CN116656584A - Streptomyces strain and application thereof - Google Patents

Streptomyces strain and application thereof Download PDF

Info

Publication number
CN116656584A
CN116656584A CN202310235060.0A CN202310235060A CN116656584A CN 116656584 A CN116656584 A CN 116656584A CN 202310235060 A CN202310235060 A CN 202310235060A CN 116656584 A CN116656584 A CN 116656584A
Authority
CN
China
Prior art keywords
strain
streptomyces
fermentation
salinomycin
geosmin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310235060.0A
Other languages
Chinese (zh)
Inventor
郭强
邹洋
刘震
曹海峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Lukang Shelile Pharmaceutical Co ltd
Original Assignee
Shandong Lukang Shelile Pharmaceutical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Lukang Shelile Pharmaceutical Co ltd filed Critical Shandong Lukang Shelile Pharmaceutical Co ltd
Priority to CN202310235060.0A priority Critical patent/CN116656584A/en
Publication of CN116656584A publication Critical patent/CN116656584A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/99—Other Carbon-Carbon Lyases (1.4.99)
    • C12Y401/99016—Geosmin synthase (4.1.99.16)

Abstract

The application discloses a streptomycete strain which is a streptomycete strain with a Geomin terpene synthase gene knocked out. According to the application, the Geomin terpene synthase gene is knocked out, so that the bad smell of fermentation is treated from the beginning, the streptomycete strain with mild tail gas smell and improved fermentation product yield in the fermentation process is obtained, and the streptomycete strain is applied to industrial fermentation production of antibiotics, so that the production cost is remarkably reduced.

