CN107881139A - Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof - Google Patents

Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof Download PDF

Info

Publication number
CN107881139A
CN107881139A CN201710874532.1A CN201710874532A CN107881139A CN 107881139 A CN107881139 A CN 107881139A CN 201710874532 A CN201710874532 A CN 201710874532A CN 107881139 A CN107881139 A CN 107881139A
Authority
CN
China
Prior art keywords
ansamitocin
bacterial strain
promoter
gene
ansa9
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710874532.1A
Other languages
Chinese (zh)
Inventor
于丽洁
白林泉
宁新娟
郭舒扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Liaoning Sewell Biotechnology Co Ltd
Shanghai Jiaotong University
Original Assignee
Liaoning Sewell Biotechnology Co Ltd
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Liaoning Sewell Biotechnology Co Ltd, Shanghai Jiaotong University filed Critical Liaoning Sewell Biotechnology Co Ltd
Priority to CN201710874532.1A priority Critical patent/CN107881139A/en
Publication of CN107881139A publication Critical patent/CN107881139A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/188—Heterocyclic compound containing in the condensed system at least one hetero ring having nitrogen atoms and oxygen atoms as the only ring heteroatoms

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A kind of high yield ansamitocin bacterial strain for strengthening polyketide synthase gene transcriptional level and preparation method thereof, belongs to biomedicine technical field, by improving the rate-limiting enzyme gene expression dose in biosynthesis pathway, and then improves ansamitocin yield.By in Actinosynnema bacterium ATCC31280, strengthening PKS genes ansa9 expression using erythromycin resistant gene promoter, strengthen ansamitocin biosynthesis ability, realize the raising of ansamitocin yield.The fermentation end yield of the ansamitocin of the engineered strain of gained of the invention improves about 125% compared with original strain, and laboratory shake flask level reaches 99 mg/L.

Description

Strengthen high yield ansamitocin bacterial strain and its preparation of polyketide synthase gene transcriptional level Method
Technical field
The present invention relates to biomedicine field, specifically a kind of high yield for strengthening polyketide synthase gene transcriptional level Ansamitocin bacterial strain and preparation method thereof, mainly by Actinosynnema bacterium ATCC 31280, utilizing Erythromycinresistant Gene promoter enhancing PKS genes ansa9 expression, so as to strengthen the biosynthesis ability of ansamitocin, and then is improved Ansamitocin yield.
Background technology
Ansamitocin is microbe-derived CHROMATOGRAPHIC FRACTIONATION AND MASS molecule, belongs to I type polyketides, by Actinosynnema bacterium （Actinosynnema pretiosum）Produce, there is very strong antitumor activity, in its multiple component, ansamitocin P-3 Activity is most strong.At present, the Multiple Antibodies coupling molecule of ansamitocin comes into different clinical trials, wherein by Roche The trastuzumabemtansine for being used to treat human breast cancer of company's exploitation（That is T-DM1）Patent medicine lists.In view of Its important medical value, the raising of ansamitocin yield receive widely studied.
Pass through literature survey, it has been found that polyketone enzyme（PKS）Activity influence whether the life of prolonging of polyketone chain, and then influence poly- The ultimate output of ketone compounds, and be to improve by carrying out overexpression to the rate-limiting enzyme expressing gene in biosynthesis pathway The conventional strategy of one kind of antibiotic yield.The PKS it was found that in AP-3 biological synthesis gene clusters is analyzed by transcript data early stage Gene ansa9 transcriptional levels are very low, may be AP-3 biosynthesis bottlenecks.
The content of the invention
It is an object of the invention to provide a kind of high yield ansamitocin bacterial strain for strengthening polyketide synthase gene transcriptional level, the bacterium Strain its preparation method and the method using bacterial strain production ansamitocin.The mutant strain is based on Actinosynnema bacterium （ATCC 31280）Ansamitocin biosynthesis PKS gene ansa9 upstreams insertion composing type strong promoter in genome-red mould Plain resistance gene promoter, make the rate-limiting step gene duplication in ansamitocin biosynthesis pathway, strengthen the table of polyketide synthase Up to level, so as to improve the yield of ansamitocin.
To achieve the above object, the invention provides following technical scheme：
On the one hand, the invention provides a kind of high yield ansamitocin bacterial strain for strengthening polyketide synthase gene transcriptional level, its technology Main points are：Erythromycin resistant gene promoter is inserted before gene ansa9 initiation codons.
Further, starting strain is ATCC 31280.
On the other hand, the invention provides the invention provides the high yield of enhancing polyketide synthase gene transcriptional level peace silk The preparation method of rhzomorph bacterial strain, is characterized in that, comprises the following steps：
Step 1）, design and expand the homologous left arm right arm for homologous recombination, and the composing type for enchancer expression Strong promoter permE*；
Step 2）, design and build and opened for inserting erythromycin resistance gene before ansa9 initiation codons by homologous recombination The plasmid of mover；
Step 3）, the plasmid that above-mentioned structure obtains is imported into recipient bacterium Actinosynnema bacterium ATCC 31280 by engaging to shift Middle carry out homologous recombination；
Step 4）, pass through resistance screening and the mutant strain of PCR checking acquisition overexpression ansa9 genes.
Further, plasmid inserts left and right homology arm by pJTU1278 SacI/HindIII sites, and utilizes XbaI/ BglII restriction enzyme sites insert promoter sequence.
Further, promoter is erythromycin resistant gene promoter.Further, the sequence of promoter is：
GCTTGGGCTGCAGGTCGACTCTAGTATGCATGCGAGTGTCCGTTCGAGTGGCGGCTTGCGCCCGATGCTAGTC GCGGTTGATCGGCGATCGCAGGTGCACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACG CGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCCACATATGTTGGGGA。
Further, the homology arm left arm sequence for inserting promoter by homologous recombination is：
GCGGACAGCAGCAGCGGCAGCGCGCCCGCCGGACGCCGCTCCCCCGGCCCGGTCGGCGCGTCGCCCTCCTCCA CGACCAGGTGCGCGTTGGTCCCGCTCATGCCGAACGCGGACACCGCCGCGCGCCGGGACCGCTCCCCGCGCGGCCAC GGCGCGGGCTCGGTCAGCACCCGCAGCGCGCCGGAGCCCCAGTCGACCTCGGGGGTGAGCCGGTCGGCGTGCAGGGT GCGCGGCGCCACGCCGTGGCGCAGCGCCTGCACGACCTTGACCAGCCCCAGCACCCCGGCCGCGCCCTGGGCGTGCC CGATGTTGGACTTGAGCGAGCCGAGCAGCAGCGGCCTGCCCCCTGGCCTGGCGCGCCCGTAGGTGGCCTGGAGCGCC GCCGCCTCGATCGGGTCGCCGAGGCGGGTGCCGGTGCCGTGCGCCTCCAGCAGGTCCACGTCGGACGGCCGCAGCCC CGCGTCCTCCAGCGCCGCCTCGATGACGCGCTGCTGCGCGGCCCCGTTCGGCGCGGTCAGCCCGTTGGACGCGCCGT CGGAGTTGACCGCGCTGCCCCGGACCACCGCCAGCACCGGCCGCCCGGCGCGGCGCGCGTCCGAGAGCCGCTCCAGC AGCACCACGCCGACGCCCTCGCCCCACGCCGTGCCGTCGGCGTCGGCGGAGAACGCCTTGCAGCGGCCGTCCGGGGA CAGTCCGCGCTGCCGGGCGAACTCGACGAACACGTCCGACAGGGGCATGACCGTCGCGCCGCCCGCCAGCGCCATCG CGCACTCGCCGCGCCGCAGCGACTGCGCGGCCAGGTGGATCGCGACCAGCGACGACGAGCAGGCGGTGTCCACGGTG AGCGCGGGCCCGTGCAGGCCGAGCGCGTAGGCGACCCGGCCGGAGGCGACGCTGCCGGAGCTGCCGATGGCCAGGTG GCCCTCGAACTCCTCGGCGACGCGCCGCCGGTTGCCGTAGTTCTGGTAGACCACGCCGGAGAAGACGCCGGTGCCGG TGCCGCGCAGCGACAGCGGGTCGATGCCCGCGCGCTCGACCGCCTCCCAGGAGGTCTCCAGGAGCATCCGGTGCTGC GGGTCGATCGTGACGGCCTCGCGCGGGCCGATGCCGAAGAACCCGGCGTCGAACTCGGCGGCGTCGTGCAGGAACCC GCCCTCGCGGGTGTAGCAGGTGCCCGGCCGGGTCGGGTCGGGGTCGTAGAGCCCGGCCAGGTCCCAGCCGCGGTCGG TGGGGAACCCGGTGATCGCGTCGACGCCGCCGTCCACCAGTTCCCACAGCGCTTCCGGGGTGCGGACGCCGCCGGGG GCGCGGCAGGCCAGGCCGGTGATCGCGATCGGCTCGTGGCCCGCCGACTCCAGGTCGGCGAGCTTGCGCCGCGTCTC GTGCAGGTCGGCGGTGACCCACCGGAGGTAGTCGACCAGCTTCTCGTGGGTCCCGTCGGTCAT；
Homology arm right arm sequence is：
GGGTGCGCGCGTCTCCAAGGCTCGGGCGGGGCAGGCGGGGCAGGCGGGGTCGTCGGGCAGCGGTTCGTCAGGC GGCGGGTCGGCGGGCGGTGGGTCGTCAGGCGGCGGGTCGTCGGGCGGCGGGTCGGCGGGTGGGTGGGCAGCAGGTGG GTGGGCAGCAGGTGGGTGGGCAGCAGGTGGGTGGGCAGCAGGTGGGTGGGCAGCGGGTGGTCAGGCGGGGGTGGTCA GGTCGGCGTGCAGGGTGGTGGGCAGGTCGGTGCGGTGGGTGACGCGCAGCTTGCGGAACACCCTGGTCAGGTGCTGC TCGACGGTGCTCGGGGTGACGAACAGCTTCTCGGCGATCTGCCGGTTGGTGAGGCCGGTGACGGCCAGCGCGGCGAC CTTGCGCTCGGAGCCGGTGAGGCCGCTGGTGTCGTGCGCGACGGGGTCGGCCGCGTCCGGTTCCAGGCGCGCGCACA GCGGTCGCGCGCCGCACGCCCTGGCCAGGTGCCAGGCCCTGCGCAGCACGGCGCGGGCGCGGCGGTGGTCGCCGAGG GCGTGGTGCGCCGCGCCGAGGCAGGCGAGGGTGGCGGCCAGCTCGTAGCGGTCGCCGCAGCGCTCCAGCGCGTCGGC GGCCTCGGCGAGCAGGTGCGGGCGGCGGGTCGGCGGGCTGAGCGGGGCGAGCGCGCGCAGCGCCAGCGCCCTGGGGC GGCCCGCGTCGGCGCCGGTCGTGGCGAGCTGGTCGAACACCAGCCGCCGGGCTCGGTCGTGGTTGCCCAGGCGGGTC CACGCCTCGGCGGCCCCGGTGCGCCACGGCGCGAGGCCCGGCAGGTCGAGGCCCCAGGAGCGCAGGAGGTCGCCGCA CGCCAGGAAGTCGGCGAGCGCCGCGTGGTCCCGCCCGGACGCGAGGTGGTGGTGGCCGCGCGCGTGCAGGTAGTGCG GGGCGGCGGGGCCGTCGAAGAGGGCGTCCGGCACGGGCGCGGTGACGTGCCGCCCGGCCTCCCGCCGCCGCCCGCGC AGGGTGTCGGCGAGGATCAGCGAGCCCAGCGGCAGCCCGACGCCCGCGCCCCAGCCGTGCGCGGGGACGGCGTCGAG CGCGGCGCGGGCGTGCCCGGCTGCGCCCGCGAGGTCGCCGAGCCGCAGCGCGATCACCGAGGCGGCGGCGGCGAAGG AGGCGACCCAGGTGGGCGCGCGCCGGGAGCGCGCCTCGTCGAGCAGCCGCGCGCAGGCCCGGTCGGCCTCGACGGCG CGGTCGGCGCGCACCAGGGCGAGCAGCGCGAGCAGCGCGGGTTCCTCGGACCAGGGGGAGGTGTGGCTGAGCTGGGC GTGGCGCAGGTAGTGCGCGGCCTCGGCGGCGGCTCGGCGCTGGTCCCCGAGGACGAACCCGCCGACCAGGCTGGCGG CCTCGCGCAACCACGGGTCGACGCGGCTCGAGGGCGGGGTGGTGGGGTTGAGGGCCGCGGGGTGGGGGTGCCGCGCT GGTGGGCAGCGGTGCGAGAAGCGGAGGTGTGCGGGGCGTT。
In addition, present invention also offers a kind of method that ansamitocin is prepared using above-mentioned mutant strain, it is characterized in that, Comprise the following steps：By the mycelium of the ansa9 gene overexpression mutant strains after activation in primary-seed medium, 30 DEG C, cultivate 24 h under the conditions of 220 r/min；It is forwarded to by 4% inoculum concentration in secondary seed medium, 30 DEG C, 220 r/min 24 h are cultivated under rotating speed；It is forwarded to by 10% inoculum concentration in fermentation medium, zymotic fluid is collected after 7 d that ferment and is extracted.
Further, in the preparation method of above-mentioned ansamitocin：
Primary-seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 5w/v%；
Or secondary seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 2.5w/v%, isobutanol 0.05v/v%, isopropanol 0.05v/v%, starch 1w/v%；
Or fermentation medium includes yeast extract 0.8w/v%, malt extract 1w/v%, sucrose 1.5w/v%, isobutanol 0.5v/v%, isopropanol 1.2v/v%, starch 2.5w/v%, MgCl2 2 mmol/L。
The present invention has the following effects that：In the prior art, generally use bacterial strain is A. pretiosum ATCC 31565, And by training systern strategy to improve AP-3 yield.And bacterial strain uses therefor is ATCC 31280 in this patent, mainly pass through The genetic modification means of PKS gene overexpressions improve AP-3 yield, and its effect of increasing production is significantly greater than prior art.
In summary, for convenience of insertion erythromycin resistant gene promoter sequence, held in right arm sequence 5 ' and introduce BglII/ XbaI restriction enzyme site.Erythromycin resistant gene promoter is inserted into the ansa9 of genome by homologous double-crossover by the present invention Upstream region of gene, strengthen ansa9 expression using strong promoter, and then improve polyketone chain extension in ansamitocin biosynthesis Approach efficiency, yield of the ansamitocin in fermentation is significantly improved, be ansamitocin industrially scalable expansion and The reduction of production cost provides effective reference.
Brief description of the drawings
Fig. 1 is that erythromycin resistant gene promoter is overexpressed ansa9 mutative symptom schematic diagrames；
Fig. 2 is ansa9 transcriptional level schematic diagrames in overexpression mutant strain；
Fig. 3 is ansa9 gene duplications mutant strain and wild-type strain ansamitocin fermentation yield schematic diagram.
Embodiment
Following instance will the invention will be further described with reference to accompanying drawing.Although it following present the implementation that the present invention optimizes Mode and process, but protection scope of the present invention is not limited to following embodiments.Unreceipted actual conditions in the following example Experimental method, according to normal condition or the suggestion condition of manufacturer.
Embodiment 1
The present embodiment is the detailed process for the mutant strain for preparing gene ansa9 overexpressions.Specifically include following steps：
Step 1）, structure plasmid pLQ593：Using plasmid pIB139 as DNA profiling, expanded using primer ermE-F/R by PCR To erythromycin resistant gene promoter fragment（216 bp）, XbaI/BglII restriction enzyme sites are introduced at promoter sequence both ends；With The genomic DNAs of Actinosynnema bacterium ATCC 31280 are template, respectively using two groups of primers ansa9-L-F/R and ansa9-R- Two sections of sequences that F/R expands to obtain ansa9 initiation codon upstream and downstream by PCR are used as the homology arm that promoter inserts, wherein, Left arm（1445 bp）5 ' ends and 3 ' ends introduce SacI and BglII restriction enzyme sites, right arm respectively（1499 bp）5 ' ends and 3 ' ends point Not Yin Ru BglII/XbaI and HindIII restriction enzyme sites, pass through gene sequencing confirm sequence correctness.In plasmid pJTU1278 SacI/HindIII site insertion left arm（SacI/BglII）And right arm（BglII/HindIII）, obtained plasmid uses After XbaI/BglII carries out digestion, with erythromycin resistant gene promoter fragment（XbaI/BglII）It is attached, obtains plasmid pLQ593。
* step 1）PCR system and condition used by prepared by middle genetic fragment：
PCR reaction systems：The ng of DNA profiling 30, primer 30 pmol, 50%DMSO 3 mL, 25 mM Mg2+2 mL, buffer solution 3 1 unit of mL, KOD polymerase, adds pure water polishing to 30 mL；
PCR conditions：95℃ 5 min；95℃ 30 s；60℃ 30 s；68℃ 2 min；Circulation 30 times；68℃ 10 min.
* each endonuclease recognized site of the present invention（Restriction enzyme site）It is as follows：
* step 1）In used primer sequence be：
Step 2）, wild-type strain ATCC 31280 will be imported for the plasmid pLQ593 of Homo~logous exchange, and screen by PCR To the mutant strain of erythromycin resistant gene promoter insertion, mutant strain characterizes doubling for rate-limiting enzyme expressing gene ansa9.
Comprise the following steps that：It will build and completed to enter host for the plasmid pLQ593 conversions of promoter insertion ET12567（Contain pUZ8002 plasmids）In.Take ET12567 in the LB containing tri- kinds of antibiotic of Amp, Kan and Chl in 37 °C It is incubated overnight, with identical culture medium, overnight culture is transferred once in 10% ratio and cultivates 2.5 h, then with fresh LB solution rinsing thalline to remove the antibiotic in culture.Simultaneously prepare the fresh of wild-type strain ATCC31280 Mycelium（About 16h cultures）, after being rinsed 2 ~ 3 times with LB solution, it is mixed with the Host Strains ET12567 prepared before (ratio of mycelial cell and Host Strains is about 1：10) uniformly after be coated on the YMG flat boards containing 10 mM magnesium ions, treat flat board Flat board is taken out after 37 °C of h of culture carton upside down culture 12 are transferred to after drying, takes two kinds of thiostrepton and nalidixic acid anti-respectively The storing liquid 30mL and 40mL of raw element are added in 1.5mL sterilized waters to be covered on YMG flat boards after mixing, is shifted after flat board is dried Cultivated into 30 °C of incubators.There is single bacterium colony joint element to grow on visible flat board after general 3 ~ 5d, it is coated on by flat board YMG flat boards containing two kinds of antibiotic of thiostrepton and nalidixic acid expand culture（The generally single cross changing-over now grown Zygote）, the joint element picking that flat board is expanded to culture carries out two-wheeled relaxation to the TSBY solution of nonreactive on a small quantity, using ansa9- YZ-F/R is primer, and joint element is verified by mycelium PCR.
An if PCR only bands（448bp）, to revert back to the bacterial strain of wild type；If the band containing 664bp, For double crossing over mutant strain；If containing 448bp and the bands of 664bp two, for single-swap mutant strain.Wherein, double crossing over mutant strain is For the mutant strain of ansa9 gene duplications.
* step 2）In used primer sequence be：
* step 2）PCR system and condition used by prepared by middle genetic fragment：
PCR system：10 ~ 100ng of DNA profiling, primer 30pmol, 50%DMSO3mL, buffer solution 3mL, 0.5 list of Taq polymerase Position, adds pure water polishing to 30mL；
PCR conditions：95℃ 5min；95℃ 30s；58℃ 30s；72℃ 1min；Circulation 30 times；72℃ 10min.
Embodiment 2
The present embodiment is the fermentation process by the mutant strain biosynthesis ansamitocin of gene ansa9 overexpressions.Specific step It is rapid as follows：The bacterial strain of overexpression is coated on the activation of solid YMG culture mediums, after 30 DEG C are cultivated 2d, a small amount of mycelium of picking connects Kind to primary-seed medium, 30 DEG C, transferred by 4% inoculum concentration in secondary seed medium after 220r/min cultures 24h, 30 DEG C/ 220r/min culture 24h after by 10% inoculum concentration transfer after fermentation medium, 7d collect zymotic fluid carry out extraction and chemical combination quality testing Survey.
The composition of the seed culture medium of table 1 and fermentation medium is formed
Embodiment 3
The present embodiment is to determine the method that gene transcription level is doubled in gene duplication bacterial strain by quantitative fluorescent PCR.For RNA The sample of extraction is typically all stored in Redzol solution.RNA extraction process requires low temperature, and centrifugal process removes specified otherwise, Carried out under conditions of 4 °C, 12000r/min.
Concretely comprise the following steps：Take the sample 500mL of break process to add 100mL chloroforms vortex oscillation to mix, centrifugation Aspirate supernatant after 15min, add 100mL absolute ethyl alcohols and suck the sample into centrifugal column (Beijing SBS Genetech gene skill after mixing Art Co., Ltd) in, 2min is stood, 1min is centrifuged, abandons liquid, use rinsing liquid（Washing Buffer, Beijing SBS Genetech gene Technology Co., Ltd.）Rinsing twice, abandons liquid, and centrifugal column is placed in collecting pipe and continues to centrifuge 2min.Use new collecting pipe instead, The treated water of 60 mL DEPC is added into centrifugal column, 2min is centrifuged, RNA sample is eluted from centrifugal column.With The type nucleic acid-protein analysis-e/or determining RNA of Nanodrop 2000 concentration and OD260/280, -80 °C of preservations of RNA sample after extraction. The digestion reaction system of RNA sample can refer to following table preparation：
Reaction system is placed in 37 °C and is incubated after 4h 65 °C of heating 10min after each reaction system addition 5mL 50mM EDTA Terminate digestion, -80 °C of preservations of the RNA sample digested.RNA just obtains cDNA after reverse transcription, available for follow-up gene Transcription analysis.
Obtained cDNA is detected using quantitative fluorescent PCR, and used kit is the Maxima of Fermentas companies SYBR Green/ROX q PCR Maxter Mix(2×)
Determine the primer used during gene transcription level：
Fig. 2 doubles gene by fluorescence quantitative PCR results for what gene duplication mutant strain compareed with wild-type strain.As a result show to be mutated Strain is compared with wild type control, and transcriptional level contrast control of the target gene in mutant strain is doubled improves about 60 times, explanation Ansa9 genes are successfully doubled.
Embodiment 4
The present embodiment is the method for the fermentation yield that ansamitocin is detected using HPLC.Specially：Use Agilent company 1200 serial HPLC of Agilent carry out chromatography, and the chromatographic absorption under 236nm is determined using DAD PDADs Peak.
Wherein, HPLC parameters are as follows：
Chromatographic column：Agilent ZORBAX SB-C18,2.1 ' 150mm, 3.5 μm；
Flow rate of mobile phase：0.1mL/min；
Mobile phase：The aqueous solution and HPLC level methanol elution gradients.
Column temperature：Room temperature.
Fig. 3 is that gene duplication mutant strain and wild-type strain ATCC31280 ansamitocins fermentation level detect.As a result show The yield comparison wild-type strain of mutant strain improves more than 125%, and laboratory shake flask fermentation ansamitocin end yield reaches 99mg/ L。
Plasmid pJTU11278 involved in the present invention is in SCI database documents《He Y, Wang Z, Bai L, Liang J, Zhou X, Deng Z: Two pHZ1358 Derivative Vectors for Efficient Gene Knockout in Streptomyces. J .Microbiol Biotechnol 2010, Jan;20(4):678-682.》In It is open.
Sequence table
<110>Liaoning swell bio tech ltd
Shanghai Communications University
<120>Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof
<130> 17-0838
<141> 2017-09-25
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4794
<212> DNA
<213>Actinosynnema bacterium ansa9 (Actinosynnema pretiosum)
<400> 1
atgaccgacg ggacccacga gaagctggtc gactacctcc ggtgggtcac cgccgacctg 60
cacgagacgc ggcgcaagct cgccgacctg gagtcggcgg gccacgagcc gatcgcgatc 120
accggcctgg cctgccgcgc ccccggcggc gtccgcaccc cggaagcgct gtgggaactg 180
gtggacggcg gcgtcgacgc gatcaccggg ttccccaccg accgcggctg ggacctggcc 240
gggctctacg accccgaccc gacccggccg ggcacctgct acacccgcga gggcgggttc 300
ctgcacgacg ccgccgagtt cgacgccggg ttcttcggca tcggcccgcg cgaggccgtc 360
acgatcgacc cgcagcaccg gatgctcctg gagacctcct gggaggcggt cgagcgcgcg 420
ggcatcgacc cgctgtcgct gcgcggcacc ggcaccggcg tcttctccgg cgtggtctac 480
cagaactacg gcaaccggcg gcgcgtcgcc gaggagttcg agggccacct ggccatcggc 540
agctccggca gcgtcgcctc cggccgggtc gcctacgcgc tcggcctgca cgggcccgcg 600
ctcaccgtgg acaccgcctg ctcgtcgtcg ctggtcgcga tccacctggc cgcgcagtcg 660
ctgcggcgcg gcgagtgcgc gatggcgctg gcgggcggcg cgacggtcat gcccctgtcg 720
gacgtgttcg tcgagttcgc ccggcagcgc ggactgtccc cggacggccg ctgcaaggcg 780
ttctccgccg acgccgacgg cacggcgtgg ggcgagggcg tcggcgtggt gctgctggag 840
cggctctcgg acgcgcgccg cgccgggcgg ccggtgctgg cggtggtccg gggcagcgcg 900
gtcaactccg acggcgcgtc caacgggctg accgcgccga acggggccgc gcagcagcgc 960
gtcatcgagg cggcgctgga ggacgcgggg ctgcggccgt ccgacgtgga cctgctggag 1020
gcgcacggca ccggcacccg cctcggcgac ccgatcgagg cggcggcgct ccaggccacc 1080
tacgggcgcg ccaggccagg gggcaggccg ctgctgctcg gctcgctcaa gtccaacatc 1140
gggcacgccc agggcgcggc cggggtgctg gggctggtca aggtcgtgca ggcgctgcgc 1200
cacggcgtgg cgccgcgcac cctgcacgcc gaccggctca cccccgaggt cgactggggc 1260
tccggcgcgc tgcgggtgct gaccgagccc gcgccgtggc cgcgcgggga gcggtcccgg 1320
cgcgcggcgg tgtccgcgtt cggcatgagc gggaccaacg cgcacctggt cgtggaggag 1380
ggcgacgcgc cgaccgggcc gggggagcgg cgtccggcgg gcgcgctgcc gctgctgctg 1440
tccgcgcgcg ggggcgcggc gctgcgcgcg gcggcggccg acctggtcga gctgccgggg 1500
gagccggtgg acgtgtgctg gtcgctgctc accggccgcg cccggctggt cgaccgcgcc 1560
gtggtggtcg ccgccgaccg ggccgggttc accgccgggc tccaggcgct ggccgccgac 1620
cagccctcgg ccgccgcggt gaccggccgg gcggacgtgt cgggccgcac ggtgctcgtg 1680
ttccccggac agggcggcca gtgggtgggc atgggggccc ggctgctgga cgagtcgccg 1740
gtgttcgcgg cggccgtggc gcgctgcgcg gcggccgtgg agcggctggt ggacttccgg 1800
gtggtggacg tgctgcgcgg cggcgacctc ggccgggtgg acgtggtgca gccggtgtcg 1860
ttcgtggtga tggtggcgct ggccgacctg tggcgctcgt tcggcgtggc cccggacgtc 1920
gtcgtgggcc actcgcaggg cgagatcgcg gcggcctgcg tggccggggc gctctcgctg 1980
gaggacgcgg cgcgggtggt cgtgctgcgc agccgggcca tcgccgtcgg ggtgggcggt 2040
gcccggctgg agggcggcgg catggcgtcg atcccgctgc cgcgcgcgga ggtcgaggag 2100
ctcatcaccg gcacgggggt gtccgtggcg gcggtcaacg gccccggttc ggtggtcgtc 2160
tccggcgacg tcgacccgct cgtggcgcgg gtggagggcg cgcgcaggct gccggtggac 2220
tacgcctcgc actcgcccgc cgtggacgtg ctgcgcgggc gcctgctggc cgacctcgcc 2280
ccgatcacgc cccgacccgc gacggtcccg atgctgtcca ccgtcacggg caagtggctg 2340
gacggcgcgg agctggacgc ggactactgg ttcgccaacc tgcgcgagcc cgtccgcttc 2400
gccgacgcgg tcaccgagct cgccggggcg gactgcgcgg tgttcgtgga ggtcggggcg 2460
cacccggtgc tcaccgccgc gatccaggac gtcctgggcg agcggaccgc cgtcgtcacc 2520
ggcacgctgc gccgcgacga cggcggcctc gaccggttcc tgcgctccgc cgccgcgctg 2580
cacgtgcgcg gcgtgcccgt cgactgggcc ccggtcttcg acggcttgga cgcccaccgc 2640
gccgacctgc ccacctaccc gttccagcgc gcccaccact ggctccagga ggccgaaccc 2700
gccgccaccc cggcgggcgg cgacgacccg ctgtgggcgg cggcgcgcga cgccgacggc 2760
ctgtgcgccg agctggagct caccgagccc gaccagcgcg ccgcgctgcg cgccgtcctg 2820
cccgcgctga ccgcctggca cgagcgcagg agcgagcggg ccctgctcga ctcctggcgc 2880
taccggatca cctggcgcac cctgcccgag ccgcccgagg ccgacccgcg cggcgactgg 2940
ctcgtcgtcg ggccgcaccc cgacctgctg cccgacctgc tgcccggcgt cgcgctcgac 3000
cccgaccgcg ccgcactcgc cgaccgcgcc gcactcgccg acctgctccg cccgcacgcc 3060
gccgtcgcgg gcgtcctggc cacgccgggc gccgacgtgc tcgccctggt ccaggcgctc 3120
ggcgacgcgg gcgtcaccgc gccgctgtgg tgcgccacca ccggggccgt cgcgatctcc 3180
ccgcacgacg gcccgccgga ccccgcccag gccgccacct ggggcctggg ccgggtcgtc 3240
gcgctggagc accccggccg ctggggcggg ctggtcgacc tcgccgaccc cgccgacccg 3300
cgccagcgcc gcaggctcgc cgccgtcctc gccggacccg gcgtcgacga cggcggcgag 3360
gaccaggtcg ccatccgcgc ggagggcgtg ttcgcgcgca ggctcgtgcg cgccgaaccg 3420
caggccccgg ccgccccgtg gaccccgcgc ggcacggtcc tggtcaccgg cggcaccggc 3480
ggcgtcgccg cgcacgtggc ccgccgcctc gccgccctcg gcgccgacca cctcgtcctc 3540
accagccgcc ggggcccgag cgcccccggc gcgcccgcgc tcgccgccga cctggaggcg 3600
ctgggctccc gcgtcaccac cgccgcctgc gacgtcgccg accgcgccgc gctcgccgcc 3660
ctgctggccg acctggaacg cgcgggcgac cagatcaccg ccgtcgtgca cgcggcgggc 3720
gccaacgccc agacccccgt cgccgacacc acccccgagg agctcgcgcg cgtccaggcc 3780
gccaaggcgc tcggcgccga gcacctggac gagctgctgg gcgggcgccc gctcgacgcg 3840
ttcgtcctgt tctcctccaa cgcgggcgtg tggggcagcg gcggccagtg cgcctacgcc 3900
gccgccaacg cccgcctcga cgccctcgcc cagcgccgcc gcgcgcacgg ccgcgtcgcc 3960
acctccgtcg cctggggcgc ctgggacggc ggcggcatgt ccagcgccac cccggacatc 4020
gccgcccagc tcgcccaggc gggcctgcgc ctgatgcccc cggacctggc ggtgtccgcg 4080
ctgctcgacg ccgtcgcccg cgacgagacc accaccgtcg tcaccgacgt gcgctgggag 4140
gcgttcgccg cccggttcac cgccctgcgc cgcagccccc tgctcgccga cctgcccgag 4200
gcccgccctg aaccggtcgc cgccgccgac gagcccgacc gggggctcgc gggcgagctg 4260
gccgcgctgc ccgcgcccga gcggctgcgc aggctcaccg acctggtgcg cgcgcacgcc 4320
gccgccgcgc tcggccaccc agggcccgag tcggtgcccg ccgacgtggc cttccgcgac 4380
ctgggtgtgg actcgctggc cgccgtcgag ctgcgcaacc gcgcctcggc cgcgaccggc 4440
gcgaggctca cgcccaccgc cgtcttcgac caccccaccc cgcgcgcgct cgccgcgcac 4500
ctggccgagc acctcgccgc caccaaggac agcggggccc cggacgcggc cccggacatc 4560
caggacccca cggccgcgct gcgcggcctg gacgccctcg ccgccgccct gcccgccgcc 4620
gcgggcgacg acgcgctgcg cgagcgggtc accgcgcgcc tgcgcgaggt gctgggccgc 4680
tgggacgagc tgaccggcga ccccggcgga cccgacgggt tcgacctcga ccacatcagc 4740
gacgacgagc tgttccgcct ggccgacagc aggctcggcc cgaccggcgc ctga 4794
<210> 2
<211> 224
<212> DNA
<213>Promoter (erythromycin resistance gene)
<400> 2
gcttgggctg caggtcgact ctagtatgca tgcgagtgtc cgttcgagtg gcggcttgcg 60
cccgatgcta gtcgcggttg atcggcgatc gcaggtgcac gcggtcgatc ttgacggctg 120
gcgagaggtg cggggaggat ctgaccgacg cggtccacac gtggcaccgc gatgctgttg 180
tgggcacaat cgtgccggtt ggtaggatcc acatatgttg ggga 224
<210> 3
<211> 1445
<212> DNA
<213>Promoter (homologous left arm)
<400> 3
gcggacagca gcagcggcag cgcgcccgcc ggacgccgct cccccggccc ggtcggcgcg 60
tcgccctcct ccacgaccag gtgcgcgttg gtcccgctca tgccgaacgc ggacaccgcc 120
gcgcgccggg accgctcccc gcgcggccac ggcgcgggct cggtcagcac ccgcagcgcg 180
ccggagcccc agtcgacctc gggggtgagc cggtcggcgt gcagggtgcg cggcgccacg 240
ccgtggcgca gcgcctgcac gaccttgacc agccccagca ccccggccgc gccctgggcg 300
tgcccgatgt tggacttgag cgagccgagc agcagcggcc tgccccctgg cctggcgcgc 360
ccgtaggtgg cctggagcgc cgccgcctcg atcgggtcgc cgaggcgggt gccggtgccg 420
tgcgcctcca gcaggtccac gtcggacggc cgcagccccg cgtcctccag cgccgcctcg 480
atgacgcgct gctgcgcggc cccgttcggc gcggtcagcc cgttggacgc gccgtcggag 540
ttgaccgcgc tgccccggac caccgccagc accggccgcc cggcgcggcg cgcgtccgag 600
agccgctcca gcagcaccac gccgacgccc tcgccccacg ccgtgccgtc ggcgtcggcg 660
gagaacgcct tgcagcggcc gtccggggac agtccgcgct gccgggcgaa ctcgacgaac 720
acgtccgaca ggggcatgac cgtcgcgccg cccgccagcg ccatcgcgca ctcgccgcgc 780
cgcagcgact gcgcggccag gtggatcgcg accagcgacg acgagcaggc ggtgtccacg 840
gtgagcgcgg gcccgtgcag gccgagcgcg taggcgaccc ggccggaggc gacgctgccg 900
gagctgccga tggccaggtg gccctcgaac tcctcggcga cgcgccgccg gttgccgtag 960
ttctggtaga ccacgccgga gaagacgccg gtgccggtgc cgcgcagcga cagcgggtcg 1020
atgcccgcgc gctcgaccgc ctcccaggag gtctccagga gcatccggtg ctgcgggtcg 1080
atcgtgacgg cctcgcgcgg gccgatgccg aagaacccgg cgtcgaactc ggcggcgtcg 1140
tgcaggaacc cgccctcgcg ggtgtagcag gtgcccggcc gggtcgggtc ggggtcgtag 1200
agcccggcca ggtcccagcc gcggtcggtg gggaacccgg tgatcgcgtc gacgccgccg 1260
tccaccagtt cccacagcgc ttccggggtg cggacgccgc cgggggcgcg gcaggccagg 1320
ccggtgatcg cgatcggctc gtggcccgcc gactccaggt cggcgagctt gcgccgcgtc 1380
tcgtgcaggt cggcggtgac ccaccggagg tagtcgacca gcttctcgtg ggtcccgtcg 1440
gtcat 1445
<210> 4
<211> 1499
<212> DNA
<213>Promoter (homologous right arm)
<400> 4
gggtgcgcgc gtctccaagg ctcgggcggg gcaggcgggg caggcggggt cgtcgggcag 60
cggttcgtca ggcggcgggt cggcgggcgg tgggtcgtca ggcggcgggt cgtcgggcgg 120
cgggtcggcg ggtgggtggg cagcaggtgg gtgggcagca ggtgggtggg cagcaggtgg 180
gtgggcagca ggtgggtggg cagcgggtgg tcaggcgggg gtggtcaggt cggcgtgcag 240
ggtggtgggc aggtcggtgc ggtgggtgac gcgcagcttg cggaacaccc tggtcaggtg 300
ctgctcgacg gtgctcgggg tgacgaacag cttctcggcg atctgccggt tggtgaggcc 360
ggtgacggcc agcgcggcga ccttgcgctc ggagccggtg aggccgctgg tgtcgtgcgc 420
gacggggtcg gccgcgtccg gttccaggcg cgcgcacagc ggtcgcgcgc cgcacgccct 480
ggccaggtgc caggccctgc gcagcacggc gcgggcgcgg cggtggtcgc cgagggcgtg 540
gtgcgccgcg ccgaggcagg cgagggtggc ggccagctcg tagcggtcgc cgcagcgctc 600
cagcgcgtcg gcggcctcgg cgagcaggtg cgggcggcgg gtcggcgggc tgagcggggc 660
gagcgcgcgc agcgccagcg ccctggggcg gcccgcgtcg gcgccggtcg tggcgagctg 720
gtcgaacacc agccgccggg ctcggtcgtg gttgcccagg cgggtccacg cctcggcggc 780
cccggtgcgc cacggcgcga ggcccggcag gtcgaggccc caggagcgca ggaggtcgcc 840
gcacgccagg aagtcggcga gcgccgcgtg gtcccgcccg gacgcgaggt ggtggtggcc 900
gcgcgcgtgc aggtagtgcg gggcggcggg gccgtcgaag agggcgtccg gcacgggcgc 960
ggtgacgtgc cgcccggcct cccgccgccg cccgcgcagg gtgtcggcga ggatcagcga 1020
gcccagcggc agcccgacgc ccgcgcccca gccgtgcgcg gggacggcgt cgagcgcggc 1080
gcgggcgtgc ccggctgcgc ccgcgaggtc gccgagccgc agcgcgatca ccgaggcggc 1140
ggcggcgaag gaggcgaccc aggtgggcgc gcgccgggag cgcgcctcgt cgagcagccg 1200
cgcgcaggcc cggtcggcct cgacggcgcg gtcggcgcgc accagggcga gcagcgcgag 1260
cagcgcgggt tcctcggacc agggggaggt gtggctgagc tgggcgtggc gcaggtagtg 1320
cgcggcctcg gcggcggctc ggcgctggtc cccgaggacg aacccgccga ccaggctggc 1380
ggcctcgcgc aaccacgggt cgacgcggct cgagggcggg gtggtggggt tgagggccgc 1440
ggggtggggg tgccgcgctg gtgggcagcg gtgcgagaag cggaggtgtg cggggcgtt 1499
<210> 5
<211> 26
<212> DNA
<213>Primer (ansa9-L-F)
<400> 5
atatagagct cgcggacagc agcagc 26
<210> 6
<211> 29
<212> DNA
<213>Primer (ansa9-L-R)
<400> 6
atataagatc tatgaccgac gggacccac 29
<210> 7
<211> 32
<212> DNA
<213>Primer (ansa9-R-F)
<400> 7
atataagatc ttctagaggg tgcgcgcgtc tc 32
<210> 8
<211> 26
<212> DNA
<213>Primer (ansa9-R-R)
<400> 8
atataaagct taacgccccg cacacc 26
<210> 9
<211> 27
<212> DNA
<213>Primer (ermE-F)
<400> 9
atatatctag agcttgggct gcaggtc 27
<210> 10
<211> 31
<212> DNA
<213>Primer (ermE-R)
<400> 10
atataagatc ttccccaaca tatgtggatc c 31
<210> 11
<211> 20
<212> DNA
<213>Primer (ansa9-YZ-F)
<400> 11
gccgtccacc agttcccaca 20
<210> 12
<211> 19
<212> DNA
<213>Primer (ansa9-YZ-R)
<400> 12
caccgacctg cccaccacc 19
<210> 13
<211> 20
<212> DNA
<213>Primer (ansa9-RT-F)
<400> 13
accagttccc acagcgcttc 20
<210> 14
<211> 20
<212> DNA
<213>Primer (ansa9-RT-R)
<400> 14
acgagaagct ggtcgactac 20
<210> 15
<211> 20
<212> DNA
<213>Primer (hrdB-RT-F)
<400> 15
gttcccccaa ggcgaagaag 20
<210> 16
<211> 20
<212> DNA
<213>Primer (hrdB-RT-R)
<400> 16
gcttggcgtt ctcctcctcg 20

Claims (9)

  1. A kind of 1. ansamitocin bacterial strain for strengthening polyketide synthase gene transcriptional level, it is characterised in that：Gene ansa9 initiation codons Insertion erythromycin resistant gene promoter before sub.
  2. 2. strengthen the ansamitocin bacterial strain of polyketide synthase gene transcriptional level according to claim 1, it is characterised in that：Set out Bacterial strain is ATCC 31280.
  3. A kind of 3. preparation method for the high yield ansamitocin bacterial strain for strengthening polyketide synthase gene transcriptional level, it is characterised in that bag Include following steps：
    Step 1）, design and expand the homologous left arm right arm for homologous recombination, and the composing type for enchancer expression Strong promoter permE*；
    Step 2）, design and build and opened for inserting erythromycin resistance gene before ansa9 initiation codons by homologous recombination The plasmid of mover；
    Step 3）, the plasmid that above-mentioned structure obtains is imported into recipient bacterium Actinosynnema bacterium ATCC 31280 by engaging to shift Middle carry out homologous recombination；
    Step 4）, pass through resistance screening and the mutant strain of PCR checking acquisition overexpression ansa9 genes.
  4. 4. the preparation method of high yield ansamitocin bacterial strain according to claim 3, it is characterised in that：The plasmid by PJTU1278 SacI/HindIII sites insertion left and right homology arm, and utilize XbaI/BglII restriction enzyme sites insertion promoter sequence Row.
  5. 5. the preparation method of the high yield ansamitocin bacterial strain according to claim 3 or 4, it is characterised in that：The promoter For erythromycin resistant gene promoter.
  6. 6. the preparation method of high yield ansamitocin bacterial strain according to claim 5, it is characterised in that the sequence of promoter For：
    GCTTGGGCTGCAGGTCGACTCTAGTATGCATGCGAGTGTCCGTTCGAGTGGCGGCTTGCGCCCGATGCTAGTC GCGGTTGATCGGCGATCGCAGGTGCACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACG CGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCCACATATGTTGGGGA。
  7. 7. the preparation method of high yield ansamitocin bacterial strain according to claim 6, it is characterised in that for by homologous heavy Group insertion promoter homology arm left arm sequence be：
    GCGGACAGCAGCAGCGGCAGCGCGCCCGCCGGACGCCGCTCCCCCGGCCCGGTCGGCGCGTCGCCCTCCTCCA CGACCAGGTGCGCGTTGGTCCCGCTCATGCCGAACGCGGACACCGCCGCGCGCCGGGACCGCTCCCCGCGCGGCCAC GGCGCGGGCTCGGTCAGCACCCGCAGCGCGCCGGAGCCCCAGTCGACCTCGGGGGTGAGCCGGTCGGCGTGCAGGGT GCGCGGCGCCACGCCGTGGCGCAGCGCCTGCACGACCTTGACCAGCCCCAGCACCCCGGCCGCGCCCTGGGCGTGCC CGATGTTGGACTTGAGCGAGCCGAGCAGCAGCGGCCTGCCCCCTGGCCTGGCGCGCCCGTAGGTGGCCTGGAGCGCC GCCGCCTCGATCGGGTCGCCGAGGCGGGTGCCGGTGCCGTGCGCCTCCAGCAGGTCCACGTCGGACGGCCGCAGCCC CGCGTCCTCCAGCGCCGCCTCGATGACGCGCTGCTGCGCGGCCCCGTTCGGCGCGGTCAGCCCGTTGGACGCGCCGT CGGAGTTGACCGCGCTGCCCCGGACCACCGCCAGCACCGGCCGCCCGGCGCGGCGCGCGTCCGAGAGCCGCTCCAGC AGCACCACGCCGACGCCCTCGCCCCACGCCGTGCCGTCGGCGTCGGCGGAGAACGCCTTGCAGCGGCCGTCCGGGGA CAGTCCGCGCTGCCGGGCGAACTCGACGAACACGTCCGACAGGGGCATGACCGTCGCGCCGCCCGCCAGCGCCATCG CGCACTCGCCGCGCCGCAGCGACTGCGCGGCCAGGTGGATCGCGACCAGCGACGACGAGCAGGCGGTGTCCACGGTG AGCGCGGGCCCGTGCAGGCCGAGCGCGTAGGCGACCCGGCCGGAGGCGACGCTGCCGGAGCTGCCGATGGCCAGGTG GCCCTCGAACTCCTCGGCGACGCGCCGCCGGTTGCCGTAGTTCTGGTAGACCACGCCGGAGAAGACGCCGGTGCCGG TGCCGCGCAGCGACAGCGGGTCGATGCCCGCGCGCTCGACCGCCTCCCAGGAGGTCTCCAGGAGCATCCGGTGCTGC GGGTCGATCGTGACGGCCTCGCGCGGGCCGATGCCGAAGAACCCGGCGTCGAACTCGGCGGCGTCGTGCAGGAACCC GCCCTCGCGGGTGTAGCAGGTGCCCGGCCGGGTCGGGTCGGGGTCGTAGAGCCCGGCCAGGTCCCAGCCGCGGTCGG TGGGGAACCCGGTGATCGCGTCGACGCCGCCGTCCACCAGTTCCCACAGCGCTTCCGGGGTGCGGACGCCGCCGGGG GCGCGGCAGGCCAGGCCGGTGATCGCGATCGGCTCGTGGCCCGCCGACTCCAGGTCGGCGAGCTTGCGCCGCGTCTC GTGCAGGTCGGCGGTGACCCACCGGAGGTAGTCGACCAGCTTCTCGTGGGTCCCGTCGGTCAT；
    Homology arm right arm sequence is：
    GGGTGCGCGCGTCTCCAAGGCTCGGGCGGGGCAGGCGGGGCAGGCGGGGTCGTCGGGCAGCGGTTCGTCAGGC GGCGGGTCGGCGGGCGGTGGGTCGTCAGGCGGCGGGTCGTCGGGCGGCGGGTCGGCGGGTGGGTGGGCAGCAGGTGG GTGGGCAGCAGGTGGGTGGGCAGCAGGTGGGTGGGCAGCAGGTGGGTGGGCAGCGGGTGGTCAGGCGGGGGTGGTCA GGTCGGCGTGCAGGGTGGTGGGCAGGTCGGTGCGGTGGGTGACGCGCAGCTTGCGGAACACCCTGGTCAGGTGCTGC TCGACGGTGCTCGGGGTGACGAACAGCTTCTCGGCGATCTGCCGGTTGGTGAGGCCGGTGACGGCCAGCGCGGCGAC CTTGCGCTCGGAGCCGGTGAGGCCGCTGGTGTCGTGCGCGACGGGGTCGGCCGCGTCCGGTTCCAGGCGCGCGCACA GCGGTCGCGCGCCGCACGCCCTGGCCAGGTGCCAGGCCCTGCGCAGCACGGCGCGGGCGCGGCGGTGGTCGCCGAGG GCGTGGTGCGCCGCGCCGAGGCAGGCGAGGGTGGCGGCCAGCTCGTAGCGGTCGCCGCAGCGCTCCAGCGCGTCGGC GGCCTCGGCGAGCAGGTGCGGGCGGCGGGTCGGCGGGCTGAGCGGGGCGAGCGCGCGCAGCGCCAGCGCCCTGGGGC GGCCCGCGTCGGCGCCGGTCGTGGCGAGCTGGTCGAACACCAGCCGCCGGGCTCGGTCGTGGTTGCCCAGGCGGGTC CACGCCTCGGCGGCCCCGGTGCGCCACGGCGCGAGGCCCGGCAGGTCGAGGCCCCAGGAGCGCAGGAGGTCGCCGCA CGCCAGGAAGTCGGCGAGCGCCGCGTGGTCCCGCCCGGACGCGAGGTGGTGGTGGCCGCGCGCGTGCAGGTAGTGCG GGGCGGCGGGGCCGTCGAAGAGGGCGTCCGGCACGGGCGCGGTGACGTGCCGCCCGGCCTCCCGCCGCCGCCCGCGC AGGGTGTCGGCGAGGATCAGCGAGCCCAGCGGCAGCCCGACGCCCGCGCCCCAGCCGTGCGCGGGGACGGCGTCGAG CGCGGCGCGGGCGTGCCCGGCTGCGCCCGCGAGGTCGCCGAGCCGCAGCGCGATCACCGAGGCGGCGGCGGCGAAGG AGGCGACCCAGGTGGGCGCGCGCCGGGAGCGCGCCTCGTCGAGCAGCCGCGCGCAGGCCCGGTCGGCCTCGACGGCG CGGTCGGCGCGCACCAGGGCGAGCAGCGCGAGCAGCGCGGGTTCCTCGGACCAGGGGGAGGTGTGGCTGAGCTGGGC GTGGCGCAGGTAGTGCGCGGCCTCGGCGGCGGCTCGGCGCTGGTCCCCGAGGACGAACCCGCCGACCAGGCTGGCGG CCTCGCGCAACCACGGGTCGACGCGGCTCGAGGGCGGGGTGGTGGGGTTGAGGGCCGCGGGGTGGGGGTGCCGCGCT GGTGGGCAGCGGTGCGAGAAGCGGAGGTGTGCGGGGCGTT。
  8. 8. the method that the ansamitocin superior strain according to claim 3 ~ 7 prepares ansamitocin, it is characterised in that including Following steps：By the mycelium of the ansa9 gene overexpression mutant strains after activation in primary-seed medium, 30 DEG C, 220 24 h are cultivated under the conditions of r/min；It is forwarded to by 4% inoculum concentration in secondary seed medium, 30 DEG C, train under 220 r/min rotating speed Support 24 h；It is forwarded to by 10% inoculum concentration in fermentation medium, zymotic fluid is collected after 7 d that ferment and is extracted.
  9. 9. the method that ansamitocin superior strain according to claim 8 prepares ansamitocin, it is characterised in that：
    Primary-seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 5w/v%；
    Or secondary seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 2.5w/v%, isobutanol 0.05v/v%, isopropanol 0.05v/v%, starch 1w/v%；
    Or fermentation medium includes yeast extract 0.8w/v%, malt extract 1w/v%, sucrose 1.5w/v%, isobutanol 0.5v/v%, isopropanol 1.2v/v%, starch 2.5w/v%, MgCl2 2mmol/L。
CN201710874532.1A 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof Pending CN107881139A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710874532.1A CN107881139A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710874532.1A CN107881139A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof

Publications (1)

Publication Number Publication Date
CN107881139A true CN107881139A (en) 2018-04-06

Family

ID=61780772

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710874532.1A Pending CN107881139A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof

Country Status (1)

Country Link
CN (1) CN107881139A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113980982A (en) * 2021-10-18 2022-01-28 上海交通大学 High-yield ansamitocin method for enhancing target protein gene expression in ansamitocin body

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040209322A1 (en) * 1997-04-30 2004-10-21 Chaitan Khosla Combinatorial polyketide libraries produced using a modular PKS gene cluster as scaffold
US20060084141A1 (en) * 2001-11-21 2006-04-20 Floss Heinz G Biosynthetic gene cluster for the maytansinoid antitumor agent ansamitocin
US20080254508A1 (en) * 2007-04-12 2008-10-16 Thomas Michael G Type i polyketide synthase extender units
CN106222191A (en) * 2016-08-01 2016-12-14 上海交通大学 Knock out central carbon metabolism gene with the method improving Ge Erdeng element fermentation level

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040209322A1 (en) * 1997-04-30 2004-10-21 Chaitan Khosla Combinatorial polyketide libraries produced using a modular PKS gene cluster as scaffold
US20060084141A1 (en) * 2001-11-21 2006-04-20 Floss Heinz G Biosynthetic gene cluster for the maytansinoid antitumor agent ansamitocin
US20080254508A1 (en) * 2007-04-12 2008-10-16 Thomas Michael G Type i polyketide synthase extender units
CN106222191A (en) * 2016-08-01 2016-12-14 上海交通大学 Knock out central carbon metabolism gene with the method improving Ge Erdeng element fermentation level

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
PETER SPITELLER等: "The post-polyketide synthase modification steps in the biosynthesis of the antitumor agent ansamitocin by Actinosynnema pretiosum" *
XINRAN WANG等: "Improved PKS Gene Expression With Strong Endogenous Promoter Resulted in Geldanamycin Yield Increase" *
宁新娟: "安丝菌素生物合成限速因子解析及产量提高" *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113980982A (en) * 2021-10-18 2022-01-28 上海交通大学 High-yield ansamitocin method for enhancing target protein gene expression in ansamitocin body
CN113980982B (en) * 2021-10-18 2024-02-06 上海交通大学 High-yield ansamitocin method for enhancing expression of ansamitocin in-vivo target protein gene

Similar Documents

Publication Publication Date Title
CN102181470B (en) Method for improving yield of Streptomyces antibiotics and plasmid thereof
CN109486848B (en) Construction method and application of spinosyn-containing multi-operon artificial gene cluster plasmid
CN101649326B (en) Gene recombination mediated by phiC312 and inheritance reformation for erythrocin producing bacterium
CN104357506B (en) Increase method of the precursor supply to improve salinomycin fermentation level
CN110563783B (en) High-efficiency low-toxicity tetramycin B derivative and directed high-yield metabolic engineering method thereof
CN101363022A (en) Biological synthesis gene cluster of tetrokacin A and use thereof
CN103215282B (en) The biological synthesis gene cluster of cross-country statin and application thereof
CN107881139A (en) Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof
CN102703495A (en) Method for improving yield of streptomycete antibiotic and plasmid thereof
CN105176904B (en) Engineering strain streptomyces tsukubaensis L21 and its application
CN102719388A (en) Method for improving yield of streptomyces antibiotics and plasmids thereof
CN104263738A (en) Biosynthesis gene cluster of FAS II inhibitor ABX
CN106188093B (en) A kind of rapamycin structure analog and preparation method thereof
CN101892186B (en) Genetic engineering bacterium of streptomyces coeruleorubidus for producing epidaunorubicin and preparation method thereof
CN107881137A (en) Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof
CN110423790B (en) Metabolic engineering method for directionally producing high yield antifungal tetramycin B
CN104427870A (en) Uk-2 biosynthetic genes and method for improving uk-2 productivity using same
Hu et al. Reassembly of anthramycin biosynthetic gene cluster by using recombinogenic cassettes
CN106191156B (en) The method for improving Ge Erdeng element fermentation level
CN102732534B (en) Biosynthetic gene cluster of xiamycin A and oxiamycin, and application thereof
CN106222191B (en) Knock out method of the central carbon metabolism gene to improve Ge Erdeng element fermentation level
CN107541481A (en) A kind of genetic engineering bacterium for producing Epi-ADM and its application
CN112410353A (en) fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene
Gupta et al. Mutations of vaccinia virus DNA topoisomerase I that stabilize the cleavage complex.
CN104388491B (en) The method for improving salinomycin fermentation level

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180406