CN107881137A - Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof - Google Patents

Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof Download PDF

Info

Publication number
CN107881137A
CN107881137A CN201710870997.XA CN201710870997A CN107881137A CN 107881137 A CN107881137 A CN 107881137A CN 201710870997 A CN201710870997 A CN 201710870997A CN 107881137 A CN107881137 A CN 107881137A
Authority
CN
China
Prior art keywords
ansamitocin
asm10
preparation
bacterial strain
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710870997.XA
Other languages
Chinese (zh)
Inventor
于丽洁
白林泉
宁新娟
郭舒扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Liaoning Sewell Biotechnology Co Ltd
Shanghai Jiaotong University
Original Assignee
Liaoning Sewell Biotechnology Co Ltd
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Liaoning Sewell Biotechnology Co Ltd, Shanghai Jiaotong University filed Critical Liaoning Sewell Biotechnology Co Ltd
Priority to CN201710870997.XA priority Critical patent/CN107881137A/en
Publication of CN107881137A publication Critical patent/CN107881137A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/188—Heterocyclic compound containing in the condensed system at least one hetero ring having nitrogen atoms and oxygen atoms as the only ring heteroatoms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y201/00—Transferases transferring one-carbon groups (2.1)
    • C12Y201/01—Methyltransferases (2.1.1)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A kind of high yield ansamitocin bacterial strain for strengthening transcriptional level and preparation method thereof, belongs to biomedicine technical field, by improving the rate-limiting enzyme gene expression dose in biosynthesis pathway, and then improves ansamitocin yield.By in Actinosynnema bacterium ATCC 31280 glycosyltransferases expression gene disruption deletion mutation strain NXJ 22, using modifier asm10 after strong promoter kasOp* overexpressions, strengthening methyl transferase activity, so as to improve ansamitocin yield.The fermentation end yield of the ansamitocin of the engineered strain of gained of the invention improves about 173% compared with control strain, and laboratory shake flask level reaches 141.8 mg/L.

Description

Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof
Technical field
The present invention relates to biomedicine field, specifically a kind of high yield ansamitocin bacterial strain for strengthening transcriptional level And preparation method thereof, mainly lacked by the glycosyltransferases expression gene disruption in Actinosynnema bacterium ATCC31280 In mutant strain NXJ-22, modifier asm10 after strong promoter kasOp* overexpressions, the methyl transfer of enhancing ansamitocin are utilized Efficiency, ansamitocin biosynthesis ability is improved, and then improve ansamitocin yield.
Background technology
Ansamitocin is by Actinosynnema bacterium（Actinosynnema pretiosum）Acyl in a kind of caused big ring Amine antibiotic, it can be combined with the β subunits of tubulin, microtubules be hindered, so as to suppress tumour cell division.Come from Chari of ImmunoGen, Inc. company et al. by the ester chain of C-3 positions connect disulfide formation DM1 molecules, through DTT also It can connect to form antibody-binding molecules from different antibody after original.At present, a variety of DM1 antibody-binding molecules of ansamitocin have been entered Enter different clinical trials, wherein the Trastuzumab for being used to treat human breast cancer by Roche Holding Ag's exploitation Emtansine（That is T-DM1）Patent medicine lists.In addition to antitumor activity, ansamitocin can also suppress eucaryote, such as true Bacterium, yeast, insect etc..
Ansamitocin biosynthesis mainly includes three parts：Start element 3- amino -5- hydroxybenzoic acids（AHBA）Conjunction Into the extension of polyketone chain（I types polyketide synthase is catalyzed）With complexity rear modification approach, including：Chloro, oxygen methylate, carbamyl Change, acylation, epoxidation, N- methylate（SAM is relied on）Or glycosylation forms ansamitocin, wherein by glycosyl transferase Asm25 The N- glycosylations of catalysis are the competition approach of N- methylation reactions, generate subsidiary product-glycosylation ansamitocin.Although can Interruption missing is carried out by glycosyltransferases expression gene, obtained mutant strain NXJ-22, the glycosylation of N positions is methylated N positions The competition of approach is eliminated, and still, the N positions efficiency that methylates is still relatively low.By prior art disclosure, rear modification The efficiency of approach suffers from vital effect for the yield and activity of end-product.
The content of the invention
It is an object of the invention to provide a kind of bacterial strain of high yield ansamitocin, the mutant strain preparation method and pass through this The method of mutant strain high yield ansamitocin.The mutant strain is based on overexpression N positions transmethylase expressing gene asm10, passes through The rate-limiting step gene in ansamitocin biosynthesis pathway is doubled, strengthens methyl transferase gene expression, so as to improve The yield of ansamitocin.
To achieve the above object, the invention provides following technical scheme：
On the one hand, the invention provides a kind of high yield ansamitocin bacterial strain for strengthening transcriptional level, it is characterized in that：The bacterium The N positions transmethylase overexpression of strain.
Further, mutant strain after the overexpressions of strains A TCC 31280 by obtaining.
On the other hand, will the invention provides the preparation method of the high yield ansamitocin bacterial strain of the enhancing transcriptional level, its technology Point is to comprise the following steps：
Step 1）, build the integrative plasmid carrier for doubling methyl transferase gene asm10；
Step 2）, by step 1）It is homologous heavy by being carried out in engagement transfer importing recipient bacterium NXJ-22 to build obtained plasmid vector Group, and the mutant strain of screening-gene overexpression.
Further, step 1）In, plasmid vector is recombinated by plasmid pDR3-K* and obtained.
Further, gene asm10 derives from Actinosynnema bacterium ATCC 31565.
Further, RBS site sequences ATCTGAGTTGAAGAGGTGACGTC is inserted before initiation codon.
Further, in step 3), the mutant strain of overexpression asm10 genes is obtained by resistance screening and PCR checkings.
Further, being constructed by for plasmid vector inserts asm10 PCR fragment in the SpeI/EcoRI sites of plasmid （SpeI/EcoRI）.
In addition, present invention also offers a kind of method that ansamitocin is prepared using above-mentioned mutant strain, it is characterized in that, Comprise the following steps：By the mycelium of the asm10 gene overexpression mutant strains after activation in primary-seed medium, 30 DEG C, cultivate 24 h under the conditions of 220 r/min；It is forwarded to by 4% inoculum concentration in secondary seed medium, 30 DEG C, 220 r/min 24 h are cultivated under rotating speed；It is forwarded to by 10% inoculum concentration in fermentation medium, 25 DEG C, ferment under 220 r/min rotating speed 7 d Zymotic fluid is collected afterwards and is extracted.
Further, in the preparation method of above-mentioned ansamitocin：
Primary-seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 5w/v%；
Or secondary seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 2.5w/v%, isobutanol 0.05v/v%, isopropanol 0.05v/v%, starch 1w/v%；
Or fermentation medium includes yeast extract 0.8w/v%, malt extract 1w/v%, sucrose 1.5w/v%, isobutanol 0.5v/v%, isopropanol 1.2v/v%, starch 2.5w/v%, MgCl2 2 mmol/L。
Beneficial effects of the present invention：In the prior art, the recipient bacterium generally selected is A. pretiosum ATCC 31565, used carrier is covered as pIB139 using asm10 genes, promoter used is permE*, and recipient bacterium is used in the present invention Mutant strain derived from ATCC 31280, asm10 gene overexpressions used carrier are pDR3-K*, and promoter used is kasOp*. By the above method, when covering compared to prior art asm10 genes into mutant strain, AP-3 yield returns to and wild type phase It is near horizontal；And by the method for the present invention after asm10 gene overexpressions, AP-3 yield comparisons control strain improves at least 173%。
In summary, deletion mutation strain NXJ- is interrupted in Actinosynnema bacterium ATCC 31280 glycosyltransferase gene In 22, using integrating vector pDR3-K*, (Φ C31 integration sites, pSET152 derives, with kasOp* strong promoters）, The transmethylase expressing gene asm10 that a copy is inserted on NXJ-22 chromosomes (derives from Actinosynnema bacterium ATCC 31565）, strengthen asm10 transcriptional level, compared with control strain（Empty vectors integration bacterial strain）More than 173% is improved, ultimate output Reach 141.8mg/L, the fermentation yield of ansamitocin is remarkably improved by the present invention.
Brief description of the drawings
Fig. 1 is asm10 gene duplication plasmid construction schematic diagrames；
Fig. 2 is asm10 gene overexpressions mutant strain and control strain transcriptional level contrast schematic diagram；
Fig. 3 is asm10 gene duplications mutant strain and control strain ansamitocin fermentation yield schematic diagram.
Embodiment
Following instance will the invention will be further described with reference to accompanying drawing.Although it following present the implementation that the present invention optimizes Mode and process, but protection scope of the present invention is not limited to following embodiments.Unreceipted actual conditions in the following example Experimental method, according to normal condition or the suggestion condition of manufacturer.
Embodiment 1
The present embodiment is the detailed process for the mutant strain for preparing gene asm10 overexpressions.Specifically include following steps：
Step 1）, structure plasmid pLQ586：Using the genomic DNAs of Actinosynnema bacterium ATCC 31565 as template, using drawing Thing asm10-F/R, expand to obtain asm10 fragments by PCR（885 bp）, SpeI/EcoRI digestions position is introduced at sequence both ends Point, and RBS sequences are inserted before initiation codon（ATCTGAGTTGAAGAGGTGACGTC）.In plasmid pDR3-K* SpeI/ EcoRI sites insertion asm10 (SpeI/EcoRI)), obtain plasmid pLQ586.
* each endonuclease recognized site of the present invention（Restriction enzyme site）It is as follows：
Primer sequence used in step 1) is：
* step 1）PCR system and condition used by prepared by middle genetic fragment：
PCR reaction systems：The ng of DNA profiling 30, primer 30 pmol, 50%DMSO 3 mL, 25 mM Mg2+2 mL, buffer solution 3 1 unit of mL, KOD polymerase, adds pure water polishing to 30 mL；
PCR conditions：95℃ 5 min；95℃ 30 s；60℃ 30 s；68℃ 2 min；Circulation 30 times；68℃ 10 min.
Step 2）, by step 1）Build obtained overexpression（Gene duplication）Plasmid vector pLQ586 led by engaging transfer Enter and homologous recombination is carried out in recipient bacterium NXJ-22, and correct joint element is screened by PCR checkings, so as to obtain asm10 genes Double（Overexpression）Mutant strain.Specifically include following steps：
The plasmid pLQ586 conversions of gene asm10 overexpressions are entered into host ET12567（Contain pUZ8002 plasmids）In.Take In the LB containing tri- kinds of antibiotic of Apr, Kan and Chl, 37 °C are incubated overnight ET12567, with identical culture medium, will stay overnight Culture is transferred once in 10% ratio and cultivates 2.5 h, then rinses thalline with fresh LB solution to remove in culture Antibiotic.Mutant strain NXJ-22 fresh mycelia is prepared simultaneously（About 16 h cultures）, taken second place with LB solution rinsing 2 ~ 3 Afterwards, it mixes to (ratio of mycelial cell and Host Strains is about 1 with the Host Strains ET12567 prepared before：10) after uniformly The YMG flat boards containing 10mM magnesium ions are coated on, are taken out after 37 °C of h of culture carton upside down culture 12 are transferred to after flat board drying Flat board, take each 40mL of storing liquid of two kinds of antibiotic of apramycin and nalidixic acid to add in 1.5 mL sterilized waters respectively and mix After be covered on YMG flat boards, be transferred to after flat board is dried in 30 °C of incubators be inverted culture.Visible flat board after general 3 ~ 5 d On there is single bacterium colony joint element to grow, it is coated on containing two kinds of antibiotic of apramycin and nalidixic acid by flat board YMG flat boards expand culture, and the mutant strain of asm10 gene duplications is obtained by mycelium PCR checking screenings.
* step 2）In pass through PCR checking screening when used PCR system and condition：
PCR system：The ng of DNA profiling 10 ~ 100, primer 30 pmol, 50%DMSO 3 mL, the mL of buffer solution 3, Taq polymerase 0.5 Individual unit, add pure water polishing to 30 mL；
PCR conditions：95℃ 5 min；95 DEG C 30 seconds；58℃ 30 s；72℃ 1 min；Circulation 30 times；72℃ 10 min.
Embodiment 2
The present embodiment is the fermentation process by the mutant strain biosynthesis ansamitocin of gene asm10 overexpressions.Specific step It is rapid as follows：The bacterial strain of asm10 overexpressions is coated on solid YMG culture mediums and activated, after 30 DEG C of 2 d of culture, picking is a small amount of Mycelium is seeded in primary-seed medium, 30 DEG C, cultivate 24 h under the conditions of 220 r/min；Two are forwarded to by 4% inoculum concentration In level seed culture medium, 30 DEG C, cultivate 24 h under the conditions of 220 r/min；Fermentation medium is forwarded to by 10% inoculum concentration, 25 DEG C, zymotic fluid collected after 7 d that ferment under the conditions of 220 r/min extracted and compound test.
The composition of the seed culture medium of table 1 and fermentation medium is formed
Embodiment 3
The present embodiment is to determine the method that gene transcription level is doubled in gene duplication bacterial strain by quantitative fluorescent PCR.（For The sample of RNA extractions is typically all stored in Redzol solution.RNA extraction process requires low temperature, and centrifugal process removes specified otherwise, Carried out under conditions of 4 °C, 12000 r/min.）
Concretely comprise the following steps：Take the mL of sample 500 of break process to add 100mL chloroforms vortex oscillation to mix, centrifuge 15 min Aspirate supernatant afterwards, add 100 mL absolute ethyl alcohols and suck the sample into centrifugal column after mixing（Beijing SBS Genetech gene technology has Limit company）In, 2 min are stood, 1 min is centrifuged, abandons liquid, use rinsing liquid（Washing Buffer, Beijing SBS Genetech gene skill Art Co., Ltd) rinse twice, liquid is abandoned, centrifugal column is placed in collecting pipe and continues to centrifuge 2 min.Use new collecting pipe instead, The treated water of 60 mL DEPC is added into centrifugal column, 2 min is centrifuged, RNA sample is eluted from centrifugal column.With The type nucleic acid-protein analysis-e/or determining RNA of Nanodrop 2000 concentration and OD260/280, -80 °C of preservations of RNA sample after extraction. The digestion reaction system of RNA sample can refer to following table preparation：
Reaction system is placed in 37 °C and is incubated after 4 h 65 °C of 10 min of heating after each reaction system addition 5 mL 50 mM EDTA Digestion can be terminated, -80 °C of preservations of the RNA sample digested.RNA just obtains cDNA after reverse transcription, available for follow-up Gene Transcript Analysis.Obtained cDNA is detected using quantitative fluorescent PCR, Fermentas companies can be selected in kit MaximaSYBR Green/ROX q PCR Maxter Mix(2×)。
Determine the primer used during gene transcription level：
Fig. 2 is the fluorescent quantitative PCR result of asm10 gene duplications mutant strain and control strain.As a result mutant strain and control are shown Compare, target gene in mutant strain is doubled transcriptional level contrast control improve about 22 times, illustrate asm10 genes by Successfully double.
Embodiment 4
The present embodiment is the method for the fermentation yield that ansamitocin is detected using HPLC.Specially：Using Agilent company 1200 serial HPLC of Agilent carry out chromatography, and determine the chromatogram under 236 nm using DAD PDADs Absworption peak.
Wherein, HPLC parameters are as follows：
Chromatographic column：Agilent ZORBAX SB-C18, 2.1´150 mm, 3.5 µm；
Flow rate of mobile phase：0.1 mL/min；
Mobile phase：The aqueous solution and HPLC level methanol elution gradients.
Column temperature：Room temperature.
Fig. 3 is that asm10 gene duplications mutant strain and ansamitocin fermentation level detect.As a result the yield pair of mutant strain is shown More than 173% is improved than wild-type strain, ultimate output reaches 141.8 mg/L.
Strains A TCC 31280 involved in the present invention is in document《PAN WenQin, KANG QianJin, WANG Lei, BAI LinQuan* & DENG ZiXin : Asm8, a specific LAL-type activator of 3- amino-5-hydroxybenzoate biosynthesis in ansamitocin production. Science China Life Sciences 2013（7）：601-608》Described in.
Strains A TCC 31565 involved in the present invention is in application publication number CN101103120A application for a patent for invention Disclosed in.
Sequence table
<110>Liaoning swell bio tech ltd
Shanghai Communications University
<120>Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof
<130> 17-0837
<141> 2017-09-25
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 885
<212> DNA
<213>Actinosynnema bacterium asm10 (Actinosynnema pretiosum)
<400> 1
atgagcctcc cagcggactc accaccgccg gggccggtgg agatgcccga cgagagctgg 60
acgtcgctgg gcaacgcggg ggcgcgggcg caggagtccg cgcgggccga ccggttgttc 120
gacgacccgc tggcgcgggc gttcctggac gcggcgggga cggggaaccc gctgctgccc 180
gaccggggtg gcggtgatcc ggggctgctc gggcagatca cggacgtcat cgtggtcaag 240
acggtgttct tcgacgcggt gctggcgcgg gcggcggcgg ccggggtgcg gcaggtggtg 300
ctgctggccg ccgggttgga cgcccgcgcg ttccggctgc cctggcccga gggggtggtg 360
gtgttcgagg tggacctgcc ggacgtgctg gggttcaagg agcgcgtggt gcgggaggtc 420
ggggcggagc cctcgtgcga ccggcgggtc gtcgcggcgg acctgcgctc ggactgggtg 480
gccgcgctgg tcgccgccgg gctggaccgg gaggccccgg tggcctggct ggcggagggc 540
gcgctggggc tgctggacga ggccgggtgc gaggagctga tggcggcggt gctcggggcc 600
tccgcggcgg ggagccggtt cgcgctcgac cacacccacg acgggtggaa ggccggggag 660
gcgctgggcg ggtacctgga ggggaccggg gtctgcttgg ccgacctggt gaaggggggt 720
ccgcgggagc cgggcggggc gtggttggcg cggcacgggt ggcgggtggc ggagtacgac 780
gtcgtggcgg aggcggcacg gcacgggcgg cccgcgccga ccctgttccg ggtgccggag 840
cggcgggcga acgcgacgat cctgttcgag gccgagctgg ggtag 885
<210> 8
<211> 23
<212> DNA
<213>Site (RBS)
<400> 8
atctgagttg aagaggtgac gtc 23
<210> 8
<211> 28
<212> DNA
<213>Primer (asm10-R)
<400> 8
atagaattcc taccccagct cggcctcg 28
<210> 6
<211> 47
<212> DNA
<213>Primer (asm10-F)
<400> 6
ataactagta tctgagttga agaggtgacg tcatgagcct cccagcg 47
<210> 2
<211> 21
<212> DNA
<213>Primer (asm10-RT-F)
<400> 2
tctgcccgag cagccccgga t 21
<210> 3
<211> 20
<212> DNA
<213>Primer (asm10-RT-R)
<400> 3
acgagagctg gacgtcgctg 20
<210> 4
<211> 20
<212> DNA
<213>Primer (hrdB-RT-F)
<400> 4
gttcccccaa ggcgaagaag 20
<210> 5
<211> 20
<212> DNA
<213>Primer (hrdB-RT-R)
<400> 5
gcttggcgtt ctcctcctcg 20

Claims (10)

  1. A kind of 1. high yield ansamitocin bacterial strain for strengthening transcriptional level, it is characterised in that：The N positions transmethylase mistake of the bacterial strain Amount expression.
  2. 2. the high yield ansamitocin bacterial strain of enhancing transcriptional level according to claim 1, it is characterised in that：Bacterial strain is by ATCC Obtained after 31280 overexpressions.
  3. 3. a kind of preparation method for the high yield ansamitocin bacterial strain for strengthening transcriptional level, it is characterised in that comprise the following steps：
    Step 1）, build the integrative plasmid carrier for doubling methyl transferase gene asm10；
    Step 2）, by step 1）It is homologous heavy by being carried out in engagement transfer importing recipient bacterium NXJ-22 to build obtained plasmid vector Group, and the mutant strain of screening-gene overexpression restructuring.
  4. 4. the preparation method of ansamitocin superior strain according to claim 3, it is characterised in that：Step 1）In, plasmid Carrier is recombinated by plasmid pDR3-K* and obtained.
  5. 5. the preparation method of the ansamitocin superior strain according to claim 3 or 4, it is characterised in that：Gene asm10 comes Come from Actinosynnema bacterium ATCC 31565.
  6. 6. the preparation method of high yield ansamitocin bacterial strain according to claim 5, it is characterised in that：Before initiation codon Insert RBS site sequences ATCTGAGTTGAAGAGGTGACGTC.
  7. 7. the preparation method of high yield ansamitocin bacterial strain according to claim 6, it is characterised in that：In step 3), pass through Resistance screening and PCR checkings obtain the mutant strain of overexpression asm10 genes.
  8. 8. the preparation method of Kosé rhzomorph superior strain according to claim 7, it is characterised in that：The structure of plasmid vector By the PCR fragment that asm10 is inserted in the SpeI/EcoRI sites of plasmid（SpeI/EcoRI）.
  9. 9. the method that the ansamitocin superior strain according to claim 3 ~ 8 prepares ansamitocin, it is characterised in that including Following steps：By the mycelium of the asm10 gene overexpression mutant strains after activation in primary-seed medium, 30 DEG C, 220 24 h are cultivated under the conditions of r/min；It is forwarded to by 4% inoculum concentration in secondary seed medium, 30 DEG C, train under 220 r/min rotating speed Support 24 h；It is forwarded to by 10% inoculum concentration in fermentation medium, 25 DEG C, collect hair after 7 d that ferment under 220 r/min rotating speed Zymotic fluid is simultaneously extracted.
  10. 10. the method that ansamitocin superior strain according to claim 9 prepares ansamitocin, it is characterised in that：
    Primary-seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 5w/v%；
    Or secondary seed medium includes TSB 3w/v%, yeast extract 0.5w/v%, sucrose 2.5w/v%, isobutanol 0.05v/v%, isopropanol 0.05v/v%, starch 1w/v%；
    Or fermentation medium includes yeast extract 0.8w/v%, malt extract 1w/v%, sucrose 1.5w/v%, isobutanol 0.5v/v%, isopropanol 1.2v/v%, starch 2.5w/v%, MgCl2 2 mmol/L。
CN201710870997.XA 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof Pending CN107881137A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710870997.XA CN107881137A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710870997.XA CN107881137A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof

Publications (1)

Publication Number Publication Date
CN107881137A true CN107881137A (en) 2018-04-06

Family

ID=61780709

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710870997.XA Pending CN107881137A (en) 2017-09-25 2017-09-25 Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof

Country Status (1)

Country Link
CN (1) CN107881137A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113980982A (en) * 2021-10-18 2022-01-28 上海交通大学 High-yield ansamitocin method for enhancing target protein gene expression in ansamitocin body

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005020883A2 (en) * 2003-05-08 2005-03-10 Immunogen, Inc. Methods for the production of ansamitocins
US20060084141A1 (en) * 2001-11-21 2006-04-20 Floss Heinz G Biosynthetic gene cluster for the maytansinoid antitumor agent ansamitocin
US20090117127A1 (en) * 2006-03-31 2009-05-07 Sabine Gaisser Novel Compounds and Methods for Their Production
CN104059863A (en) * 2014-05-06 2014-09-24 江南大学 Metabolic transformation method for efficiently improving production capacity of corynebacterium crenatum SYPA5-5 L-arginine
CN104357506A (en) * 2014-10-28 2015-02-18 上海交通大学 Method for improving fermentation level of salinomycin by increasing supply of precursors

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060084141A1 (en) * 2001-11-21 2006-04-20 Floss Heinz G Biosynthetic gene cluster for the maytansinoid antitumor agent ansamitocin
WO2005020883A2 (en) * 2003-05-08 2005-03-10 Immunogen, Inc. Methods for the production of ansamitocins
US20090117127A1 (en) * 2006-03-31 2009-05-07 Sabine Gaisser Novel Compounds and Methods for Their Production
CN104059863A (en) * 2014-05-06 2014-09-24 江南大学 Metabolic transformation method for efficiently improving production capacity of corynebacterium crenatum SYPA5-5 L-arginine
CN104357506A (en) * 2014-10-28 2015-02-18 上海交通大学 Method for improving fermentation level of salinomycin by increasing supply of precursors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
XINJUAN NING等: "Identification and Engineering of Post-PKS Modification Bottlenecks for Ansamitocin P-3 Titer Improvement in Actinosynnema pretiosum subsp. pretiosum ATCC 31280" *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113980982A (en) * 2021-10-18 2022-01-28 上海交通大学 High-yield ansamitocin method for enhancing target protein gene expression in ansamitocin body
CN113980982B (en) * 2021-10-18 2024-02-06 上海交通大学 High-yield ansamitocin method for enhancing expression of ansamitocin in-vivo target protein gene

Similar Documents

Publication Publication Date Title
CN102181470B (en) Method for improving yield of Streptomyces antibiotics and plasmid thereof
CN109486848B (en) Construction method and application of spinosyn-containing multi-operon artificial gene cluster plasmid
CN104357506B (en) Increase method of the precursor supply to improve salinomycin fermentation level
CN101802168B (en) Method for production of non-natural antibiotic
CN105176899B (en) Method for constructing recombinant bacteria for producing or highly producing target gene products, constructed recombinant bacteria and application
CN112899210B (en) Method for improving validamycin fermentation level by enhancing positive regulatory protein gene expression
CN103215282B (en) The biological synthesis gene cluster of cross-country statin and application thereof
CN107881137A (en) Strengthen high yield ansamitocin bacterial strain of transcriptional level and preparation method thereof
CN102703495A (en) Method for improving yield of streptomycete antibiotic and plasmid thereof
CN110563783B (en) High-efficiency low-toxicity tetramycin B derivative and directed high-yield metabolic engineering method thereof
CN102719388A (en) Method for improving yield of streptomyces antibiotics and plasmids thereof
CN101892186B (en) Genetic engineering bacterium of streptomyces coeruleorubidus for producing epidaunorubicin and preparation method thereof
CN107881139A (en) Strengthen high yield ansamitocin bacterial strain of polyketide synthase gene transcriptional level and preparation method thereof
CN101892185B (en) Genetically engineered strain of streptomyces coeruleorubidus producing epi-daunorubicin and preparing method thereof
CN106191156B (en) The method for improving Ge Erdeng element fermentation level
CN112410353B (en) fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene
CN106754986A (en) Creatmycin biological synthesis gene cluster and its application
CN106222191B (en) Knock out method of the central carbon metabolism gene to improve Ge Erdeng element fermentation level
CN104388491B (en) The method for improving salinomycin fermentation level
CN107541481B (en) Genetic engineering bacterium for producing epirubicin and application thereof
CN107541535B (en) Fermentation medium and method for producing epirubicin
CN104059892A (en) Daunorubicin C-14 hydroxylase mutant and production method of genetically engineered bacteria thereof
CN113980982B (en) High-yield ansamitocin method for enhancing expression of ansamitocin in-vivo target protein gene
CN111349647B (en) CRISPR/Cas 9-mediated microbial secondary metabolite enhanced initiation system for additional endogenous RBS
CN107881138A (en) Interrupt high yield ansamitocin bacterial strain of missing and preparation method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination