CN112176091B - CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof - Google Patents
CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof Download PDFInfo
- Publication number
- CN112176091B CN112176091B CN202011154421.1A CN202011154421A CN112176091B CN 112176091 B CN112176091 B CN 112176091B CN 202011154421 A CN202011154421 A CN 202011154421A CN 112176091 B CN112176091 B CN 112176091B
- Authority
- CN
- China
- Prior art keywords
- eggplant
- sepal
- molecular marker
- color
- green
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
According to the invention, by a high-throughput QTL-seq technology, the full-genome polymorphic sites of green sepal eggplants and purple sepal eggplants are analyzed, SNP sites are converted into CAPS molecular markers, a CAPS molecular marker EGC277 capable of effectively screening the green sepal eggplants is obtained, and the color of the sepal eggplants can be predicted by PCR amplification, enzyme digestion of PCR products and electrophoretic detection analysis, so that single plants of the green sepal eggplants can be accurately and rapidly screened.
Description
Technical Field
The invention belongs to the field of molecular biology and eggplant breeding, and particularly relates to a CAPS molecular marker related to eggplant sepal color traits, a preparation method of the CAPS molecular marker related to eggplant sepal color traits, and application of the CAPS molecular marker related to eggplant sepal color traits.
Background
Eggplants (Solanum melongena L.) are herbaceous plants of the genus Solanum of the family solanaceae and are widely cultivated around the world, which are classified as the fourth major vegetable crop by food and agricultural organizations of the united nations. The molecular marker is used as an important genetic marker, and can be used for researches such as horticultural crop genetic map construction, QTL (quantitative trait loci) analysis, molecular marker-assisted selective breeding and the like. Among them, molecular markers such as ssr (simple sequence requests), aflp (amplified fragment length polymorphism) and caps (purified amplified polymorphism sequence) have been widely used in the fields of gene mapping of horticultural crops such as eggplant, tomato, cucumber, etc., genetic diversity analysis, etc.
Eggplant sepal color is an important fruit quality character, and is mainly an eggplant variety type with green, purple sepal and other colors. The consumption demands of the eggplant calyx color in various regions are different. At present, eggplant with green sepals is favored by consumers in many areas of China. Therefore, the color of the sepals gradually develops into one of the important characters of the eggplants, and the method has important significance on the commodity value of the eggplants.
After a while, people have made certain researches on the color of eggplant calyx from the aspects of eggplant sepal color division, genetic rules and the like. Partial research shows that the eggplant calyx color character belongs to nuclear inheritance and is controlled by two pairs of genes, and a dominant epistatic effect may exist. According to the F1 generation calyx color analysis, the fact that the purple of the calyx is dominant to the green part is considered, the color grade times of the calyx are distributed in a unimodal biased state, the character is a quantitative character controlled by multiple genes, eggplant calyx color inheritance meets two pairs of additive-dominant-epistatic major genes + additive-dominant-epistatic-multigenic models, the effects of the two pairs of major genes are mainly additive effects, and the first pair of major genes is dominant. Although there are some analyses about genetic correlation of eggplant sepal color, the genetic mechanism is not clear, and no related linked DNA molecular markers are reported.
Disclosure of Invention
The invention aims to provide a CAPS molecular marker EGC277 closely linked with the color trait of eggplant sepals, and the CAPS molecular marker discloses the information of the restrictive length variation of the PCR fragment of the closely linked gene of the color trait of the eggplant sepals. At present, no molecular marker information report related to the close linkage of eggplant sepal color characters exists, and the invention belongs to the first discovery.
The invention also aims to provide the CAPS molecular marker related to the eggplant sepal color character and the preparation method thereof.
The CAPS molecular marker is characterized by comprising a primer: f: TCATGTTCCATGTGATTGCC, respectively; r: TCCCTCCGGAAATTCTTCTT amplifying;
the amplified fragment of the CAPS molecular marker is 277bp, and the sequence is as follows (5 '-3'): TCATGTTCCATGTGATTGCCAATTAATTTGTCTTTGTTAGATCGGCAGTCGGCTCGACATCCCTCTTGTAATTTTTTTTTAAAGAGGGTAACGTGGTTAAATTGATCACTATTGTCCATGCTTTTCCAACCTCTACTTTTTTCACAAAAAAGTACACGTTGACCCATCAAAAAATCACAGCAAACGTACCTTCCAAGACGATTTGGTTCTTCATTTTTCTCCATCATCGAGCAATTTGATTGCTTTGATGCTAAAACAAGAAGAATTTCCGGAGGGA (recognition sites for BglII restriction enzymes are underlined).
After restriction enzyme BglII is used for enzyme digestion, the detection result is obtained by agarose gel electrophoresis. The molecular marker detection method is simple, and results are easy to observe and analyze.
The invention further aims to provide application of the CAPS molecular marker or the primer related to the color traits of the eggplant sepals in identifying the color genotypes of the eggplant sepals. The molecular marker can be used for molecular marker assisted breeding and eggplant sepal color genetic regulation mechanism research. The invention provides a new means for eggplant breeding, can accelerate the improvement process of the color character of eggplant sepals, and improves the breeding accuracy and the selection efficiency.
In order to achieve the purpose, the invention adopts the following technical measures:
1. a screening method of CAPS molecular markers related to eggplant sepal color traits comprises the following steps:
(1) preparing a genetic population: and hybridizing, backcrossing and selfing the green sepal eggplant high-generation selfing line variety GP05 and the purple sepal eggplant high-generation selfing line variety PP05 to prepare a genetic group.
(2) Preparation of sequencing DNA sample: extracting and mixing DNA of single plants with extreme characters (green sepals) in a green sepal parent and a backcross separation population by using a CTAB method, extracting and mixing DNA of single plants with extreme characters (purple sepals) in a purple sepal eggplant parent and a selfing separation population F2, and obtaining two eggplant sample pools of green sepals and purple sepals.
(3) High-throughput sequencing screening of SNP sites: and performing whole genome sequencing by using a new generation Hiseq2500 sequencing platform, performing whole genome comparison by using short sequence comparison software, searching reliable SNP (single nucleotide polymorphism) sites in two groups of green sepal eggplants and purple sepal eggplants, and obtaining a target character (green sepal) associated region. Through analysis, 42 scaffolds associated with the green sepal character are screened out.
(4) Conversion of SNP sites into CAPS molecular markers: based on the characteristics of the cleavage sites in 42 scaffolds screened by high throughput sequencing, 34 pairs of primers were designed, and BglII, HindIII, MboI, NcoI, NdeI and XbaI were selected as restriction enzymes for identification. In F2 generations of GP05 and PP05 and eggplant materials of other varieties with different parents, candidate CAPS molecular markers are analyzed, 34 pairs of primers are respectively subjected to PCR amplification, the PCR products are subjected to enzyme digestion identification, and enzyme digestion product polymorphism is analyzed. EGC277 was finally selected for the development of CAPS molecular markers. The molecular marker can be repeatedly detected in two groups and is shown to be closely linked with the color character of sepals. The primer sequence (5 '-3') is F: TCATGTTCCATGTGATTGCC, respectively; r: TCCCTCCGGAAATTCTTCTT, PCR the size of the product is 277bp,
the amplified fragment sequence (5 '-3') is:
TCATGTTCCATGTGATTGCCAATTAATTTGTCTTTGTTAGATCGGCAGTCGGCTCGACATCCCTCTTGTAATTTTTTTTTAAAGAGGGTAACGTGGTTAAATTGATCACTATTGTCCATGCTTTTCCAACCTCTACTTTTTTCACAAAAAAGTACACGTTGACCCATCAAAAAATCACAGCAAACGTACCTTCCAAGACGATTTGGTTCTTCATTTTTCTCCATCATCGAGCAATTTGATTGCTTTGATGCTAAAACAAGAAGAATTTCCGGAGGGA (recognition site for BglII restriction enzyme underlined)
The restriction enzyme is BglII, the size of the enzyme digestion product of the green sepal eggplant PCR fragment is as follows: 39bp and 238 bp; the size of a PCR fragment enzyme digestion product of the purple sepal eggplant is 277 bp; the sizes of the PCR fragment enzyme cutting products of the eggplant with the transitional sepal sepals are 238bp and 277 bp.
The parent materials used by the invention are a green sepal eggplant high-generation inbred line variety GP05 and a purple sepal eggplant high-generation inbred line variety PP05, which are bred by technical personnel in solanum fruit research institute of vegetable research institute in Wuhan City.
Compared with the prior art, the invention has the advantages that:
the invention firstly analyzes the polymorphism sites of the whole genome of the green sepal eggplant and the purple sepal eggplant by a new generation of high-throughput QTL-seq technology, converts the SNP sites into CAPS molecular markers, and obtains a CAPS molecular marker EGC277 capable of effectively screening the green sepal eggplant. In the conventional breeding method, the color phenotype identification of eggplant sepals can be carried out only after fruiting, which wastes time and labor and has low efficiency. By detecting the close linkage gene of the characters of the green sepals of the eggplants, the eggplants can be eliminated in the seedling stage, so that the production cost is saved, and the selection efficiency is greatly improved. The method for detecting the eggplant green sepals tightly linked CAPS molecular markers has the advantages of convenience and rapidness in detection, stable result and no environmental influence. The color of the eggplant sepals can be predicted by PCR amplification, enzyme digestion of PCR products and electrophoresis detection analysis, and then the green sepal eggplant individual plants are accurately and quickly screened.
Drawings
FIG. 1 is a schematic diagram of the PCR amplification of an EGC277CAPS molecular marker.
The lane information is as follows: m is DL2000 Marker, and the sizes of bands of the DL2000 DNA Marker are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp sequentially from top to bottom. The lane templates from 1 to 4 are the detection results of PCR amplification products of the purple sepal eggplant of PP05, the green sepal eggplant of GP05, the purple sepal eggplant of the F2 generation of PP05 and the green sepal eggplant of GP05 respectively.
FIG. 2 is a schematic diagram of the polymorphism of an EGC277CAPS molecular marker cleaved fragment.
The lane information is as follows: m is DL2000 Marker, and the sizes of bands of the DL2000 DNA Marker are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp sequentially from top to bottom. The lane templates from 1 to 4 are the enzyme digestion product detection results of the purple sepal eggplant of PP05, the green sepal eggplant of GP05, the purple sepal eggplant of the F2 generation of PP05 and GP05, and the green sepal eggplant of the green color.
FIG. 3 is a diagram showing the polymorphism of EGC277CAPS molecular marker cleaved fragments.
M is DL2000 Marker, and the sizes of bands of the DL2000 DNA Marker are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp sequentially from top to bottom. A1-24, B1-24 and C1-24 represent the detection results of the eggplant enzyme digestion amplification products from different places respectively.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1: construction and DNA extraction of eggplant sepal color genetic population
(1) Population construction
In the embodiment of the invention, eggplant varieties GP05 (green sepal eggplant) and PP05 (purple sepal eggplant) are used as parents, and hybridization (orthogonal) and selfing are carried out in spring and autumn greenhouses to prepare genetic groups, namely Pl, P2 and F2. The genetic population is simultaneously fixed in the greenhouse without separating various 30 strains of generations P1, P2 and Fl, and 240 strains of F2 are separated and cultivated and managed conventionally.
The eggplants of the two parents and the genetic population reach the mature period of the commodity, and are identified after being harvested. According to the eggplant germplasm resource description specification, two paired eggplants which reach commodity maturity, accord with strain characteristics and are normally developed are collected from each eggplant plant, the calyx photos are taken on a dark background plate, and indoor colorimetric grading is carried out. According to the parent of the tested material and the sepal color of the F2 colony, in order to cover all intermediate transition color types as much as possible and facilitate statistical analysis, the eggplant germplasm resource description specification is defined as five types of green, mixed green, purple green, mixed purple and purple.
(2) DNA extraction
Respectively extracting DNA from 10 single plant mixed samples of parent eggplant with green sepals GP05 and eggplant with purple sepals PP 05; randomly selecting 22 parts of green sepal plants from an F2 generation (a plant system of which the resource description specification is determined as green in an F2 generation), forming a green sepal progeny mixed pool BSAg together, randomly selecting 22 parts of purple sepal eggplants from an F2 generation (a plant system of which the resource description specification is determined as purple in an F2 generation), and forming a purple sepal eggplant progeny mixed pool BSAp together; a total of 4 cuvettes.
The CTAB method is used for extracting the total DNA of the leaves of the four sample pools, and the specific steps are as follows: 0.1 g of fresh cotyledon is taken, and the DNA precipitate is finally dissolved in 20 mu L of TE solution through the processes of liquid nitrogen grinding or steel ball crushing, cracking of 2 xCTAB lysate, chloroform extraction, isopropanol precipitation, 70% ethanol washing and the like. The DNA concentration was measured with an ultraviolet spectrophotometer and stored in a freezer at-20 ℃ for future use.
Example 2: high throughput sequencing for finding green sepal eggplant associated regions
(1) High-throughput sequencing: sepal color-related SNP screening: and (3) sequencing by using a Hiseq2500 sequencing platform, and performing high-throughput sequencing on the extracted eggplant parents GP05 and PP05, the eggplant green sepal filial generation mixed pool BSAg and the eggplant purple sepal filial generation mixed pool BSAp.
(2) Sequencing original sequence processing: and (3) converting an original image data file obtained by high-throughput sequencing into an original sequencing sequence (raw data) through base recognition (base locking) analysis. Then according to a certain rule, filtering the original sequencing sequence obtained by sequencing, wherein the main standards are as follows: 1) removing the reads pair with the joint; 2) when the proportion of N in the single-ended sequencing read is more than 10%, the pair of reads needs to be removed; 3) when the single-ended sequencing read contains more than 50% of the length proportion of the read with a low (less than 5) number of bases, the pair of reads needs to be removed. The sequence obtained after the filtration treatment is clean reads.
(3) SNP locus detection: clear reads obtained after filtering are aligned to a reference genome (GenBank access No. BAUE00000000.1), four samples (GP05, PP05, BSAg and BSAp) are subjected to SNP detection by utilizing GATK software, and then position information and types of SNP sites detected by the four samples are annotated by ANNOVAR software. Similarly, the InDel of the four samples is detected by using the GATK software, and the position information and the type of the InDel site detected by the four samples are annotated by using ANNOVAR software.
(4) Positioning a target character region: firstly, filtering SNP loci detected from mixed pool samples BSAg and BSAp: 1) removing the sites with the number less than 5 of reads supports in any mixed pool; 2) filtering the parental SNP type as heterozygous sites. Thereby obtaining high-quality credible SNP sites. And then, associating the target characters to related regions of the genome by using the QTL-seq method and using the sites with the significant difference of the SNP-index of the two pool samples. The calculation method of the SNP-index comprises the following steps: a certain site on the genome supports the reads signature of the mutated base/the total reads number at that site. Then calculating the SNP locus of the difference between the two mixing pools, wherein the difference of the SNP locus can be measured by delta (SNP-index), and the calculation method comprises the following steps: Δ (SNP-index) ═ SNP-index (bsag) -SNP-index (bsap).
(5) Determination of target character association region: since the eggplant reference genome is at the level of the scaffold (33873 strips), each scaffold is mapped by a method of sliding a window (window size 1kb, step length 100bp) and fitting a curve, the scaffold with a delta (SNP-index) value exceeding 99% confidence interval is selected, and the scaffold is considered to be associated with the target trait. By the method, a total of 42 scfolds associated with the sepal color trait are screened.
Example 3: design and Synthesis of polymorphic primers
Based on the 42 scaffold sequence features obtained by high-throughput sequencing that could be associated with the green sepal trait, 34 pairs of Caps primers were designed, and BglII, HindIII, MboI, NcoI, NdeI, and XbaI were selected as identifying restriction enzymes. Through these primers, PCR amplification is carried out on two parental DNAs, the PCR amplification product is cut by restriction endonuclease, and then the size of the band is distinguished through agarose gel electrophoresis and dyeing, and polymorphic primers are screened. The primer sequence was synthesized by Beijing Oaku Biotechnology Inc., and restriction enzymes were purchased from NEB.
Example 4: screening and detecting method of CAPS molecular marker primer
(1) 10 DNA strains randomly selected from each parent were mixed in equal amounts and used as templates for screening primers. After the primers are dissolved, the parental DNA is subjected to PCR amplification. The reaction system is as follows:
wherein rTaq, a buffer solution matched with DNA polymerase and dNTPs are products of Takara (Chinese Dalian).
(2) The PCR amplification procedure was:
(3) the PCR product digestion reaction system is (BglII as an example):
incubate at 37 ℃ for 3 hours in an incubator, and stop the reaction by adding stop solution. Wherein, the restriction enzyme and the buffer solution matched with the restriction enzyme are products of NEB company.
(4) Agarose gel electrophoresis, imaging and analysis:
preparation of 1.5% strength agarose gel: 0.3 g agarose was weighed and added to a triangular flask containing 20mL 0.5 XTBE buffer, heated in a microwave oven until the agarose was completely dissolved, and when the solution was completely clear, the heating was stopped, cooled to about 55 ℃, and 1. mu.L GeneRed nucleic acid staining solution (Tiangen Biochemical technology (Beijing) Co., Ltd.) was added. After the gel is completely solidified, putting the gel into a horizontal electrophoresis tank, adding 9 mu L of enzyme digestion product containing stop solution into a gel spot sample hole, switching on a power supply to carry out electrophoresis, wherein the electrophoresis conditions are as follows: the voltage of the electrophoresis apparatus is 200V, and the electrophoresis time is 18 min. Photographs were then taken by a UV Gel imaging system (BIO-RAD Gel Doc XR + Gel imaging analysis system). And observing the position difference of the bands of the two parent PCR products after enzyme digestion.
(5) And (3) identifying the polymorphism of the primer: the DNA of parent GP05 and PP05 are used as templates, and specific bands can be amplified by 34 pairs of synthesized primers through PCR amplification. After being cut by the corresponding endonuclease BglII, HindIII, MboI, NdeI, NcoI and XbaI respectively, electrophoresis detection shows that the cut products of 7 pairs of primer amplified fragments show polymorphism.
(6) Determination of eggplant green sepal CAPS molecular marker: and (3) further verifying the 7 pairs of primers which show polymorphism by using eggplants with different sepal colors as materials to judge whether the polymorphism of the enzyme-digested fragment of the amplification product is related to the sepal color. Finally, the polymorphism of the amplified fragment enzyme digestion product of the primer EGC277 is found to be better linked with the color of eggplant sepals.
The sequences of the pair of primers are as follows: EGC277_ F: TCATGTTCCATGTGATTGCC, respectively;
EGC277_ R: TCCCTCCGGAAATTCTTCTT are provided. The size of the PCR amplification product is 277bp,
the amplified fragment sequence (5 '-3') is:
TCATGTTCCATGTGATTGCCAATTAATTTGTCTTTGTTAGATCGGCAGTCGGCTCGACATCCCTCTTGTAATTTTTTTTTAAAGAGGGTAACGTGGTTAAATTGATCACTATTGTCCATGCTTTTCCAACCTCTACTTTTTTCACAAAAAAGTACACGTTGACCCATCAAAAAATCACAGCAAACGTACCTTCCAAGACGATTTGGTTCTTCATTTTTCTCCATCATCGAGCAATTTGATTGCTTTGATGCTAAAACAAGAAGAATTTCCGGAGGGA (recognition site for BglII restriction enzyme underlined)
After the eggplant is cut by the restriction enzyme BglII, the size of the green sepal eggplant enzyme-cut product is as follows: 238bp and 39 bp; the purple sepal eggplant is 277 bp; other transition color sepal eggplants (the materials of hybrid green, purple green and hybrid purple are specified by eggplant germplasm resource description specifications) are 238bp and 277 bp. Therefore, EGC277 was finally identified as a molecular marker associated with eggplant green sepals.
Example 5: suitability identification of CAPS molecular marker EGC277 in eggplant sepal color screening
Selecting 72 parts of eggplant materials with different color sepals (green, middle and purple), wherein the eggplant materials are variety resources collected from different places in the department, have different local sources with the parent materials in the invention, and can be used as test materials for testing whether the primers have universal applicability. The CAPS molecular marker of the invention is verified. The genomic DNA of the above eggplant leaves was extracted by the CTAB method, primers corresponding to the molecular markers of EGC277CAPS were used for PCR amplification, and the PCR amplification products were digested with BglII and the size of the fragments was identified (see example 4).
(1) The field resource description result shows that:
35 samples of A1-23, B6, B20-24 and C17-24 are eggplant calyx Hibisci,
18 samples of A24, B1-5, B7, B8 and C1-10 are eggplant calyx shaped like purple;
16 samples of B9-19 and C11-16 are medium color sepal eggplant;
(2) EGC277CAPS marker detection showed:
as can be seen from fig. 3:
1) in green sepal eggplant, the CAPS molecular marker has 32 sample enzyme digestion bands capable of obtaining 238bp specific bands, and 3 strains do not accord with the marker detection result, wherein the enzyme digestion of A1 and A5 can obtain 277bp and 238bp bands, and A9 can only obtain 277bp bands;
2) in the eggplant with purple sepal, the CAPS molecular marker can obtain 277bp bands in 18 samples through enzyme digestion, and all the bands are consistent with the molecular marker result;
3) in the eggplant with the intermediate color, the CAPS molecular marker can obtain 277bp and 238bp bands by enzyme digestion in 12 samples, and 3 strains accord with the detection result of the molecular marker, wherein the 277bp bands can only be obtained by enzyme digestion in B11, B13 and C13 samples.
4) In addition, 3 strains did not amplify any fragments, numbered A3, A23 and B15, which were not amplified due to DNA degradation and were eliminated in the final analysis.
In the implementation case, the molecular marker EGC277CAPS for detecting the green sepals of the eggplants and the detection primers thereof are developed, the accuracy rate of sepal color discrimination reaches 89% (table 1; 62 field resource character observation results in 69 materials are consistent with the molecular marker detection results), and the identification can be carried out from the level of leaves at the seedling stage, so that the production cost is saved, the operation is simple and convenient, the color of the sepals of the eggplants can be effectively detected, and the method can be used for breeding the eggplants related to the sepals.
Table 1 data identifying the colour of eggplant sepals using EGC277CAPS molecular markers.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Wuhan City college of agricultural sciences
<120> CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 277
<212> DNA
<213> eggplant (Solanum melongena)
<400> 1
tcatgttcca tgtgattgcc aattaatttg tctttgttag atcggcagtc ggctcgacat 60
ccctcttgta attttttttt aaagagggta acgtggttaa attgatcact attgtccatg 120
cttttccaac ctctactttt ttcacaaaaa agtacacgtt gacccatcaa aaaatcacag 180
caaacgtacc ttccaagacg atttggttct tcatttttct ccatcatcga gcaatttgat 240
tgctttgatg ctaaaacaag aagaatttcc ggaggga 277
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Claims (7)
1. A CAPS molecular marker EGC277 closely linked with eggplant sepal color characters is characterized in that a nucleic acid sequence of the molecular marker is obtained by PCR amplification of primers shown in SEQ ID NO. 2-3.
2. The molecular marker EGC277 of claim 1 wherein the PCR amplification product has a size of 277bp, and after digestion with the restriction enzyme BglII, the size of the green sepal eggplant cleaved product is: 238bp and 39 bp; the purple sepal eggplant is 277 bp; the other transition color sepal eggplants are 238bp and 277 bp.
3. The molecular marker EGC277 of claim 2, wherein the transient color is defined as heterogreen, purple green and heteropurple according to eggplant germplasm resource description specifications.
4. The molecular marker EGC277 of any of claims 1 to 3 wherein the nucleic acid sequence of the molecular marker is set forth in SEQ ID NO. 1.
5. A preparation method of CAPS molecular markers related to eggplant sepal color traits is characterized in that the CAPS molecular markers are obtained by PCR amplification through primers shown in SEQ ID NO. 2-3, enzyme digestion through restriction endonuclease BglII and agarose gel electrophoresis.
6. Use of the CAPS molecular marker of any one of claims 1-4 for identifying eggplant sepal color genotypes.
7. Use of the primers as claimed in claim 1 for identifying the sepal color genotype of eggplant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011154421.1A CN112176091B (en) | 2020-10-26 | 2020-10-26 | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011154421.1A CN112176091B (en) | 2020-10-26 | 2020-10-26 | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112176091A CN112176091A (en) | 2021-01-05 |
| CN112176091B true CN112176091B (en) | 2021-07-27 |
Family
ID=73923073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011154421.1A Active CN112176091B (en) | 2020-10-26 | 2020-10-26 | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112176091B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813191B (en) * | 2021-03-30 | 2021-08-10 | 天津市农业科学院 | Molecular marker related to eggplant sepal covering pericarp color and application |
| CN116426684A (en) * | 2023-04-24 | 2023-07-14 | 上海市农业科学院 | InDel molecular marker closely linked with eggplant peel color traits and application |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011074964A1 (en) * | 2009-12-18 | 2011-06-23 | Keygene N.V. | Improved bulked mutant analysis |
| WO2013006058A1 (en) * | 2011-07-07 | 2013-01-10 | Keygene N.V. | Use of jaz5a for improving drought-resistance in a plant |
| CN103103268A (en) * | 2013-01-22 | 2013-05-15 | 上海交通大学 | Development and application method of solanum melongena L. EST-SSR marker |
| CN103571833A (en) * | 2013-11-18 | 2014-02-12 | 四川农业大学 | Design method of SSR label primer and wheat SSR label primers |
| CN108411027A (en) * | 2018-05-24 | 2018-08-17 | 武汉市农业科学院 | It is a kind of detection capsicum CMS fertility restorer genes CAPS molecular labeling primers and application |
| CN108676903A (en) * | 2018-05-24 | 2018-10-19 | 武汉市农业科学院 | A kind of primer SmemboI-1 of the imperial No. three eggplant Purities of purple based on SNP marker and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701926B (en) * | 2016-12-09 | 2018-03-02 | 广东省农业科学院蔬菜研究所 | Eggplant fruit color epistatic gene D positioning and its InDel molecular markers developments and application |
-
2020
- 2020-10-26 CN CN202011154421.1A patent/CN112176091B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011074964A1 (en) * | 2009-12-18 | 2011-06-23 | Keygene N.V. | Improved bulked mutant analysis |
| WO2013006058A1 (en) * | 2011-07-07 | 2013-01-10 | Keygene N.V. | Use of jaz5a for improving drought-resistance in a plant |
| CN103103268A (en) * | 2013-01-22 | 2013-05-15 | 上海交通大学 | Development and application method of solanum melongena L. EST-SSR marker |
| CN103571833A (en) * | 2013-11-18 | 2014-02-12 | 四川农业大学 | Design method of SSR label primer and wheat SSR label primers |
| CN108411027A (en) * | 2018-05-24 | 2018-08-17 | 武汉市农业科学院 | It is a kind of detection capsicum CMS fertility restorer genes CAPS molecular labeling primers and application |
| CN108676903A (en) * | 2018-05-24 | 2018-10-19 | 武汉市农业科学院 | A kind of primer SmemboI-1 of the imperial No. three eggplant Purities of purple based on SNP marker and application |
Non-Patent Citations (3)
| Title |
|---|
| "A RAD Tag Derived Marker Based Eggplant Linkage Map and the Location of QTLs Determining Anthocyanin Pigmentation";Lorenzo Barchi et al.;《PLOS ONE》;20120817;第7卷(第8期);第1-11页 * |
| "茄子SSR多态性标记筛选及杂交种纯度鉴定";张洪源等;《南方农业学报》;20171231;第48卷(第7期);第1148-1154页 * |
| "茄子紫色形成的分子研究进展";张映等;《园艺学报》;20191231;第46卷(第9期);第1779-1796页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112176091A (en) | 2021-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108004344B (en) | Corn whole genome SNP chip and application thereof | |
| CN110295251B (en) | SNP molecular marker linked with wheat effective tillering number QTL and application thereof | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN105925721B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits epidermis coloring character | |
| CN107488659B (en) | Sequence related to red and yellow color characters of citrus peels and application thereof | |
| CN106916897B (en) | Molecular marker for identifying purity of pumpkin hybrid seeds 'Yinhui No. three' of Indian pumpkin and application of molecular marker | |
| CN112176091B (en) | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof | |
| CN112289384B (en) | Construction method and application of citrus whole genome KASP marker library | |
| CN113795597A (en) | Soybean SNP typing detection chip and application thereof in molecular breeding and basic research | |
| CN104789648B (en) | Identify molecular labeling and its application of the section haplotypes of rice CMS restoring genes Rf 1 | |
| CN117265168A (en) | Molecular marker related to protein content in soybean and application thereof | |
| CN111979346A (en) | Improved variety peach breeding method based on KASP molecular marker | |
| CN115896331A (en) | SNP molecular marker and dCAPS molecular marker closely linked with eggplant peel color character and application thereof | |
| CN107760798B (en) | SSR molecular marker of seedless major QTL (quantitative trait locus) of grape fruit | |
| CN113584204B (en) | DNA fragment related to kernel yield of camellia seeds, SNP molecular marker closely linked with DNA fragment and application of DNA fragment | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| CN111235301B (en) | Method for identifying authenticity of bitter gourd varieties and special SSR primer combination thereof | |
| CN103740856B (en) | Molecular method for predicting verticillium wilt resisting capability of different cotton materials | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| CN111394502A (en) | InDel marker and method for identifying RN type CMS (cytoplasmic male sterility) restoring gene of soybean | |
| CN115341047B (en) | Molecular marker related to asexual shape of trilobatin of Malus and application thereof | |
| CN116875728B (en) | KASP molecular marker group for identifying five-leaf strawberries and application thereof | |
| CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof | |
| CN114622033B (en) | SNP (Single nucleotide polymorphism) marker linked with color traits of ripe cucumber peel and application thereof | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |