected is respectively green or intermediate green before the color conversion period, and the pepper to be detected is the white pepper variety if only 122bp of the strip is generated, and the fruit color of the pepper to be detected is white or yellow-white before the color conversion period. According to the method, the genotype can be judged according to the size of the amplified product, and the characteristics of the pepper fruits to be detected can be further predicted and judged.
Another embodiment of the present application provides a kit for detecting InDel molecular markers for white pepper variety breeding as described above, the kit comprising the detection primers as described above.
The advantages of the kit compared with the prior art are the same as those of the InDel molecular marker detection primer for detecting white pepper variety breeding, and are not repeated here.
Based on the same inventive concept, a further embodiment of the present application provides the use of the detection primer as described above or the kit as described above for identifying or breeding white pepper varieties.
Specifically, the method for identifying or breeding white pepper varieties by using the detection primer as described above or the kit as described above comprises the following steps:
s1, extracting genome DNA of a pepper plant to be detected;
s2, using the sequence shown in SEQ ID NO:3-4, performing PCR amplification by using the detection primer;
s3, judging the fruit character of the pepper plant to be detected according to the size of the PCR amplification product, wherein when the length of the PCR amplification product is 122bp, the fruit phenotype of the pepper plant to be detected is white before the color conversion period, when the length of the PCR amplification product is 145bp, the fruit phenotype of the pepper plant to be detected is green before the color conversion period, and when the length of the PCR amplification product simultaneously shows two bands of 145bp and 122bp, the fruit phenotype of the pepper plant to be detected is intermediate green before the color conversion period.
Alternatively, in step S1, genomic DNA is extracted by CTAB method.
Alternatively, in step S2, the reaction system for PCR amplification comprises, in 10 μl: 1. Mu.L of genomic DNA, 5. Mu.L of 2X FineTaq PCR SuperMix (+dyne) (available from Beijing full gold Biotechnology Co., ltd., cat# AS 101), 0.2. Mu.L of upstream primer, 0.2. Mu.L of downstream primer and 3.6. Mu.L of ddH 2 O。
Optionally, in step S2, the reaction procedure of PCR amplification includes: pre-denaturation at 94.0 ℃ for 3min; denaturation at 94.0 ℃ for 30s, renaturation at 59.0 ℃ for 30s, extension at 72.0 ℃ for 30s, and circulation for 34 times; extension at 72.0℃for 5min and storage at 4 ℃.
The application will be further illustrated with reference to specific examples. The experimental methods in which specific conditions are not specified in the following examples are generally conducted under conventional conditions, for example, those described in the molecular cloning Experimental guidelines (fourth edition) published in Cold spring harbor laboratory, or are generally conducted under conditions recommended by the manufacturer.
In the following embodiments, the jade-dragon pepper is an excellent white pepper variety developed by the agricultural science institute of the Zhejiang province (reference: liu Huiqin, research on the breeding and cultivation technique of novel variety of special pepper, zhejiang province, agricultural science institute of the Zhejiang province, 2018-12-08), the peel of the pepper fruit in the immature stage is milky white, the peel of the pepper fruit in the green stage (commodity fruit) is yellow-white, the fruit color from the color conversion stage to the finishing stage (red-ripe stage) is orange-red, and the genetic research shows that the color of the pepper fruit can be inherited stably, thus being a stable variation.
Cultivation of Capsicum annuum germplasm MiniPep (ref: shi Chunmei, shen Xinyan, zhang Zhiying, zhou Yuhong, chen Rong, luo Jingying, tang Yaping, lu Yongen, li Feng, ouyang Bo. Served role of Fructokinase-like protein 1in chloroplast development revealed by a seedling-lethal albino mutant of peper. Horticulure Research,2022,9: uhab 084) green-stage fruits, green-stage (commodity fruits) fruits in dark green, transition-stage to full-stage (red-stage) fruits transition from brown to red.
Fruit color identification is performed with reference to regulations in the description Specification of Capsici fructus germplasm resources and data Standard [ M ] (Li Xixiang and Zhang Baoxi, china agricultural Press, 2006).