Description

Streptomyces strain and application thereof
Technical Field
The application belongs to the field of biological fermentation, and particularly relates to a streptomycete strain and application thereof.
Background
The fermentation production of antibiotics by Streptomyces industrial strains is one of the most important methods for the production of antibiotics, and how to increase the yield and reduce the production cost is always the aim pursued in the field. The fermentation process of streptomyces generates a large amount of tail gas with foul smell, and the components are complex, and the biochemical method or the tail gas treatment device is used for treating the tail gas with high energy consumption, so that enterprises need to consume a large amount of cost to treat the fermentation tail gas, and on the basis of the process, a method capable of reducing the fermentation smell and improving the fermentation yield is needed to be searched for so as to reduce the production cost.
Disclosure of Invention
The inventor of the application surprisingly found that knockout of the Geomin terpene synthase gene can greatly reduce bad smell in fermentation tail gas of Streptomyces albus, thereby greatly reducing cost required for tail gas treatment, and more unexpectedly, after knockout of the Geomin terpene synthase gene, the salinomycin yield of the strain is obviously improved, and the application is completed based on the fact.
The first aspect of the application provides a Streptomyces albus strain which is a Geomin terpene synthase gene knockout Streptomyces albus strain.
In a second aspect, the application provides the use of a Streptomyces strain according to the first aspect of the application for industrial fermentation.
In a third aspect, the application provides a method for the industrial production of salinomycin, which comprises the step of fermenting the streptomyces strain provided by the first aspect of the application to produce the salinomycin.
In a fourth aspect, the application provides a method for increasing the yield of salinomycin and/or reducing the odor of tail gas of industrial salinomycin, which comprises fermenting the same with the Streptomyces strain according to the first aspect of the application.
The application has the beneficial effects that:
according to the application, the Geomin terpene synthase gene is knocked out, so that the bad smell of fermentation is treated from the beginning, the streptomycete strain with mild smell of tail gas in the fermentation process and improved yield of fermentation products is obtained, and the streptomycete strain is applied to industrial fermentation production of antibiotics, so that the yield of the antibiotics is improved, the malodorous smell of fermentation tail gas generated in the production process of the antibiotics is reduced, the investment of tail gas treatment is reduced, and the production cost is reduced.
And (3) strain preservation:
name: streptomyces albus LZ001 or Streptomyces albus LZ001
Preservation unit: china Center for Type Culture Collection (CCTCC)
Address: chinese university of Wuhan
Preservation number: CCTCC NO: M2023070
Preservation date: 2023-01-11.
Name: streptomyces albus J1-024 or Streptomyees albus J1-024
Preservation unit: china Center for Type Culture Collection (CCTCC)
Address: chinese university of Wuhan
Preservation number: CCTCC NO: M2023069
Preservation date: 2023-01-11.
Drawings
FIG. 1 is a schematic diagram of the construction flow of vector pZY-1 of example 1;
FIG. 2 is a PCR-validated electrophoresis of the knockout Geosmin double-exchanged strain of example 1; WT is the original strain J1-024, P is pLZ-1 plasmid positive control;
FIG. 3 is a GC-MS detection result of Geomin content in strains LZ-6 and J1-024, wherein A is a gas chromatogram of strains J1-024, B is a gas chromatogram of strains LZ-6, C is a mass spectrum of chromatographic peaks of 12.524min, and D is a standard mass spectrum of skatole.
FIG. 4 shows the salinomycin titer results in the fermentation products of the Geomin knockout strains LZ-2 to 6 of example 1.
Detailed Description
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described, and it is apparent that the drawings in the description below are only one embodiment of the present application, and other embodiments may be obtained according to these drawings by those skilled in the art.
Definition of the definition
As used herein, the terms "a" and "an" and "the" and similar referents refer to the singular and the plural, unless the context clearly dictates otherwise.
As used herein, the terms "about," "substantially" and "similar to" refer to an acceptable error range for a particular value as determined by one of ordinary skill in the art, which error range may depend in part on the manner in which the value is measured or determined, or on the limitations of the measurement system.
In a first aspect the present application provides a Streptomyces albus strain which is a Geomin terpene synthase gene knockout Streptomyces albus (Streptomyces albus), hereinafter also referred to as engineered strain. The inventors found that the expression product of the Geosmin terpene synthase gene (also referred to herein simply as the Geosmin gene) is a key enzyme for producing Geosmin (Geosmin), which is a major source of earthy smell (or soil odor) in soil or water, whereas the composition of malodorous tail gas from industrial fermentation of streptomyces albus is complex, and the proportion of Geosmin therein or the extent of influence on the tail gas odor is not quite clear. The inventor unexpectedly found in the study that the knockout of the Geomin terpene synthase gene in the Streptomyces albus can greatly improve the malodorous smell in the fermentation tail gas of the Streptomyces albus, and more unexpectedly, the yield of fermentation secondary metabolites of the Streptomyces albus, such as antibiotic salinomycin, can be obviously improved after the Geomin terpene synthase gene is knocked out. Thereby reducing the production cost of producing antibiotics by fermentation of the streptomyces albus.
The gene knockout in the application belongs to the technology of editing gene (group), and means that the expression of the whole gene is eliminated by means of mutation, disruption of the gene reading frame and the like at the genome level. In general, such gene editing changes can be stably inherited to the next generation.
In some embodiments, the Geosmin terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% identity to the sequence set forth in SEQ ID No. 11; preferably, the Geosmin terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 11.
Geomin terpene synthase gene: ATGACGCAGCCGTTCGTTCTGCCGGACTTCTACATGCCGTATC CCGCCCAGCTCAATCCGCACCTGGAGGAGGCCCGGGCGCACAGCGCCGACTGGGCGCGGGAGATGGGGATGCTGGAGGGCTCCGGCGTCTGGGACACCGCCGACCTCGAAGCCCACGACTACGCGCTCCTGTGCGCGTACACCCACCCCGACTGCGACGGGCCCGCACTCTCCCTGGTCACCGACTGGTACGTGTGGGTCTTCTTCTTCGACGACCACTTCCTGGAGCTCTTCAAGCGCAGCCAGGACCGCGCGGCCGGCAAGGCGCACCTCGAACGCCTGGCCCTCTTCATGCCGATGGACCTCGCCACGCCGATGCCCGAGCCGCAGAACCCGGTCGAGGCCGGGCTCGCCGATCTGTGGACCCGCACCGTGCCCGCGATGTCCGCGGCCTGGCGGGACCGCTTCGCCGAGTCGACCAGGAACCTGCTCAACGAGTCCGACTGGGAGCTCTCCAACATCAACGAGGGCCGGATCGCCAACCCGGTCGAGTACATCGAGATGCGCCGCAAGGTGGGCGGCGCGCCCTGGTCCGCCGGTCTCGTCGAGTACGCCACCGCCGAGATCCCCGCCCGGATCGCCCGCTCCCGCCCGCTGCGGGTGCTCTGCGACGCCTTCTCCGACGGCGTCCATCTGCGCAACGACCTCTTCTCCTACCAGCGCGAGGTCCAGGACGAGGGCGAACTCAGCAACGGCGTCCTGGTCCTGGAGACCTTCCTCGGCTGTACGACGCAGGAGGCCGCCGACGCCGTCAACGACCTGATCACCTCCCGGCTCCAGCAGTTCGAGGCCACCGCGCTGACCGAACTGCCCGCGCAGTGCGCCGAGAGCGCGCTCGACCCGGGGGAGTACGCGGCGGTCGCGGCCTATGTGAAGGGCCTGCAGGACTGGCAGTCGGGCGGCCACGAATGGCATCTGCGCTCCAGCCGCTACATGAACGAGGGCGCGGTGCGGGAGAGTTCACCGCTGGCCGGGCCGACCGGCCTCGGCACCTCGGCCGCCGCGGTGCGCTCGCTGCTCTCCCCGGCGAGCGCCCGGCGGCTGCGCAACTACGCGCACGTGCCCCACCAGCGCGTCGGCCCCTCCCGGATCCCCGACTTCGAGACCGGCTACGAACTGCGGCTGAGCCCCCTGCTGCCCACCGCCCGGGACCACCTGACCGACTGGGCGCGCACCACCGGCATCACCCGCGAGGGCCTGTGGGACCAGGCCGCCCTCGACCGCTACGACCTGGCGCTGTGCGCCGCCGGGATCTACCCGGACGCCGACCAGAAGGACCTCGACATCGGCTCCGCCTGGCTGGCCTGGGGCACCTACGGCGACGACTGGTACCCGGCGCTGTACGCCCGTACCGGCGACTTCGCGGGCGCCCGGCTCGCCACCGAGCGCCTGAAGGCCCTGATGGTCGTGGACGAACCGGACGCCGCGCTCGCCGCCCCGCACGCCAACGCCCTGGAACGCGCCCTCGCCGACCTCTGGTCGCGCACCGCGGGGCCCATGCCGCCCGAGGGCCGCGCCCTGTTCCGCGACGGCGTGGTGGCCATGCTCGACGGCTGGCTGTGGGAGGTGTCCAACGAGATCCAGCACCGCATCCCGGACCCGGTCGACTACATCGAGATGCGCAGGGACACCTTCGGCTCCGACATGACGACGAGCCTCTCGCGCATCTCGCACGGCAAGCGCGTACCCGACGAGATCTACGCCACCGGCCCCATGCGCTCGCTCGTGAACTCGGCGATGGACTACGCCTGCCTGCTCAACGACCTGTTCTCGTACCAGAAGGAGATCGAGTACGACGGCGAGGTGCACAACGGCGTCCTCGTGGTGCAGAACTTCTTCGACTGCGACTACGCCACCGGTGTGGCCCTCGTCCACGATCTGATGCAGGGCAGGCTGCGCCAGTTCCAGCATGTGGTGGAGCACGAACTGCCCGTGCTCTACGAGGACTTCGGCCTCGACGAGGAGGCGCGCGAGGTCCTCGCCGGGTATGTCACGGAGCTGGAGAACTGGCTGACCGCCATCCTCCACTGGCACCGCGAGTGCAGGCGCTACCGGGAGGAGTACCTCTCGCACGGCATCGGCGCCGGCACCCCCGCGCCCCGCCGCGCGGACTCCCTGCTGCCCGGACCCGCCCTGCCCTTCGCCTGGCGGGCCGCGCCCCCGGCGGGGTGA (SEQ ID NO. 11)
In some embodiments, the engineered strain has a reduced content of Geosmin of at least 90%, preferably at least 95%, preferably at least 98% compared to the starting strain.
In some embodiments, the content of Geosmin in the engineered strain is less than 1ppm, preferably less than 0.5ppm, preferably less than 0.2ppm.
In some embodiments, the "content of Geosmin" or the "content of Geosmin in a strain" may be understood as the content of Geosmin in the thallus or in the fermentation product thereof during at least one fermentation cycle of the streptomyces albus. The term "fermentation cycle" as used herein has its ordinary meaning, meaning the time elapsed from the start of fermentation to the end of fermentation, or it can be understood as the fermentation process to be carried out when salinomycin is produced by fermentation using the Streptomyces albus in a laboratory or in an industrial production.
In some embodiments, the engineered strain has an increase in salinomycin yield of at least 25%, preferably at least 30%, more preferably at least 35% as compared to the starting strain.
The inventors have also found that knockout of the Geosmin terpene synthase gene in a strain that produces salinomycin can further increase the yield of salinomycin in the strain. In some embodiments, the starting strain of the engineered strain is Streptomyces albus (Streptomyces albus) J1-024, with a accession number of CCTCC M2023069. The inventor discovers that the industrial production strain with higher salinomycin yield can be further obtained by knocking out the Geomin terpene synthase gene on the basis of Streptomyces albus J1-024.
In some embodiments, the engineered strain is streptomyces albus (Streptomyces albus) LZ001 with a accession number of cctccc M2023070.
In a second aspect, the application provides the use of a Streptomyces strain according to the first aspect of the application for industrial fermentation. The Streptomyces strain is used for industrial fermentation, the malodorous smell of fermentation products is obviously reduced, and the tail gas treatment is relatively easy; the yield of the antibiotic salinomycin is further improved, thereby reducing the cost of industrial production.
In some embodiments, the industrial fermentation comprises industrial production of salinomycin.
In a third aspect, the present application provides a method for industrially producing a salinomycin, which comprises producing a salinomycin by fermentation using the Streptomyces strain provided in the first aspect of the present application.
In a fourth aspect, the application provides a method for increasing the yield of salinomycin and/or reducing the off-gas malodour of industrially produced salinomycin, which comprises fermentatively producing salinomycin using a Streptomyces strain according to the first aspect of the application.
The Streptomyces strains of the present application and their use are described below by way of specific examples.
EXAMPLE 1 construction of Streptomyces albus with Geomin terpene synthase Gene knockout
(1) Construction of knockout vector pLZ-1
The enzyme digestion principle is utilized to cut the carrier of the left and right homology arms and pJTU1278 enzyme and insert the two ends of the apramycin resistance gene fragment to bring two matched enzyme digestion sites by the primer. Obtaining genome of streptomyces albus J1-024 (CCTCC M2023069) by phenol-chloroform extraction, taking the genome of streptomyces albus J1-024 as a template, amplifying a left homology arm by an upstream primer LHA-GF,5'-CCGCTC TAGAGACGAGGTACGGGACTTCCTCAT-3' (SEQ ID NO. 1) and a downstream primer LHA-GR,5'-TAAT TGCGCATATGGCGAGACATGGAACAGACTGCTT-3' (SEQ ID NO. 2), and introducing an XbaI enzyme cutting site matched with the right end of a carrier framework and an NdeI enzyme cutting site matched with the left end of the inserted apramycin; the right homology arm was amplified by the upstream primer RHA-GF,5'-CGCTCAATCATATGATGTAGAAGTCCGGCAGAACGAA-3' (SEQ ID NO. 3) and the downstream primer RHA-GR,5'-GATAAGCTTGTAGAGGAGGACCAGGTAGTAGC-3' (SEQ ID NO. 4) and introduced with a HindIII cleavage site matching the left end of the vector backbone and an NdeI cleavage site matching the right end of the insert apramycin. The inserted apramycin resistance gene is amplified by an upstream primer Apr-GF,5'-TGTCTCGCCATATGCGCAATTAACCCTCACTAAAGGA-3' (SEQ ID NO. 5) and a downstream primer Apr-GR,5'-GGACTTCTACATCATATGATTGAGCGTCAGCATATCATCA G-3' (SEQ ID NO. 6) by taking pIB139 (Beijing Hua Vietnam biological company) as a template, and NdeI restriction sites matched with left and right homology arms are introduced at both ends; the double enzyme cutting sites XbaI/HindIII are selected to carry out linearization treatment on the pJTU1278 vector, and the Geomin knockout vector pLZ-1 is obtained by a 4-fragment enzyme cutting enzyme linkage mode. The sequencing result of generation 1 shows that the vector is constructed successfully. A schematic diagram of the construction flow of the vector pLZ-1 is shown in FIG. 1.
(2) Obtaining a Geomin knockout J1-024 engineered strain
2.1 transformation of E.coli and Streptomyces albus
80-100 ul of J1-024 seed preservation solution is inoculated on an SFM culture medium (2.4% soybean cake powder, 2.4% mannitol, 1.6% Qingdao brand agar and tap water), and the inoculated culture medium is placed in a constant temperature incubator at 30 ℃ for 6-12 days, and the J1-024 after the culture has a thick white spore layer. The constructed pLZ-1 plasmid was electrotransformed into E.coli DH10B, and verified to give DH10B containing pLZ-1. Triple parental ligation transfer of J1-024 with DH10B containing pLZ-1: e.coli DH10B and ET12567/pUB307 were cultured overnight to OD 0.6-0.8, respectively, for further use. Collecting a J1-024 spore, collecting in 4-6 ml TES buffer solution (0.05M, pH=8.0), and heat-shocking at 50deg.C for 10min; adding equal volume of pregermination culture medium (1% OXIO yeast extract; 1% SIGMA casein hydrolysate) and CaCl with final concentration of 5mM 2 Mixing the above liquids uniformly, and then placing the mixture in a shaking table at 37 ℃ for incubation for 2.5-3 h. The cultured E.coli DH10B and ET12567/pUB307 were centrifuged at 3500rpm for 5min, the cells were resuspended in sterile water or LB medium, the procedure was repeated for washing the E.coli twice, and finally the cells were resuspended in 1-1.5 ml of sterile water or LB medium. 0.5ml of bacterial liquid was added respectively in a volume ratio of J1-024:ET12567/pUB307:DH10 B=1:1:1, a final volume of 1.5ml, and the mixture was mixed and spread on ISP4 medium (soluble starch 10g/L, ammonium sulfate 2g/L, calcium carbonate 2g/L, K) 2 HPO 4 1g/L, ferrous sulfate heptahydrate 0.001g/L, zinc sulfate heptahydrate 0.001g/L, tetrahydrateManganous chloride 0.001g/L, agar 4g/200ml, pH=7.0-7.4, and sterilizing at 121 ℃ for 30min. ) And (3) upper part. Culturing for about 12h, dissolving trimethoprim and apramycin in 1ml sterile water according to the final concentration of 50ug/ml and 25ug/ml respectively, covering the joint transfer plate with 1ml sterile water with antibiotics, air-drying for about 1h after covering, and culturing in a constant temperature incubator at 30 ℃ for 7 days.
2.2 screening of Mono-crossover strains
White wrinkled binder colonies are picked up, amplified culture is carried out on SFM culture medium, and after 6-12 days of culture, 2cm multiplied by 2cm colony spores are picked up for nucleic acid extraction. The spores are moved into 50ul of 50% dimethyl sulfoxide solution, the spores are placed in boiling water for 5min, ice bath for 5min, boiling water for 3min, ice bath for 3min, boiling water for 3min and ice bath for 3min, wall breaking treatment is carried out, the treated thalli are centrifuged at 8000rpm for 5min, and the supernatant is taken as a template. By means of the upstream primer Veri-GF,5'-CATCGGTCAGCTTCTCAACCTT-3' (SEQ ID NO. 7); the downstream primer Veri-GR,5'-TACCAACTTGCCATCCTGAAGA-3' (SEQ ID NO. 8) identified the binding agent by PCR, and the correct single crossover strain showed only a 508bp band on agarose electrophoresis.
2.3 construction of Geomin knockout Strain
The correct single-exchange strain is separated into single colonies on SFM medium containing 25ug/ml of apramycin according to a three-area streaking method, after 6-12 days of culture, the single colonies are selected, and the single colonies are respectively coated on SFM medium containing 50ug/ml of thiostrepton, 25ug/ml of apramycin and SFM medium containing 25ug/ml of apramycin. The coated culture plates were observed after 7 days of incubation. Strains that grew only on SFM medium containing 25ug/ml apramycin appeared in the first round of double screen as candidate strains; and carrying out PCR verification according to a boiling fungus extraction nucleic acid method flow in single-exchange strain verification, and verifying the candidate double-exchange strain through an upstream primer S-Veri-GF,5'-AAGCAGTCTGTTCCATGTCTCGC-3' (SEQ ID NO. 9) and a downstream primer S-Veri-GR,5'-CGTTCGTTCTGCCGGACTTCTAC-3' (SEQ ID NO. 10), wherein only a verification group of 1201bp appears in agarose electrophoresis as a correct knockout Geomin double-exchange modified strain. As a result, only 5 double-exchanged modified strains, designated LZ-2 to 6, were finally obtained as shown in FIG. 2.
(3) Domesticated rejuvenation of engineered strains
The process of genetic modification affects the metabolic and growth state of industrial strains, the modified strains LZ-2-6 are respectively passaged and separated from single colonies by using SFM culture medium inclined planes at 30 ℃, the mature culture inclined planes are inoculated into shake flask fermentation culture, the strains are cultured for 16-18 hours by using seed culture medium (4% glucose, 3% soybean cake powder, 1% yeast extract, 0.2% calcium carbonate) in a 33 ℃ constant temperature environment, the strains are transferred to fermentation culture medium (0.5% cottonseed cake powder, 0.8% wheat germ powder, 0.1% sodium chloride, 0.2% potassium chloride, 0.16% urea, 0.2% tartaric acid, 0.01% magnesium sulfate, 0.01% dipotassium hydrogen phosphate, 15% soybean oil, 0.5% calcium carbonate) according to 10% inoculation amount, the pH value is adjusted to be 6.6-6.9, and the strains are cultured for 9 days in a 33 constant temperature environment (for specific steps, refer to CheangLu et al, enhanced salinomycin production by adjusting the supply of polyketide extender units in Streptomyces albus, metabolic Engineering, year, 35 rolls).
(4) Modified strain smell and yield test
As the streptomyces albus cannot effectively detect the Geosmin by using the traditional liquid sample injection GC-MS detection method, the detection is changed to a headspace sample injection GC-MS sample injection mode. Detection and analysis of odor molecules in fermentation broth by GC-MS, and detection of molecular weight extraction of m/z=95 and m/z=112 revealed that compared with original strain J1-024, there was no chromatographic peak of Geosmin in the modified strain (GC-MS spectra of strain LZ-6 and J1-024 are shown in fig. 3), indicating that the modified strain had no longer produced Geosmin. Based on the limit of detection of Geomin by GC-MS, it is understood that the strain or its fermentation product contains Geomin in an amount of less than 0.2ppm.
Subsequently, in 17 volunteers by random recruitment, the fermentation broths of the modified strain and the unmodified strain (JI-024) were contained in 2 glass triangular flasks labeled A and B, respectively, the samplers did not inform the volunteers of sample information in advance and the samplers did not participate in the odor identification experiment, and finally 16 people were considered to be the less-sharp person in the A flask, and the 1 person could not distinguish the two flasks for light and heavy odor. Double blind odor assessment experiments showed that 94% of volunteers could clearly distinguish the engineered strain from the original strain by this feature of broth odor reduction.
And then the strain titer is measured, the specific process is that a proper amount of salinomycin standard substance is weighed, a standard substance solution with the final concentration of 30000mg/L is prepared by methanol, then the standard substance solution is diluted in sequence to the final concentrations of 25000mg/L, 20000mg/L, 15000mg/L, 10000mg/L and 5000mg/L, the standard substance with each concentration is quantitatively detected by HPLC, the linear relation between the peak area and the concentration is established at 520nm, and a standard curve is drawn. Ultrasonic treating the modified strain fermentation broth with an equal volume of methanol for 30 minutes, centrifuging to obtain a supernatant as a test solution, and substituting the peak area into a standard curve to calculate the salinomycin titer. The results of the titer of the modified strain LZ-2-6 and the titer of the original strain J1-024 are shown in figure 4, wherein the titer of the original strain J1-024 is about 18000mg/L, the titer of the modified strain salinomycin can reach over 22500mg/L, compared with the original strain J1-024, the yield is improved by at least 25%, and the titer of the strain LZ-3 and the strain LZ-6 can reach 25000mg/L, compared with the original strain, the yield is improved by at least 35%. Wherein LZ-6 is preserved in China center for type culture Collection, and is named as LZ001, with the preservation number: cctcc No. M2023070.
The application firstly establishes a complete genetic operation flow aiming at Streptomyces albus J1-024 to be remodeled, selects genetically unstable plasmid pJTU1278 as a carrier, and realizes the knockout of the Geosmin gene in J1-024. The GC-MS detection shows that the chromatographic peak of the Geomin does not exist in the modified strain, and the tail gas smell of the fermentation product is obviously improved.
Then through detection of fermentation products, it is unexpectedly found that the salinomycin production level in the J1-024 modified strain is at least 25% higher than that of the original strain, and even can be improved by more than 35%, and the salinomycin titer can reach 25000mg/L, so that the improvement of tail gas smell in the fermentation process of the streptomycete strain is realized, the yield of the fermentation product salinomycin is further improved, and the production cost is greatly reduced.
Example 2 construction and product detection of Streptomyces albus JCM 4177 strain with Geomin terpene synthase Gene knockout
The procedure was the same as in example 1, except that the starting strain was replaced with Streptomyces albus JCM 4177. Detecting a starting strain JCM 4177 salinomycin titer of about 1200 mg/L; the titer of salinomycin of the modified strain after the Geomin gene knockout is about 1550mg/L, and the titer is improved by about 30%.
The results of the above examples demonstrate that the knockout of the Geosmin gene can increase the titer of Streptomyces albus salinomycin.
The foregoing description of the preferred embodiments of the application is not intended to limit the application to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the application are intended to be included within the scope of the application.

Claims (10)

1. A strain of streptomyces albus which is a Geosmin terpene synthase gene knockout (Streptomyces albus).
2. The streptomyces strain according to claim 1, wherein said Geosmin terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% identity with the sequence shown in SEQ id No. 11; preferably, the Geosmin terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 11.
3. The streptomyces strain according to claim 1, wherein the content of Geosmin is below 1ppm, preferably below 0.5ppm, preferably below 0.2ppm.
4. Streptomyces strain according to claim 1, wherein the yield of salinomycin is increased by at least 25%, preferably by at least 30%, more preferably by at least 35% compared to the starting strain.
5. The Streptomyces strain according to any one of claims 1 to 4, wherein the starting strain is Streptomyces albus (Streptomyces albus) J1-024.
6. The Streptomyces strain according to claim 5, which is Streptomyces albus (Streptomyces albus) LZ001 with a preservation number of CCTCC M2023070.
7. Use of the Streptomyces strain according to any one of claims 1 to 6 for industrial fermentation.
8. The use of claim 7, wherein the industrial fermentation comprises industrial production of salinomycin.
9. A method for industrially producing salinomycin, which comprises producing salinomycin by fermentation using the streptomyces strain according to any one of claims 1 to 6.
10. A method for increasing the yield of salinomycin and/or reducing the off-gas odor of industrial salinomycin production, comprising fermentation production of salinomycin using the streptomyces strain of any one of claims 1-6.
CN202310235060.0A 2023-03-13 2023-03-13 Streptomyces strain and application thereof Pending CN116656584A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310235060.0A CN116656584A (en) 2023-03-13 2023-03-13 Streptomyces strain and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310235060.0A CN116656584A (en) 2023-03-13 2023-03-13 Streptomyces strain and application thereof

Publications (1)

Publication Number Publication Date
CN116656584A true CN116656584A (en) 2023-08-29

Family

ID=87717791

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310235060.0A Pending CN116656584A (en) 2023-03-13 2023-03-13 Streptomyces strain and application thereof

Country Status (1)

Country Link
CN (1) CN116656584A (en)

Similar Documents

Publication Publication Date Title
Li et al. A high γ-aminobutyric acid-producing Lactobacillus brevis isolated from Chinese traditional paocai
CN109971681B (en) Fusarium laojiao and application thereof
CN106754508B (en) Bacillus subtilis strain and application thereof in soy sauce fermentation and aroma enhancement
CN110093285B (en) Acid-resistant lactobacillus fermentum and application thereof
CN112813085A (en) Use of pyrophosphatase gene
CN112980759B (en) Method for improving TG enzyme fermentation level by enhancing transcription level of Subtilisin gene
CN112725235B (en) Novel strain of clostridium and application thereof
CN112746036B (en) Streptomyces and method for producing pseudouridine by fermenting same
CN102286398B (en) Method for producing high-activity and high-purity rifamycin SV
CN111621454B (en) Gene engineering high-yield strain streptomyces diastatochromogenes, production method and application of epsilon-polylysine
CN111607608A (en) Gene engineering high-yield strain streptomyces diastatochromogenes, method for improving yield of polylysine and application
CN116656584A (en) Streptomyces strain and application thereof
CN113817650B (en) Pyrazine-producing high-temperature actinomycetes, separation screening and application
CN114107113B (en) Method for reducing ethyl carbamate in fermented food by using synthetic starter
CN110423790B (en) Metabolic engineering method for directionally producing high yield antifungal tetramycin B
CN113717886A (en) Bacillus coagulans and method for producing 2' -deoxyadenosine by catalyzing same
CN111876349A (en) Streptomyces albus for producing polylysine and application thereof
CN116622601A (en) Streptomyces strain and application thereof
CN113215064B (en) Slime bacterium for producing meishadazole compounds and application thereof
CN108102964A (en) A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application
CN116286575B (en) Method for efficiently expressing raw starch alpha-amylase by using bacillus subtilis
CN113913314B (en) Strain for reducing accumulation of urea and ethyl carbamate in yellow wine and application thereof
CN107881139A (en) Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof
CN114457103A (en) Method for improving TG enzyme yield by using CRISPR/dCas9 to knock down and regulate protein expression
CN114717135A (en) Streptomyces pralatteris and method for producing pseudouridine and 1-methyl-pseudouridine by fermentation of streptomyces pratensis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination