CN116716409A

CN116716409A - Transcription factor for regulating and controlling AFAP1-AS1 expression and application thereof in breast cancer diagnosis or treatment

Info

Publication number: CN116716409A
Application number: CN202310974377.6A
Authority: CN
Inventors: 张晓辉; 李方园; 冼达亨; 黄俊颖; 聂龙珠; 周易冬; 孙强
Original assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Current assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date: 2023-08-04
Filing date: 2023-08-04
Publication date: 2023-09-08

Abstract

The invention relates to the field of biotechnology, and discloses a transcription factor for regulating and controlling AFAP1-AS1 expression and application thereof in diagnosis or treatment of breast cancer. Through a series of experiments, the SP1 is found to be an upstream regulator of the AFAP1-AS1 in TNBC, and the SP1 can be used AS an upstream transcription factor of the AFAP1-AS1 to directly interact with a promoter region P3 of the AFAP1-AS1, so that the expression of the AFAP1-AS1 is regulated, the proliferation of a TNBC cell line is caused, and the tumor development is promoted. It was also found that transcription factor SP1 further activates the mTOR pathway by increasing the expression of AFAP1-AS, thereby promoting tumorigenesis. The research of the invention is beneficial to analyzing and understanding the expression of AFAP1-AS1 in tumors and the specific molecular mechanism of AFAP1-AS1 in the tumorigenesis and development process, and can also lay a theoretical foundation for the diagnosis and treatment related regulation and control research of AFAP1-AS1.

Description

Transcription factor for regulating and controlling AFAP1-AS1 expression and application thereof in breast cancer diagnosis or treatment

Technical Field

The invention relates to the field of biotechnology, in particular to a transcription factor for regulating and controlling AFAP1-AS1 expression and application thereof in diagnosis or treatment of breast cancer.

Background

AFAP1-AS1 has been found to be upregulated in almost all kinds of malignant tissues, such AS lung cancer, breast cancer, osteosarcoma, etc., with upregulation having a significant impact on increasing malignancy and decreasing patient survival. In particular, overexpression of AFAP1-AS1 is found in Triple Negative Breast Cancer (TNBC) tissues and cells, exerts oncogenic activity, and is associated with low survival in TNBC patients. Therefore, the research of AFAP1-AS1 has important significance on the molecular mechanism of TNBC.

Some current research focuses on the downstream molecular mechanisms of AFAP1-AS1 on TNBC, especially AS a sponge for cancer-related miRNAs, whereas the upstream regulation of AFAP1-AS1 is rarely studied and reported. However, researching the transcription factor directly acting with the AFAP1-AS1 and the upstream channel is beneficial to analyzing and understanding the expression of the AFAP1-AS1 in tumors and the specific molecular mechanism of the AFAP1-AS1 in the tumorigenesis and development process, and can also lay a theoretical foundation for the regulation and control research related to diagnosis and treatment of the AFAP1-AS1.

Disclosure of Invention

In view of the above problems, the present invention provides a transcription factor for regulating and controlling AFAP1-AS1 expression and its application in diagnosis or treatment of breast cancer.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

in a first aspect, the invention provides the use of a transcription factor regulating the expression of AFAP1-AS1, said transcription factor being SP1, for the preparation of a product for diagnosing or treating breast cancer.

Further, the breast cancer is a triple-negative breast cancer.

Further, the specific mode of regulating the expression of the AFAP1-AS1 by the transcription factor SP1 is AS follows: the transcription factor SP1 activates AFAP1-AS by binding to the P3 region of the promoter region of AFAP1-AS1, thereby increasing the expression of lncRNA AFAP1-AS1.

Further, the transcription factor SP1 further activates the mTOR pathway by increasing the expression of AFAP 1-AS.

Further, the product is a chip, a reagent or a kit.

In a second aspect, the invention provides an siRNA for diagnosing or treating breast cancer, wherein the siRNA is si-SP1, the sequences of the siRNA are shown as SEQ ID NO.1 and SEQ ID NO.2,

SEQ ID NO.1：GUGCAAACCAACAGAUUAUTT

SEQ ID NO.2：AUAAUCUGUUGGUUUGCACTT。

in a third aspect, the present invention provides a reagent for diagnosing or treating breast cancer, wherein the reagent is a reagent for detecting the expression levels of AFAP1-AS1 and SP1 after transfection of si-SP 1.

In a fourth aspect, the invention provides a kit for diagnosing or treating breast cancer, comprising si-SP1, RT-PCR primers for AFAP1-AS1 and SP1, other reagents required for RT-PCR and reagents required for WB.

Further, the sequences of the forward primer and the reverse primer of the RT-PCR for detecting the expression quantity of the AFAP1-AS1 are respectively shown AS SEQ ID NO.3 and SEQ ID NO.4,

SEQ ID NO.3:AATGGTGGTAGGAGGGAGGA

SEQ ID NO.4:CACACAGGGGAATGAAGAGG。

further, the forward primer and reverse primer sequences of the RT-PCR for detecting the SP1 expression level are respectively shown as SEQ ID NO.5 and SEQ ID NO.6,

SEQ ID NO.5:TTGCTGCTATGCCAAACCTA

SEQ ID NO.6：CCTGAGAGCTGGGAGTCAAG。

compared with the prior art, the invention has the following advantages:

the invention discovers that SP1 is an upstream regulator of AFAP1-AS1 in TNBC, and that SP1 can be used AS an upstream transcription factor of AFAP1-AS1 to directly interact with a promoter region P3 thereof, thereby regulating the expression quantity of AFAP1-AS1, inducing proliferation of TNBC cell lines and promoting tumor progression.

After analysis of mRNA expression after AFAP1-AS1 silencing in MDA-MB-231 and MDA-MB-468 cells, the invention finds that some genes are regulated with the same trend, such AS SGK1, EIF4B, MAPKAP1, NEDD4L, SEH1L and SKP2, and the expression of the six genes is confirmed by RT-qPCR and Western blot analysis. It was concluded that AFAP1-AS1 can activate the mTOR pathway, resulting in a change in expression of several related genes, thus promoting tumorigenesis.

The research of the invention is beneficial to analyzing and understanding the expression of AFAP1-AS1 in tumors and the specific molecular mechanism of AFAP1-AS1 in the tumorigenesis and development process, and can also lay a theoretical foundation for the diagnosis and treatment related regulation and control research of AFAP1-AS1.

Drawings

FIG. 1 shows that SP1 increases the expression level of lncRNA AFAP1-AS1. Wherein, RT-qPCR (A) and Western blot (B) experiments prove that siRNA, i.e. si-SP1, has silencing effect. (C) After si-SP1 silences SP1, the amount of expression of lncRNA AFAP1-AS1 changes.

FIG. 2 shows the transcription of SP1 in TNBC cells to activate lncRNA AFAP1-AS1. Wherein, (A) Motif diagram of SP 1; (B) Predicting the SP1 binding site in the lncRNA AFAP1-AS1 promoter sequence by JASPAR; (C) The ChIP assay demonstrated that SP1 binds to the lncRNA AFAP1-AS1 promoter region at P3; (D) Over-expression of SP1 by the ov-SP1 vector was confirmed by western blotting; (E) determination of the binding site P3 by a double luciferase assay.

FIG. 3 is a graph showing that SP1 promotes lncRNA AFAP1-AS1 mediated proliferation and migration of TNBC cells. (A) RT-qPCR confirmed that SP1 overexpression rescued lncRNA AF AP1-AS expression caused by lncRNA AFAP1-AS1 silencing. (B) The CCK-8 assay (where P value is an analytical statistic in the 72 hour group) and (C) the colony formation assay evaluated the promotion of SP1 overexpression on lncRNA AFAP1-AS1 mediated TNBC cell proliferation; (D) 48 hours of Transwell assay and (E) wound healing assay the promotion of SP1 overexpression on lncRNA AFAP1-AS1 mediated TNBC cell migration was assessed.

FIG. 4 is a graph showing that SP1 promotes tumorigenesis of TNBC cells in vivo. (A) Tumor volume (B) tumor weight and tissue in nude mice (statistical analysis and P-values shown here were analyzed within 30 days). (C) Immunohistochemical staining of Ki67 in mouse tumor tissue.

FIG. 5 shows the expression of lncRNA AFAP1-AS1 regulatory genes. (A) Changing the number of genes and (B) scatter plots after lncRNA AFAP1-AS1 knockout. (C) The number of coincidences of the down-regulated genes between MDA-MB-231 and MDA-MB-468 cells. (D) KEGG pathway analysis to downregulate gene enrichment in MDA-MB-231 and MDA-MB-468 cells. (E) GO enrichment analysis of the first 5 downregulated MDA-MB-231 and MDA-MB-468 cells.

FIG. 6 shows LncRNA AFAP1-AS1 regulating gene expression of mTOR pathway. (A) FISH analysis indicated that most of the lncRNA AFAP1-AS1 was localized in the cytoplasm. (B) RT-qPCR and (C) Western blotting assess mRNA expression of mTOR pathway genes.

Detailed Description

The technical scheme of the invention is specifically and specifically described below with reference to the embodiment of the invention and the attached drawings. It should be noted that the following examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.

The experimental methods used in the examples below are conventional methods unless otherwise specified.

All materials, reagents, etc. in the examples described below are commercially available unless otherwise specified.

The experimental method comprises the following steps:

1. MDA-MB-231 and MDA-MB-468 cell culture

MDA-MB-231 and MDA-MB-468 cells were cultured in an L15 culture medium containing 20% fetal bovine serum at 37℃in a 100% air incubator. When the cells grow and merge to 80%, the original culture medium is discarded, 0.25% pancreatin 1ml is evenly added, the cells are put into an incubator to be digested for about 1-5 min, after the adherent cells are rounded, the digestion is stopped by 1ml culture medium, the cells are blown and mixed uniformly, single cell suspension is prepared and transferred into a 15 ml centrifuge tube, and the single cell suspension is centrifuged for 3 min in a low-speed centrifuge at 1000 r/min. The supernatant is sucked off, and a proper amount of culture medium is added to the cell sediment for 1/4 to 1/3 passage, and each 2 to 3 passages d passage is carried out for 1 time. The morphological changes were observed with an inverted microscope.

2. Cell transfection of small interfering RNA (small interfering RNA, siRNA)

Cells in log phase were taken for the experiment. MDA-MB-231 cells and MDA-MB-468 cells

Respectively divided into 2 groups:

(1) si-NC group (siRNA of transfection control)

(2) si-SP1 group (transfection of corresponding siRNA)

The sequence of si-SP1 is as follows:

GUGCAAACCAACAGAUUAUTT（SEQ ID NO.1）

AUAAUCUGUUGGUUUGCACTT（SEQ ID NO.2）

1) Taking 6-well plate transfection as an example, cells were seeded into 12-well plates one day before transfection, each well was cultured with 1ml L15 medium containing 20% fetal bovine serum, and cells were pooled from 60-80% each well the next day of transfection.

2) lipofectamine 3000 transfected siRNA in cells, si-SP1 final concentration was 50 nM (mother liquor concentration was 20. Mu.M), and mixed well.

3) Incubator 37 ℃ culture 72 h.

3. Fluorescent quantitative PCR (RT-qPCR) verification after transfection

a. Extraction of cellular RNA

(1) 1ml Trizol was added to each well of cells in the 6-well plate, and the gun was blown, taking care of the ice-on procedure.

(2) The lysate of each well was aspirated into a 1.5 ml EP tube, chloroform 0.2. 0.2 ml/tube was added, vortexed for 15 s, incubated at 15-30℃for 2-3 min, and centrifuged (4 ℃,12000 g,15 min).

(3) After centrifugation the liquid was separated into three layers and the upper colourless liquid was carefully aspirated into a new EP tube.

(4) Adding equal volume of isopropanol into each tube, mixing, incubating at 15-30deg.C for 10-30 min, and centrifuging (4deg.C, 12000 g,10 min).

(5) Removing supernatant, adding absolute ethanol 1ml into the precipitate, mixing, centrifuging (4deg.C, 7500 g,1 min), and washing for 2 times.

(6) Carefully remove the supernatant, empty for 1 min, suck the supernatant with a small gun head, and remove as much as possible. And (5) opening the cover at room temperature and standing for 5-10 min to dry the pipe wall.

(7) 20. Mu.L of DEPC water was added for dissolution and stored in a refrigerator at-70 ℃.

(8) The ultraviolet spectrophotometer determines the Optical Density (OD) of the total cellular RNA at 260 nm and 280 nm and calculates the RNA content and purity.

b. RT preparation of cDNA

Preparing a reaction system

5×PrimeScript Buffer（for Real Time） 4 μL

PrimeScript RT Enzyme Mix I 1 μL

Random 6 mers（100 μM） 4 μL

Total-RNA 2. Mu.g

RNase Free dH ₂ O is added to 20 mu L

Reaction conditions:

37. 15 min (reverse transcription reaction); 85. DEG C5 sec (reverse transcriptase inactivation reaction); 4. DEG C

c. Fluorescent quantitative PCR amplification of genes to be detected and GAPDH

Primer sequence:

lncRNA-AFAP1-AS1-S（SEQ ID NO.3） 5' AATGGTGGTAGGAGGGAGGA 3'

lncRNA-AFAP1-AS1-AS（SEQ ID NO.4）5' CACACAGGGGAATGAAGAGG 3'

SP1-S（SEQ ID NO.5） 5' TTGCTGCTATGCCAAACCTA 3'

SP1-AS（SEQ ID NO.6） 5' CCTGAGAGCTGGGAGTCAAG 3'

GAPDH-S（SEQ ID NO.7） 5' ATGACATCAAGAAGGTGGTGAAGCAGG 3'

GAPDH-AS（SEQ ID NO.8） 5' GCGTCAAAGGTGGAGGAGTGGGT 3'

reaction system

SYBR® Premix Ex Taq II(Tli RNaseH Plus)（2×） 10 μL

PCR Forward primer (10. Mu.M) 0.8. Mu.L

PCR reverse primer (10. Mu.M) 0.8. Mu.L

RT reaction solution (cDNA solution) 2. Mu.L

ROX Reference Dye or Dye II（50×） 0.4 μL

Sterilized water was added to 20. Mu.L

Reaction conditions: 95. 30 sec at C; 95. DEG C5 sec,60 ℃ 30 sec, X40; 95. 15 sec at C; 60. 60 sec at C; 95. 15 sec.

4. Detection of SP1 protein expression by Western Blot (WB)

(1) The cells were lysed with a1 Xloading buffer, respectively, and the samples were boiled for 5 min.

(2) WB detection of SP1 expression

1) Preparation of SDS denatured 10% polyacrylamide gel (lower layer separation gel)

1% methylene: 780. mu L;

30% acrylamide: 2 mL;

1.5 M Tris-Cl (pH 8.8)：1.5 mL；

20% SDS：30μL；

10% ammonium persulfate: 40. mu L;

TEMED：4.0 μL

after mixing, rapidly pouring the gel to about 2/3 of the total height of the glass plate, adding water saturated n-butanol 1mL above the gel to ensure the smoothness of the upper layer of the gel, and standing for gelation and solidification.

2) Preparation of SDS denatured 4% polyacrylamide gel (Upper concentrated gel)

1% methylene: 200. Mu.L;

30% acrylamide: 270. mu L;

1.0 M Tris-Cl (pH 6.8)：500 μL；

20% SDS：30 μL；

10% ammonium persulfate: 40. mu L;

TEMED：4 μL

after mixing evenly, glue is quickly filled to the glass plate, a comb is inserted, and the mixture is stood for gelation and fixation. The comb was pulled off before electrophoresis, the gel was placed in1 XTris-glycine running buffer and the loading well was purged with syringe needle.

3) Samples of 10. Mu.L of the protein were loaded and subjected to SDS-denaturing 10% polyacrylamide gel electrophoresis (SDS-PAGE) until the target protein was effectively separated, and then the electrophoresis was stopped.

4) And taking out the gel after electrophoresis, placing the gel in a sandwich clamp special for transferring the gel, placing the gel in a negative electrode, placing a PVDF membrane in a positive electrode, and transferring the protein in the gel to the PVDF membrane to form a print by transferring the 200 mA constant flow membrane 1 h in a transfer buffer solution at the temperature of 4 ℃.

5) The membrane was placed in a blocking solution and blocked for half an hour with shaking at room temperature.

6) Membranes were cut at the blotting site and placed in dilutions of antibodies containing the corresponding primary antibodies (rabbit anti-SP 1 and murine anti-GAPDH), respectively, and shaken overnight at 4 ℃.

7) The membrane was placed in a1 XTBST solution and rinsed with shaking for 5 min for a total of 3 times.

8) Membranes were placed in TBST with the corresponding secondary antibody (HRP-labeled goat anti-rabbit/mouse IgG antibody) at room temperature for 1 h.

9) The membrane was placed in a1 XTBST solution and rinsed with shaking for 5 min for a total of 3 times.

10 The film was placed in Super ECL Plus hypersensitive glow for 2 min.

11 Immediately, the film is placed in an exposure box, and the photosensitive film is exposed in a darkroom, and then subjected to development and fixing treatment.

5. Construction and transfection of cell transfected SP1 overexpression plasmid

(1) Basic information of SP1 overexpression plasmid

(2) Plasmid transfection

Cells in log phase were taken for the experiment. MDA-MB-231 cells and MDA-MB-468 cells were divided into 2 groups:

(1) NC group (transfection pcDNA3.1-NC plasmid)

(2) SP1 overexpression group (transfection SP1 overexpression plasmid)

2) lipofectamine 3000 transfected the corresponding plasmid into cells, the single well dose of plasmid was 2 μg, and mixed well.

3) Incubator 37 ℃ culture 72 h.

6. CHIP test

a. Solution preparation

1.Glycine Solution (10X): if precipitate is formed, preheating in 37deg.C warm water for 30 min, and vortex for use;

pbs: if precipitate forms, heating to 37deg.C in water bath, swirling after 30 min, diluting PBS (20X) to 1X with water without nuclease;

3.1M DTT: 50. Mu.L of nuclease-free pure water was added to DTT, and the solution was allowed to stand at-20℃for 6 months;

4.DNA Column Binding Buffer: adding 120 mu L of pH indicator into a 30 mL DNA Column Binding Solution bottle, uniformly mixing, and preserving at room temperature;

5.DNA Column Wash Buffer: adding 24 mL ethanol (95-100%) into 6 mL DNA Column Wash Solution bottle, mixing, and preserving at room temperature;

6.Membrane Extraction Buffer: to 200. Mu. L of Membrane Extraction Buffer in an EP tube on ice, 2. Mu.L of Hall Cocktail was added;

7.MNase Digestion Buffer Working Solution: to 210. Mu. L of MNase Digestion Buffer in an EP tube was added 0.21. Mu.L of 1M DTT and left at room temperature;

8.1X IP Dilution Buffer: to 395. Mu.L of enzyme-free water were added 100. Mu.L of IP solution/Wash Buffer (5X) and 5. Mu. L of Halt Cocktail, and stored at 4 ℃;

9.IP Wash Buffer 1: adding 0.6 mL IP Dilution Buffer/Wash Buffer (5X) into 2.4 mL enzyme-free water and storing at 4 ℃;

10.IP Wash Buffer 2: 200. Mu.L of IP solution/Wash Buffer (5X) and 70. Mu.L of sodium chloride (5M) were added to 730. Mu.L of enzyme-free water and stored at 4 ℃;

11.1X IP Elution Buffer: IP Elution Buffer (2X) was preheated to complete dissolution in a 37℃water bath. For each ChIP reaction or total Input control, 150 μl of 1X IP Elution Buffer was prepared, containing 75 μl of 75 μ L IP Elution Buffer (2X) and 75 μl of enzyme-free water, and left at room temperature;

ChIP flow:

A. cross-linking and cell harvesting

1. Culturing adherent cells;

2. adding a sufficient amount of 16% formaldehyde to each dish containing a cell culture medium to obtain a final concentration of 1% formaldehyde to fix cells;

3. slightly stirring uniformly, and incubating in a chemical fume hood at room temperature for 10 min;

4. adding glycine solution (10×) to a final concentration of 1×, gently stirring, and incubating in a fume hood at room temperature for 5 min;

5. sucking out the culture solution containing formaldehyde and glycine;

6. washing cells twice with precooled PBS of the same volume of the culture solution, and sucking the cells;

7. 10. Mu.L of Hall Cocktail was added to 1mL precooled PBS, added to a petri dish, scraped off with cells and the suspension transferred to an EP tube with a pipette;

8.3000 Xrcf for 5 min;

9. removing the supernatant and then carrying out subsequent operation;

B. cleavage and Mnase digestion

1. Using the cells collected in the above experiment;

2. 200. Mu.L of Membrane Extraction Buffer containing protease/phosphatase inhibitor is added, broken cells are blown by a pipette, vortexed 15 s and then incubated on ice for 10 min for lysis;

3.9000 Xrcf, centrifuging at 4deg.C for 3 min, and removing supernatant;

4. resuspending the nuclear pellet with 200 μ L MNase Digestion Buffer working fluid;

5. diluting MNase (ChIP grade, 10 u/. Mu.L), adding 0.5. Mu.L MNase into 4.5. Mu. L MNase Digestion Buffer working solution, and blowing and mixing by a pipette (diluted MNase cannot be stored);

6. 2. Mu.L of diluted MNase was added to the nuclear suspension, and after vortexing, incubated in a 37℃water bath for 15 min, during which vortexing was performed every 5 min;

7. digestion was stopped by addition of 20 μ L MNase Stop Solution, vortexed and incubated on ice for 5 min;

8.9000 Xrcf, centrifuged at 4℃for 5 min, and the supernatant removed to re-collect the nuclei;

9. nuclei were resuspended with 100 μl of 1× IP Dilution Buffer protease/phosphatase inhibitor;

10. the nuclei were sonicated several times on ice with a gap of 20 s between pulses;

11.9000 Xrcf, centrifuged for 5 min at 4℃and the supernatant transferred to a new EP tube;

C. immunoprecipitation (Buffer all requires precooling in the following procedure)

1. 10. Mu.L of the lysate from the above procedure was taken into a new EP tube as 10% Input;

2. 90. Mu.L of the cleavage supernatant obtained in the above-described operation was added to 410. Mu.L of 1X IP Dilution Buffer;

3. adding a primary antibody. 2-4×10 ⁶ For best results, the following antibody numbers were used:

positive control IP: add 10. Mu.L of Anti-RNA Polymerase II Antibody

Negative control IP: 1-2 mu L Normal Rabbit IgG is added

Sample IP: 10 μg of antibody was used per IP reaction;

4. the IP reaction was incubated overnight at 4 ℃ with mixing;

5. vortex resuspended Protein A/G Magnetic Beads and add 20. Mu.L to each IP system and mix overnight at 4 ℃;

6. removing the supernatant on a magnetic rack, adding 1mL Wash Buffer 1, and incubating for 5 min after resuspension, and washing for 3 times;

7. removing the supernatant on a magnetic rack, adding 1mL Wash Buffer 2, and incubating for 5 min after resuspension;

IP elution

1. Adding 150 mu L IP Elution Buffer to the washed beads, incubating for 40 min at 65 ℃, and shaking vigorously every 10 min;

2. a new EP tube was prepared for each IP sample, to which 6. Mu.L of 5M NaCl and 2. Mu.L of protease K (20 mg/mL) were added, respectively;

3. 10% Input frozen before thawing, 150 μ L IP Elution Buffer,6 μL 5M NaCl and 2 μL protease K (20 mg/mL) were added to the solution, and the solution was left at room temperature;

4.65 After incubation at C, the beads were adsorbed on a magnetic rack, and the supernatant (containing eluted protein-chromatin complex) was removed and added to tubes packed with NaCl and protease K. Incubating 1.5. 1.5 h together with the Input sample mixed in the previous step at 65 ℃;

e.collection of DNA

1. 750 μ L DNA Binding Buffer was added to each IP sample and Input;

2. 500. Mu.L of each sample was placed in a DNA purification column and inserted into a collection tube of 2 mL. Centrifugation is carried out for 1 min at 10000 Xrcf, and the column penetrating liquid is abandoned. Repeating the operation on the rest samples;

3. putting the purification column back into a collecting pipe, adding 750 mu L DNA Column Wash Buffer and 10000 Xrcf for centrifugation for 1 min, and discarding the column penetrating liquid;

4. putting the purification column back into a collecting pipe, and centrifuging 10000 Xrcf for 2 min;

5. collecting a new EP tube, adding 50 mu L DNA Column Elution Solution to the center of DNA purification column, centrifuging at 10000 Xrcf for 1 min, collecting eluted DNA, and performing subsequent PCR detection

7. Double luciferase assay

LncRNA-AFAP1-AS1 wild (P3 region) and LncRNA-AFAP1-AS1 mutant (P3 region) were co-transfected with SP1 overexpressing plasmid and control (vector) into MDA-MB-231 cells, AS follows: wild+vector, wild+SP1, mutant+ vector, mutant +SP1

1) MDA-MB-231 cells were seeded into the well plates the day before transfection, and the cells reached 60-80% per well the next day of transfection.

2) lipofectamine 3000 was transfected into cells, respectively, and mixed well.

3) Incubator culture 48 h at 37 ℃.

4) Dual luciferase reporter detection

Lysing the cells: the reporter gene cell lysate is fully and evenly mixed, and 100 mu L of the reporter gene cell lysate per hole can be directly added after the cell culture fluid is absorbed; after sufficient lysis, the supernatant was centrifuged at 12000r for 5 min and used for assay.

The firefly luciferase assay reagent and Renilla luciferase assay buffer were dissolved and brought to room temperature. The Renilla luciferase assay substrate (100×) was placed on an ice bath or ice box for use.

An appropriate amount of Renilla luciferase assay buffer was taken in an amount of 100 μl per sample, and Renilla luciferase assay substrate (100×) was added at 1:100 to prepare a Renilla luciferase assay working solution.

The fluorescence measuring instrument was turned on, the measurement interval was set to 2s, and the measurement time was set to 10 s.

For each sample measurement, 50 μl of the sample was taken, 100 UL firefly luciferase assay reagents were added, and the samples were gun-homogenized or otherwise mixed in a suitable manner for measurement RLT (relative light Tnit). And taking the reporter gene cell lysate as a blank control.

After the above procedure for determining firefly luciferase was completed, 100. Mu.L of Renilla luciferase assay working solution was added, and after homogenization with a gun or other appropriate means, a microplate-type multifunctional photometer was used for determination RLT (relative light Tnit).

In the case of Renilla luciferase as a reference, the RLT value obtained by firefly luciferase assay is divided by the RLT value obtained by Renilla luciferase assay. And comparing the activation degree of the target reporter gene among different samples according to the obtained ratio.

8. CCK8 detection of cellular Activity

The cells of each group were taken 5X 10 ⁴ Each was seeded in 96-well plates. At 0 h, 24 h, 48 h, 72 h, 10 μl of CCK8 assay was added to each well, 4 h was incubated in a cell incubator, absorbance at 450 nm was measured for each well with a microplate reader, and a cell growth curve was drawn.

9. Clone formation assay to detect cell proliferation

(1) And respectively digesting, counting, diluting and inoculating 500 cells in each hole of the 12-hole plate, and placing the cells in a cell culture box for culturing for 2-3 weeks.

(2) The medium was discarded, washed twice with PBS, and fixed with 4% paraformaldehyde for 15 min.

(3) The paraformaldehyde was discarded and stained with 1ml Giemsa for 15 min.

(4) Washed twice with PBS, dried and photographed.

10. Scratch assay to detect cell migration

After each group of cells grow, the cells are streaked along the central axis of the well by a micro sample adding suction head, the streaked cells are washed away by PBS, then culture medium is added, the 12-pore plate is taken out for microscopic photographing at the time of 0 h, 24 h and 48 h respectively, the migration distance of the cells is observed, and the migration rate of the cells at different time points is calculated.

11. Transwell detection of cell invasion

(1) Seeding cells

1) And paving 100 mu L of Matrigel matrix glue at the bottom of the Transwell chamber. Placing into an incubator for 2-3 h, and completely solidifying.

2) 600 mu L of complete medium is added into the lower layer of the Transwell chamber.

3) After digestion of each group of cells, 1X 10 counts were counted ⁵ Cells were resuspended in 100. Mu.L serum-free medium and transferred to the matrigel surface.

4) Placing the cells in an incubator for conventional culture, taking out and detecting MDA-MB-231 cells 24 and h, and taking out and detecting MDA-MB-468 cells 48 and h.

(2) Cell staining

1) Discarding the old culture solution, and washing the upper and lower parts of the cell for 2 times by PBS;

2) The cotton swab wipes the cells on the cell, and 4% paraformaldehyde pre-cooled by ice is fixed for 30 min;

3) Giemsa dye liquor dyeing for 15 min;

4) Washing the lower part of the cell with PBS for 1 time, drying, and placing the cell surface on a glass slide downwards;

5) Photomicrographs, counts.

12. Nude mice xenograft tumor

1. Experimental animal

BALB/C strain nude mice were purchased from Si Bei Fu, 1-5 week old, female infertility, healthy maturation, average body weight of 18+ -2 g, 24 total, SPF grade. All feeds, water, air, bedding and various articles entering the barrier system are subjected to sterilization treatment such as high temperature and high pressure; all people and animals entering the laboratory are subjected to strict microbiological control.

2. Establishing a nude mouse tumor forming model:

after 1 week of adaptive feeding, nude mice were randomly divided into 4 groups of 6 mice each, and the specific groupings were as follows:

（1）pcDNA3.1；

（2）pcDNA3.1-SP1；

（3）pcDNA3.1+sh-AFAP1-AS1；

（4）pcDNA3.1-SP1+sh-AFAP1-AS1；

after each group of cells was digested with pancreatin, washed 2 times with PBS and diluted to 10 with serum-free medium ⁷ /ml. Under aseptic conditions, nude mice were inoculated under the armpits of the nude mice subcutaneously, each 0.1. 0.1 ml, and nude mice were kept for 30 days.

3. Measuring tumor size and plotting tumor growth curve

The nude mice were observed every 1 day for mental state, motility, reaction, diet, and appearance of subcutaneous inoculation area. The longest diameter A and the shortest diameter B of the tumor body are measured by a vernier caliper every week, and the formula V=1/2 AB is adopted ^２ Tumor volumes were calculated. And drawing each group of tumor growth curves by taking the tumor volume as a Y axis and the growth cycle number as an X axis.

4. Immunohistochemical staining of tumor tissue

(1) Killing nude mice, taking out tumors, weighing the tumors, and then placing the tumors in 4% paraformaldehyde fixing solution for fixing;

(2) Dehydrating, transparentizing, waxing, embedding and slicing the fixed tumor tissue;

(3) Removing paraffin from slice with xylene, adding into alcohol with high concentration to low concentration, and finally adding into distilled water;

(4) Washing 3 times with PBS for 5 minutes each;

(5) With 3% H ₂ O ₂ Blocking and inactivating endogenous peroxidase, and standing at room temperature for 10 min; washing 3 times with PBS for 5 minutes each;

(6) Antigen retrieval; boiling in 0.01M citric acid buffer (pH 6.0) (95 deg.C, 20 min), naturally cooling for more than 20 min, washing with cold water, cooling to room temperature, and washing with PBS for 3 times each for 5 min;

(7) And dripping 20% normal goat serum blocking solution, and standing for 20 min at room temperature. Removing redundant liquid;

(8) Dripping 50 mu L of the corresponding primary antibody at 4 ℃ overnight;

(9) After overnight at 4 ℃, the temperature is required to be reset at 37 ℃ for 45 min;

(10) Washing with PBS 3 times for 5 min each;

(11) Dripping an EnVision reagent, and standing at room temperature for 30 min;

(12) Washing with PBS 3 times for 5 min each;

(13) DAB color development is carried out for 10 min, and the dyeing degree is mastered under a microscope;

(14) Washing with PBS for 10 min;

(15) Counterstaining with hematoxylin for 2 min, and differentiating with hydrochloric acid and alcohol;

(16) Washing with tap water for 15 min;

(17) Dehydrating, transparency, sealing and microscopic examination. (Nuclear purple blue, positive brown yellow)

13. GeneChip cube PrimeView gene chip ™ human gene expression array

GeneChip PrimeView Gene chip ™ human Gene expression array kit (Affymetrix, thermoFisher) the sequence used in the array design was selected from RefSeq V36, uniGene 219 and full-length human mRNA ™ in GenBank using a probe set to effect expression profiling. After knocking down lncRNA AFAP1-AS1, total RNA was extracted from MDA-MB-231 and MDA-MB-468 cells, and then RNA quality control was performed. After addition of the PolyA control, cDNA was synthesized from total RNA, followed by biotin labeling, purification and quantification of cRNA. Adding the fragmented and marked sample into a chip, putting the chip into a GeneChip Hybridization Oven 645 hybridization furnace (thermo Fisher), and carrying out chip hybridization at a specific temperature and a specific rotating speed; after reaching the specified time, the sample was washed and stained with the corresponding Protocol using a gene chip elution workstation GeneChip Fluidics Station (thermo fisher), and after completion, scanned using a GeneChip 3000 g scanner. The scanner generates the CEL file by capturing the fluorescent signal and converting the signal by GCOS software to obtain a signal value for each probe.

14. In situ hybridization experiment of fluorescent probe of cell slide

(1) Cell climbing sheet fixation: the cell slide was fixed in 4% paraformaldehyde for 20 min, washed 3 times with PBS (pH 7.4) and 5 min each time with shaking on a decolorizing shaker.

(2) Digestion: proteinase K (20. Mu.g/ml) was added dropwise and digested for 8 min. After washing with pure water, PBS was washed 3 times X5 min.

(3) Prehybridization: the prehybridization solution was added dropwise to the reaction mixture, followed by a 37℃incubator 1 h.

(4) Hybridization: the prehybridization solution was poured off, and the hybridization solution containing the probe was added dropwise and hybridized overnight at 37 ℃.

(5) Washing after hybridization: washing the hybridization solution with 2 XSSC, 37℃for 10 min,1 XSSC, 37℃for 2X 5 min, and 0.5 XSSC for 10 min.

(6) DAPI counterstain nuclei: DAPI dye solution is dripped into the slices, incubated for 8 min in a dark place, and anti-fluorescence quenching sealing tablets are dripped into the slices after washing.

(7) And (5) microscopic examination and photographing: sections were observed under a fluorescence microscope and images were acquired.

Experimental results:

1. the present invention explores the potential transcription factor at the lncRNA AFAP1-AS1 promoter (hg38_knownGene_ENST 00000608442.2, range = chr4: 7752077-7754076) using the online prediction tool JASPAR (http:// jasspar. Geneg. Net /). The results show that SP1 has a potential binding site in the promoter region of lncRNA AFAP1-AS1. And lncRNA AFAP1-AS1 was up-regulated in TNBC tissue compared to normal tissue. Thus, it is speculated that SP1 may interact directly with the promoter region of lncRNA AFAP1-AS1 AS an upstream transcription factor, thereby regulating expression of lncRNA AF AP1-AS1, promoting or inhibiting tumor progression.

2. To determine whether SP1 modulates expression of lncRNA AFAP1-AS1, siRNA (si-SP 1) was first used to silence SP1 in MDA-MB-231 and MDA-MB-468 cells, and the silencing efficiency of si-SP1 was confirmed by RT-qPCR and Western blot analysis. The results showed that si-SP1 showed excellent silencing efficiency in MDA-MB-231 and MDA-MB-468 cells, confirming that si-SP1 was able to regulate SP1 expression at the mRNA and protein levels (FIGS. 1A, 1B). Then, we assessed mRNA expression of lncRNA AFAP1-AS1, and RT-qPCR results showed that after SP1 silencing, lncRNA AFAP1-AS1 expression was significantly reduced in MDA-MB-231 and MDA-MB-468 cells (FIG. 1C).

The ChIP analysis showed that the lncRNA AFAP1-AS1 promoter was enriched in the complex with anti-SP 1, indicating that SP1 binds to the lncRNA AFAP1-AS promoter and that the P3 region is the most enriched promoter (fig. 2A-2C).

3. Overexpression of SP1 was performed by the ov-SP1 vector and assessed by Western blotting. The results demonstrated that SP1 protein was up-regulated in both MDA-MB-231 and MDA-MB-468 cells after transfection of the SP1 over-expression vector (ov-SP 1) (FIG. 2D). SP1 overexpression increased the luciferase activity of the lncRNA AFAP1-AS1-WT promoter sequence in the P3 region (1037-1046), whereas the luciferase activity of the P3 mutant sequence was unaffected (FIG. 2E). The above data indicate that SP1 binds to the P3 promoter region to promote expression of lncRNA AFAP1-AS1.

4. To probe the effect of SP1 on lncRNA AFAP1-AS1 mediated cell behavior, overexpression of SP1 (ov-SP 1) and silencing of lncRNA AF AP1-AS1 (sh-AFAP 1-AS 1) were used. First, transfection efficiency was confirmed by RT-qPCR, and the results showed that expression of lncRNA AFAP1-AS1 was significantly increased after ov-SP1, and that overexpression rescued lncRNA AFAP1-AS1 expression inhibition caused by lncRNA AFAP1-AS1 silencing in MDA-MB-231 and MDA-MB-468 cells (FIG. 3A). In addition, CCK-8 and colony formation assays showed that SP1 overexpression resulted in activated cell viability and rescued lncRNA AFAP1-AS 1-mediated proliferation inhibition by sh-AFAP1-AS1 (FIGS. 3B-3C). In addition, SP1 promoted lncRNA AFAP1-AS1 mediated inhibition of TNBC cell migration by Transwell (fig. 3D) and wound healing assay (fig. 3E).

5. We performed xenograft tumors in nude mice to assess the effect of SP1 on tumorigenesis of MDA-MB-231 cells in vivo. The results show that: SP1 overexpression promoted tumor growth, while sh-AFAP1-AS1 inhibited tumor growth, which could be reversed by SP1 overexpression (FIGS. 4A-4B). Immunohistochemical staining was then used to assess protein expression of Ki 67. Ki67 positive cells were significantly increased in the ov-SP1 group compared to the vector group, while Ki 67-positive cells were decreased in the sh-AFAP1-AS1 group. Meanwhile, the number of Ki67 positive cells was also increased in the ovSP1+sh-AFAP 1-AS1 group compared to the vector+sh-AFAP 1-AS1 group (FIG. 4C). These findings indicate that overexpression of SP1 can reverse sh-AFA1-AS1 inhibited tumor growth at a slower rate in vivo.

6. We have attempted to describe its detailed molecular mechanism at the transcriptome level. We knocked down lncRNA AFAP1-AS1 (sh-AFAP 1-AS 1) in MDA-MB-231 and MDA-MB-468 cells, followed by GeneChip PrimeView ™ human gene expression array detection of the cell lines. In the experiments, genes whose fold change was > 2 and p-value was.ltoreq.0.05 were considered significantly changed. Experimental results 292 up-regulated and 411 down-regulated mRNA were found in MDA-MB-231 cells, and 474 up-regulated and 273 down-regulated mRNAs were found in MDA-MB-468 cells after knocking down lncRNA AFAP1-AS1 (fig. 5A, 5B). Subsequently, the down-regulated gene was further analyzed. Down-regulating genes 17 crossover genes were included between MDA-MB-231 and MDA-MB-468 cells (FIG. 5C), these 17 genes involved in 44 KEGG pathways, and after analysis of these KEGG pathways, we found that 9 genes appeared more than twice. For example, eukaryotic translation initiation factor 4B (EIF 4B) and serum/glucocorticoid regulated kinase 1 (SGK 1) are both involved in the mTOR signaling pathway (KEGG hsa 04150).

In another aspect, KEGG pathway analysis showed that five KEGG pathway enrichments were found in MDA-MB-231 and MDA-MB-468 cell lines (fig. 5D). After binding to down-regulated gene-related pathways, we found that the mTOR signaling pathway (KEGG hsa 04150) and aldosterone-mediated sodium reabsorption (KEGG-hsa 04960) appear in both assay results.

Gene Ontology (GO) analysis also showed that these commonly predicted genes are associated with cancer (fig. 5E).

FISH analysis showed that most of the lncRNA AFAP1-AS1 was located in the cytoplasm (fig. 6A). Once located in the cytoplasm, lncRNA transduces gene expression primarily at post-transcriptional levels, such as regulating mRNA translation and degradation, or is involved in the regulation of intracellular signaling pathways through protein binding, uptake of mirnas, or base pairing with target RNAs. It was appreciated that the mTOR signaling pathway (KEGG hsa 04150) and aldosterone-mediated sodium reabsorption (KEGG hsa 04960) were significantly altered following AFAP1-AS1 knockdown, and literature searches were performed to find that the mTOR signaling pathway is more closely related to TNBC tumorigenesis.

Then, based on the gene expression results of GeneChip, we assessed some gene expression in the mTOR pathway. Mammalian stress activated mapped kinase interacting protein 1 (mSin 1, also known AS MAPKAP 1), EIF4B, SGK1 and SEH1L are shown to be up-regulated, while S-phase kinase associated protein 2 (SKP 2) is down-regulated by AFAP1-AS1. The E3 ubiquitin protein ligase NEDD 4-like (NEDD 4L) was demonstrated to phosphorylate SGK1 and was demonstrated to be upregulated by AFAP1-AS1 (FIGS. 6B, 6C). It was concluded that AFAP1-AS1 can activate the mTOR pathway, resulting in a change in expression of several related genes, thus promoting tumorigenesis.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims

1. Use of a transcription factor regulating AFAP1-AS1 expression in the preparation of a product for diagnosing or treating breast cancer, characterized in that the transcription factor is SP1.

2. The use according to claim 1, wherein the breast cancer is a triple negative breast cancer.

3. The use according to claim 2, wherein the transcription factor SP1 regulates AFAP1-AS1 expression in the following specific manner: the transcription factor SP1 activates AFAP1-AS by binding to the P3 region of the promoter region of AFAP1-AS1, thereby increasing the expression of lncRNA AFAP1-AS1.

4. The use according to claim 3, wherein the transcription factor SP1 further activates the mTOR pathway by increasing the expression of AFAP 1-AS.

5. The use according to claim 1, wherein the product is a chip, a reagent or a kit.

6. A siRNA for diagnosing or treating breast cancer is characterized in that the siRNA is si-SP1, the sequences of which are shown as SEQ ID NO.1 and SEQ ID NO.2,

SEQ ID NO.1：GUGCAAACCAACAGAUUAUTT

SEQ ID NO.2：AUAAUCUGUUGGUUUGCACTT。

7. an agent for diagnosing or treating breast cancer, characterized in that the agent is transfected si-SP1

Then, the AFAP1-AS1 and SP1 expression levels were measured.

8. A kit for diagnosing or treating breast cancer, comprising si-SP1, AFAP1-AS1 and RT-PCR primers for SP1, other reagents required for RT-PCR and reagents required for WB.

9. The kit according to claim 8, wherein the forward primer and the reverse primer of the RT-PCR for detecting the expression level of AFAP1-AS1 are respectively shown AS SEQ ID NO.3 and SEQ ID NO.4,

SEQ ID NO.3:AATGGTGGTAGGAGGGAGGA

SEQ ID NO.4:CACACAGGGGAATGAAGAGG。

10. the kit according to claim 8, wherein the forward primer and the reverse primer of RT-PCR for detecting the expression level of SP1 are respectively shown in SEQ ID NO.5 and SEQ ID NO.6,

SEQ ID NO.5:TTGCTGCTATGCCAAACCTA

SEQ ID NO.6：CCTGAGAGCTGGGAGTCAAG。