The reference genome is a capsicum inbred line CA59 (hereinafter referred to as CA 59) reference genome, and the genome information is specifically described in the literature: liao Yi, wang Juntao, zhu Zhangsheng, liu Yuanlong, chen Jinfeng, zhou Yonggfeng, yu Feng, lei Jianjun, gaut S.Brandon, cao Bihao, emerson J.James, chen changming. The 3Darchitecture of the pepper genome and its relationship to function and evolution.Nature Communications,2022,13: 3479).
1. Development of white fruit character closely linked molecular markers
The application utilizes hybridization of commercial capsicum germplasm Yulong capsicum (female parent) and cultivated capsicum germplasm MiniPep (male parent) to obtain F 1 The generation, FIG. 1, shows the wild germplasm MiniPep of Zanthoxylum schinifolium and Capsicum annuum and the filial generation F of the two 1 The character phenotype of young fruits, green ripe fruits (green ripe period and before) and fruits from the color conversion period to the red ripe period, male parent and F in the figure 1 Filial generation F respectively representing wild germplasm MiniPep of capsicum, jade-dragon capsicum and jade Long Jiao ×MiniPep 1 The scale bar is 1cm.
Will F 1 Self-pollination of the generation to obtain F 2 Adopts sprinkling irrigation, externally covers an insect-proof net, prevents external media from pollinating, and timely carries out cultivation management such as fertilization, intertillage, weeding, disease and insect prevention and the like according to a standardized production mode of the capsicum. The phenotype can be basically judged 1-2 weeks after fruit setting, and the phenotype is obvious and stable in green ripening stage. More than 3 fruits are investigated in each plant, the fruits of the Yulong pepper are yellow-white in the period from fruit setting to green ripening, and the normal fruits are green in color. And if more than 3 fruits are all yellow and white, judging that the phenotype of the white fruits is recessive, otherwise, judging that the phenotype of the white fruits is dominant. Construction F 2 Segregating population 246, wherein 60 individuals with fruits exhibiting a ginkgo phenotype find a card square value of 0.022, less than a card square threshold of 3.84 with degrees of freedom of 1, and judge that the mutation meets 3:1 separation ratio, which indicates that the white fruit character is recessive single gene control.
The card square threshold is as follows:
at F 2 Selecting 30 plants with fruit phenotypes of green fruit phenotype and ginkgo fruit phenotype in the fruiting period of the group plants, namely selecting 30 recessive single plants and 30 dominant single plants, selecting one fruit for each plant, cutting equal amounts of fruit peel, mixing samples, extracting RNA, sending the RNA to a company for carrying out RNA sequencing (RNA-seq), filtering the obtained RNA-seq data, comparing the filtering data with a capsicum reference genome CA59 through Hisat2 software, and extracting the unique ratioReads of pairs, and ranks. Mutation identification was performed using samtools software to obtain SNPs. Based on a BSR analysis strategy (Bulked segregant RNA-sequencing, BSR), the frequency of each allele in two mixed pools is calculated respectively by utilizing an autonomously developed Perl script, mutation sites with sequencing depth smaller than 10 and gene frequency smaller than 0.3 or larger than 0.7 in the two mixed pools are filtered, euclidean distance (Euclidean Distance, ED) of each SNP site is calculated, linear regression fit and mapping are carried out on data by using a LOESS (locally weighted scatterplot smoothing) curve after the ED value is taken to the power of 4 (see A diagram in FIG. 2, the abscissa of 1-12 represents chromosome number and the ordinate of ED is taken to the power of 4), and based on the BSR strategy, differences exist between the two mixed pools except for the relevant sites of the target traits, and other sites tend to be consistent, so the ED value of the non-target sites tends to be 0, and a remarkable peak area is found on the whole genome number 10 chromosome. Taking the 3 times of the sum of the median value and the standard deviation of the power fitting values of all loci as a threshold line, taking a section higher than the threshold line as a candidate section, wherein the size of the candidate section is a 175.41Mb physical section of 8069287bp-183480718bp (see a B diagram in fig. 2, the abscissa represents the genome position, the ordinate represents the ED to the power of 4), and initially locating the gene for controlling the white fruit in the candidate section.
To further shorten the candidate interval, the filtered data are compared to the capsicum reference genome CA59 by BWA software, repeated sequence marking and mutation identification are carried out by utilizing GATK software, inDel mutation information is extracted, then the self-created perl script is used for developing polymorphic InDel molecular markers of two parents, recombination events in 60 recessive single plants are identified by using the markers, the white fruit color control gene is positioned in the interval of about 560kb (9323021 bp-9888972 bp) after analysis of the recombination events, an InDel molecular marker which is tightly linked with the gene for controlling fruit color and is tightly linked with the gingko phenotype is obtained, and calculated by the center position of the InDel molecular marker, the InDel molecular marker is positioned at 9888972bp of chromosome 10 and has a deletion of 23bp, and the deletion fragment position is 9888961bp (containing) -9888983 bp. The molecular marker is marked as M7, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, specifically: CGAAATGGCCTTACCAACCCCAC.
The above analytical methods are described in detail in the literature: hill JT, demarest BL, bisgrove BW, gorsi B, su YC, yost HJ.MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq. Genome Research,2013,23:687-697 and Li H.A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data.Bioinformation (Oxford, england), 2011,27:2987-2993.
2. Detection primer design and population verification
For the InDel molecular marker M7, a specific upstream primer and a specific downstream primer are designed by taking sequences of about 150bp on two sides of a mutation site, and the nucleotide sequence of the detection primer is as follows:
M7-F: GGCCCATTGGCGCCACTTC (see SEQ ID NO: 3)
M7-R: CTCGGGGTGAACCAGGGGTTC (see SEQ ID NO: 4).
The 246 strain F obtained by the above construction 2 Genotyping was performed on individuals of the isolated population. Extraction of F 2 The genomic DNA of the individual strain was amplified by PCR using the above-mentioned detection primer, and the reaction system was 10. Mu.L: 1. Mu.L of genomic DNA, 5. Mu.L of 2X FineTaq PCR SuperMix (+dyne) (available from Beijing full gold Biotechnology Co., ltd., cat# AS 101), 0.2. Mu.L of upstream primer, 0.2. Mu.L of downstream primer and 3.6. Mu.L of ddH 2 O, the upstream primer and the downstream primer were synthesized by Wuhantian Yihua gene technology Co., ltd, and the original OD value was 1.0, and the amounts of the substances were 5.47nmol/tube and 4.48nmol/tube, respectively. The reaction procedure is: pre-denaturation at 94.0 ℃ for 3min; denaturation at 94.0 ℃ for 30s, renaturation at 59.0 ℃ for 30s, extension at 72.0 ℃ for 30s, and circulation for 34 times; extension at 72.0℃for 5min and storage at 4 ℃.
After completion of the PCR reaction, the size of the PCR product was detected by 3% agarose gel electrophoresis, and according to the result of the electrophoresis of the amplified product, 2 specific bands, 145bp and 122bp, respectively, were possibly present, and FIG. 3 shows part F 2 The PCR amplification result of the individual strain, wherein lane M represents Marker, lane P 1 Lane P, showing the capsicum father miniep 2 Represents female parent Yulong pepper, lane F 1 Represents F 1 Population individuals, lane N represents H 2 Amplification results with O as template as negative control, lane F 2 Represents F 2 Individuals in a population. If only one 145bp band (large band) appears, the homozygous dominant is indicated, the phenotype is green fruits, and the genotype is G/G; if a 122bp band (small band) appears as homozygous recessive, the phenotype is white fruits, and the genotype is g/g; if the band is double, i.e.145 bp and 122bp bands are present simultaneously, the heterozygous genotype G/G is present and the phenotype is intermediate green.
The nucleotide sequence of the large band (145 bp) in the amplified target band is as follows: (see SEQ ID NO: 2); and (3) injection: the detection primer targeting sites are underlined and the deletion sites are shown in the shaded portion.
The amplified nucleotide sequence of the small band (122 bp) differs from that of the large band in that the shaded portion is deleted and the display is not repeated here.
F constructed by using the molecular marker M7 pair of the application 2 Group verification is carried out on genotypes of individuals of 246 strains of groups, and the individuals of 246 strains are judged to be of two types, namely green fruits and white fruits, and the group verification is carried out on the genotypes of the individuals of 246 strains of groups, namely green: white = 186:60. according to statistics, 186 plants of the non-white fruits are shown to contain a molecular marker M7, and show dominant genotypes G/G or heterozygous genotypes G/G, only one of 60 plants of the ginkgo fruits is shown to contain the molecular marker M7, and the rest of the plants are detected to be homozygous deletion of the molecular marker M7 and show a recessive genotype G/G, so that the genotype of the pepper plants is proved to be highly consistent with the color phenotype of the fruits, and the genotype and phenotype coincidence rate of the white fruits reaches 59/60=98.33%.
The foregoing description of the preferred embodiments of the application is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the application.

Claims (10)

1. The InDel molecular marker for white pepper variety breeding is characterized in that the InDel molecular marker is positioned at 9888972bp of chromosome 10 of a CA59 reference genome of a pepper inbred line, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.
2. The use of InDel molecular markers for white pepper variety selection as defined in claim 1 for the identification or selection of white pepper varieties.
3. The application of the InDel molecular marker for white pepper variety selection according to claim 2 in the identification or selection of white pepper variety, characterized in that whether the InDel molecular marker for white pepper variety selection exists in a pepper plant to be detected is detected, and the fruit character of the pepper plant to be detected is judged according to the detection result;
when the pepper plants to be detected are deleted as SEQ ID NO:1, wherein fruits of the pepper plants to be detected appear white.
4. The use of InDel molecular markers for white pepper variety selection according to claim 3, characterized in that the method for detecting the InDel molecular markers for white pepper variety selection comprises a genetic sequencing method, a DNA molecular hybridization method or a PCR amplification method.
5. A detection primer, which is used for detecting the InDel molecular marker for white pepper variety breeding according to claim 1, and comprises an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer and the downstream primer are respectively shown in SEQ ID NO:3-4.
6. A kit for detecting InDel molecular markers for white pepper variety breeding according to claim 1, comprising the detection primer according to claim 5.
7. Use of the detection primer according to claim 5 or the kit according to claim 6 for identifying or breeding white pepper varieties.
8. A method for identifying or breeding white pepper varieties, which is characterized by comprising the following steps:
s1, extracting genome DNA of a pepper plant to be detected;
s2, using the sequence shown in SEQ ID NO:3-4, performing PCR amplification by using the detection primer;
s3, judging the fruit character of the pepper plant to be detected according to the size of the PCR amplification product, wherein when the length of the PCR amplification product is 122bp, the fruit phenotype of the pepper plant to be detected is white before the color conversion period, when the length of the PCR amplification product is 145bp, the fruit phenotype of the pepper plant to be detected is green before the color conversion period, and when the length of the PCR amplification product simultaneously shows two bands of 145bp and 122bp, the fruit phenotype of the pepper plant to be detected is intermediate green before the color conversion period.
9. The method for identifying or breeding white pepper variety according to claim 8, characterized in that in step S1, the genomic DNA is extracted using CTAB method.
10. The method for identifying or breeding white pepper variety according to claim 8, characterized in that in step S2, the reaction system of the PCR amplification comprises in 10 μl: 1. Mu.L of genomic DNA, 5. Mu.L of 2X FineTaq PCR SuperMix (+dyne), 0.2. Mu.L of upstream primer, 0.2. Mu.L of downstream primer and 3.6. Mu.L of ddH 2 O；
The reaction procedure for PCR amplification includes: pre-denaturation at 94.0 ℃ for 3min; denaturation at 94.0 ℃ for 30s, renaturation at 59.0 ℃ for 30s, extension at 72.0 ℃ for 30s, and circulation for 34 times; extension at 72.0℃for 5min and storage at 4 ℃.
CN202310951424.5A 2023-07-31 2023-07-31 InDel molecular marker for white pepper variety breeding and application thereof Pending CN116732235A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310951424.5A CN116732235A (en) 2023-07-31 2023-07-31 InDel molecular marker for white pepper variety breeding and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310951424.5A CN116732235A (en) 2023-07-31 2023-07-31 InDel molecular marker for white pepper variety breeding and application thereof

Publications (1)

Publication Number Publication Date
CN116732235A true CN116732235A (en) 2023-09-12

Family

ID=87918845

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310951424.5A Pending CN116732235A (en) 2023-07-31 2023-07-31 InDel molecular marker for white pepper variety breeding and application thereof

Country Status (1)

Country Link
CN (1) CN116732235A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117385087A (en) * 2023-11-27 2024-01-12 北京市农林科学院 SNP molecular marker Me-5676929 linked with microspore embryogenic gene, application thereof and special primer

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117385087A (en) * 2023-11-27 2024-01-12 北京市农林科学院 SNP molecular marker Me-5676929 linked with microspore embryogenic gene, application thereof and special primer

Similar Documents

Publication Publication Date Title
Gady et al. Implementation of two high through-put techniques in a novel application: detecting point mutations in large EMS mutated plant populations
CN109735652B (en) Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application
CN109207622B (en) Molecular marker linked with capsicum green-staying gene and application thereof
CN108486276B (en) Pepper maturity SNP molecular marker and application thereof
CN109762921B (en) SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof
CN110157831B (en) Molecular marker coseparated with watermelon short vine gene Cldw1
CN107164533B (en) SNP (Single nucleotide polymorphism) marker of watermelon peel stripe, detection method and application
CN109338002B (en) SNP molecular marker related to watermelon peel background color and application thereof
CN112176091B (en) CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof
CN109929945A (en) The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site
CN116732235A (en) InDel molecular marker for white pepper variety breeding and application thereof
CN110205396B (en) SNP marker closely linked with irregular stripe character of cucumber fruit and application thereof
Liu et al. Development and molecular cytogenetic identification of a new wheat–Psathyrostachys huashanica Keng translocation line resistant to powdery mildew
CN109321673B (en) Method for identifying QTL (quantitative trait loci) and genes related to color of tender cucumber peel
CN110004242A (en) The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site
CN111996280B (en) SNP marker co-separated from brassica napus dwarf compact trait and application thereof
CN111100946B (en) Molecular marker primer of rape grain weight character major gene locus and application
CN114480721A (en) Method for identifying whether melon variety to be detected is thin-skin melon or thick-skin melon and special SNP primer combination thereof
Deka Molecular plant breeding and genome editing tools for crop improvement
CN107794261B (en) Molecular marker closely linked with major QTL (quantitative trait loci) of rape grain number per pod and application thereof
CN115852032B (en) Gene related to cowpea pod color, KASP (KASP-related protein kinase) marker and application thereof
CN111118196B (en) Molecular marker CNU288 primer of rape grain weight character major gene locus and application thereof
CN116640878B (en) Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof
CN113755637B (en) Wheat speckle leaf gene Lm5 coseparated KASP molecular marker and application thereof
CN113862386B (en) Indel marker linked with Cucurbita pepo L. Leaf notch gene Cpdll, and primers, kit and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination