CN104059892A - Daunorubicin C-14 hydroxylase mutant and production method of genetically engineered bacteria thereof - Google Patents

Abstract

The invention provides a daunorubicin C-14 hydroxylase mutant and a production method of genetically engineered bacteria thereof. In a C-14 hydroxylase sequence coded by genes of the daunorubicin C-14 hydroxylase mutant, the glutamic acid at the 121 position is mutated into valine; through directed evolution technology, a target gene is subjected to random mutation, and a C-14 hydroxylase mutant with improved enzyme activity is obtained through a high-throughput screening method; the safety is better, the production rate is higher, and the method is environment-friendly.

Description

The production method of daunorubicin C-14 hydroxylase mutant and genetic engineering bacterium thereof

Technical field

The present invention relates to biotech medicine product technical field, particularly the production method of a kind of daunorubicin C-14 hydroxylase mutant and genetic engineering bacterium thereof.

Background technology

Anthracycline antibiotics (Anthracyclines) is the important antitumor drug of a class, and they are formed by connecting by the glycosidic link sugar different with one or more by the chromophoric group of anthracene nucleus ketone.Anthracycline antibiotics is mainly because the difference of following structural changes is distinguished: the aglucon on anthracene nucleus is different; Quantity, kind and the difference that puts in order of sugar; The position of glycosidic link is different with stereochemical structure.The microbiotic of most of anthracyclines has very strong bone marrow depression and cardiac toxic and can not be applied to clinical, only have daunorubicin-Zorubicin type anthracycline antibiotics to become the antitumor drug that has clinically using value most, comprise daunorubicin, Zorubicin, pidorubicin, carminomycin etc.

Daunorubicin (Daunorubicin, DNR) and Zorubicin (Doxorubicin) difference in chemical structure is that Zorubicin C-14 position is hydroxyl, and structural representation is as shown in Figure of description 1, accompanying drawing 2.On clinical therapeutic efficacy, Zorubicin is compared with daunorubicin, and the curative effect of same dose is stronger, and toxic side effect is lower, and without crossing drug resistant, antitumor spectrum is wider than daunorubicin, has higher using value, becomes one of current most widely used antitumor drug.

Zorubicin is the C-14 position hydroxylation product of daunorubicin, although find that very early the steel gray mutation of ripple match streptomycete can produce micro-Zorubicin, so far not for suitability for industrialized production.

Current industrial production Zorubicin is mainly used molecular design method, obtains Zorubicin: first, from taking the daunorubicin of microorganisms, with brominated methylene dichloride, carry out chlorination through seven step reactions; In order to prevent C-7 position sugar chain break, add triethyl orthoformate; Then under 10 ℃ of environment, react; Gained reactant is de-ketal at room temperature; Obtain bromination daunorubicin, then carry out conversion reaction, under acidic conditions, add sodium formiate; Then under 40 ℃ of environment, react, first form daunorubicin methyl esters, be then hydrolyzed into gradually Zorubicin, now add dehydrated alcohol to precipitate, until obtain Zorubicin crude product; This crude product is refined purifying with Microcrystalline Cellulose again, by the fibre columns of having adsorbed Zorubicin, with methylene dichloride-Methanol-water, be that developping agent carries out partition chromatography, effluent liquid after chromatography extracts the aqueous solution under acidic conditions, finally under neutrallty condition, again by aqueous solution extracting in methylene dichloride, through dehydration and concentrating under reduced pressure step, finally obtain Zorubicin highly finished product, the product of gained reaches 21 editions reference materials of < < American Pharmacopeia > > (USP/NF).

In actual production process, above-mentioned flow process total recovery is counted and is generally 30% left and right from daunorubicin, so chemical synthesis exists yield shortcoming on the low side.And in rear extractive process, need to consume a large amount of organic solvents or use virose halogen, not only causing production cost to improve, being also easy to cause the environmental pollution of periphery.

Enzyme process and microbe transformation method and metabolic engineering biosynthetic pathway direct fermentation, be considered to two kinds of main method of Biological preparation doxorubicin hydrochloride.The former is actually conversion process in a kind of organism, in thalline fermenting process, adding may be as the compound of precursor or substrate, utilize the genes involved and the catalyst system thereof that in organism, exist, carry out utilization and the conversion of substrate or precursor, and then reach the generation effect of target product; As another method, metabolic engineering biosynthetic pathway, is to utilize genetically engineered or Protocols in Molecular Biology, conventionally by changing, participates in the genes involved of reaction and express the enzyme producing in organism, biological passway of metabolism is changed, reach the object of producing required chemical substance.In above-mentioned two kinds of methods, genes encoding daunorubicin C-14 hydroxylase (DoxA) and corresponding C-14 hydroxylase thereof are prepared the important participant of Zorubicin reaction as catalysis, paid close attention to widely.

Yet, although the research of current prior art separation from several microorganisms has obtained doxA gene, but the functional expression of gene, such as: the high efficient expression of the acquisition of the doxA mutant that high enzyme is lived, stable C-14 hydroxylase etc., the still primary stage in research.

Summary of the invention

Therefore; the novel process of research enzyme process and microbial transformation and biosynthesizing direct production Zorubicin, will be technical progress and eco-friendly only way, not only can significantly improve the production efficiency of Zorubicin; and compare to traditional process for extracting, can greatly protection of the environment.

For existing production Zorubicin, mainly use molecular design method; and cause above-mentioned defect and the problem of the low and contaminate environment of productivity; the object of the embodiment of the present invention is to provide that a kind of security is better, productivity is higher and the daunorubicin C-14 hydroxylase mutant of protection of the environment and the production method of genetic engineering bacterium thereof; by orthogenesis technology; goal gene is carried out to random mutation; and use high-throughout screening method, obtain the C-14 hydroxylase enzyme mutant that enzyme activity improves.

In order to achieve the above object, the embodiment of the present invention provides following technical scheme:

A daunorubicin C-14 hydroxylase mutant, is characterized in that, in the C-14 hydroxylase sequence of the genes encoding of daunorubicin C-14 hydroxylase mutant, the L-glutamic acid of the 121st sports α-amino-isovaleric acid.

A daunorubicin C-14 hydroxylase mutant, is characterized in that, in the DNA sequence dna of daunorubicin C-14 hydroxylase mutant, the GAG of 361-363bp sports GTG.

A daunorubicin C-14 hydroxylase mutant, is characterized in that, in the C-14 hydroxylase sequence of the genes encoding of the recombinant expression plasmid of daunorubicin C-14 hydroxylase mutant, the L-glutamic acid of the 121st sports α-amino-isovaleric acid.

The present invention also provides a kind of genetic engineering bacterium of daunorubicin C-14 hydroxylase mutant simultaneously, it is characterized in that, described genetic engineering bacterium is that the recombinant expression plasmid by daunorubicin C-14 hydroxylase mutant is transformed into host cell and obtains.

As technique scheme preferably, the host cell of the genetic engineering bacterium of described daunorubicin C-14 hydroxylase mutant is intestinal bacteria.

As technique scheme preferably, the DNA sequence dna of described daunorubicin C-14 hydroxylase mutant is cloned into host cell, and the production for Zorubicin by the fermentation thalline of this host cell.

As technique scheme preferably, described daunorubicin C-14 hydroxylase mutant, its genetic engineering bacterium, its recombinant expression plasmid and encoding gene thereof all can be applied in during Zorubicin, pidorubicin produce.

The present invention provides a kind of production method of daunorubicin C-14 hydroxylase mutant gene engineering bacteria simultaneously, comprises the following steps:

Q1: the gene clone method of the C-14 '-hydroxylase gene of bacterium streptomycete C5, comprises step by step following:

Q11:PCR amplification:

Q111: design pair of primers:

5 '-CTGGATCCATGGGCGGTGGGCGGTCC-3 ' and

5’-ATAAGCTTCACGGGGCCGGCTTCTCG-3’;

Q112: the streptomycete C5 thalline of take is template, design pcr amplification primer, carries out pcr amplification, and PCR system is: 2 μ l PCR buffer, the MgCl of 25mMol/L ₂1 μ l, the dNTP1.5 μ l of 2.5m Mol/L, gets two primers in the above-mentioned Q111 step of 1 μ l, and a small amount of streptomycete C5 of toothpick picking thalline is as template, the Taq enzyme of 2 units, dimethyl sulfoxide (DMSO) 1 μ l, finally complements to 20 μ l with sterilized water;

Q113: after sex change 10min, keep sex change 30s in 94 ℃ of environment in 94 ℃ of environment, the 30s that then anneals in 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q114: above-mentioned Q13 step is carried out 30 circulations altogether fully extends 10min subsequently in 72 ℃ of environment;

Q12: the escherichia coli plasmid containing doxA gene builds

Q121:, it is the Nucleotide electrophoresis of 100 volts that the material after first in 1% sepharose, Q1 step pcr amplification being finished is used voltage;

Q122: after rubber tapping, reclaim with glue the DNA fragmentation that test kit reclaims 1400bp left and right, obtained DNA fragmentation and carrier pTrc99A are carried out to double digestion by restriction enzyme BamH I and Hind III;

Q123: enzyme is cut product, and again to carry out voltage be the Nucleotide electrophoresis of 100 volts, reclaim gene fragment and carrier that corresponding size is respectively 900bp, 4100bp left and right, after finally carrier and fragment being mixed in the ratio of 1:3, add the T4 ligase enzyme of 1 unit, 16 ℃ connect more than 10 hours;

Q2: the random mutation to doxA gene

Q21: get primer pair:

5 '-AGCCTGAATCACTTCCGAATTCA-3 ' and

5’-TTCATTGGACCTAATACCGATCA-3’；

Q22: get fallibility PCR reaction system 50 μ l, contain material is: the escherichia coli plasmid containing doxA gene after the Q1 step of 20ng completes, the pair of primers in the Q21 step of each 30pmol, 7mMol/LMgCl ₂, 50mMol/L KCl, 10mMol/L Tris-HCl, 0.2mMol/L dGTP, 0.2mMol/LdATP, 1mMol/L dCTP, 1mMol/L dTTP, 0.05mMol/L MnC1 ₂, and the Taq enzyme of 5 enzyme activity units;

Q23: PCR reaction conditions is set is: under 94 ℃ of environment after sex change 10min, then keep 94 ℃ of sex change 30s, the 30s that then anneals under 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q24: Q23 step is repeated to 30 circulations, then fully extend 10min under 72 ℃ of environment;

Q25: use 1% sepharose, carry out voltage and be the Nucleotide electrophoresis of 100 volts, after rubber tapping, reclaim with glue the DNA object fragment that test kit reclaims 1400bp left and right;

Q26: using and reclaim DNA fragmentation after purifying in Q25 step as primer, the escherichia coli plasmid containing doxA gene after Q1 step completes, as masterplate, carries out pcr amplification, specific as follows:

Q261: getting reaction system material proportioning is: the DNA profiling of 20ng, this template is the recombination bacillus coli plasmid after Q1 step completes; Primer 10 μ l, primer is in Q25 step, to reclaim the DNA fragmentation after purifying; 2.5mM dNTP8 μ l, and the KOD polysaccharase of 2 enzyme activity units;

Q262: PCR reaction conditions is set is: in 95 ℃ of environment after sex change 8min, sex change 45s in keeping 95 ℃ of environment, the 45s that then anneals in 58 ℃ of environment extends 5.5min subsequently in 68 ℃ of environment;

Q263:Q262 step repeats 25 circulations altogether, finally in keeping 68 ℃ of environment, fully extends 10min;

Q264: final PCR product, digests after 1 hour with Dpn I enzyme in 37 ℃ of environment, and 10min processes and makes Dpn I enzyme deactivation in 65 ℃ of environment, obtains surpassing 6 * 103 clones' mutant library;

Q3: the screening of mutant library:

Q31: mutant transforms: the mutant that after step Q2 being completed by electric-shocking method, structure obtains is transformed in competent cell E.coli DH10B;

Q32: the competent cell E.coli DH10B cell completing after Q31 step transforms is coated containing on the antibiotic LB flat board of ammonia benzyl, cultivated in 37 ℃ of environment; On described LB flat board, also contain in addition peptone 1%, yeast extract 0.5%, sodium-chlor 1%, agar 2%;

Q33: screening mutant and evaluation:

Q331: the thalline growing on picking LB flat board is transferred in liquid LB test tube, in 37 ℃ of culture environment, be placed in the shaking table incubated overnight of 220 revs/min, second day is transferred in the 250ml shaking flask of loading amount 50ml LB substratum, after 3 hours, thalline is carried out to 1mMIPTG induction, continue to cultivate after 18h, the speed of 4000 revs/min, after centrifugal 15 minutes, is collected thalline;

Q332: the thalline of collecting is carried out dissolve 0.2g daunorubicin in the 0.1M phosphoric acid buffer of the conversion of daunorubicin: 2ml, the above-mentioned thalline that adds equivalent, in 37 ℃ of water-baths, shake with the speed of 200 revs/min, continue after 30 minutes, measure the increasing amount of Farmorubine Hydrochloride;

Q34: from completing above-mentioned mutant gene engineering bacteria storehouse in steps, screening obtains the mutant gene engineering bacteria that enzyme activity is improved.

The DNA sequence dna of the daunorubicin C-14 hydroxylase mutant that the embodiment of the present invention produces is:

atgagcggcgaggcgccgcgggtggccgtcgacccgttctcgtgtcccatgatgaccatgcagcgcaaacccgaggtgcacgacgcattccgagaggcgggccccgtcgtcgaggtgaacgcccccgcgggcggacccgcctgggtcatcaccgatgacgccctcgcccgcgaggtgctggccgatccccggttcgtgaaggaccccgatctcgcgcccaccgcctggcggggggtggacgacggtctcgacatccccgttccggagctgcgtccgttcacgctcatcgccgtggacggtgaggaccaccggcgtctgcgccgcatccacgcaccggcgttcaacccgcgccggctggccgtgcggacggatcgcatcgccgccatcgccgaccggctgctcaccgaactcgccgactcctccgaccggtcgggcgaaccggccgagctgatcggcggcttcgcgtaccacttcccgctgttggtcatctgcgaactgctcggcgtgccggtcaccgatccggcaatggcccgcgaggccgtcggcgtgctcaaggcactcggcctcggcggcccgcagagcgccggcggtgacggcacggaccctgccggggacgtgccggacacgtcggcgctggagagccttctcctcgaagccgtgcacgcggcccggcggaaagacacccggaccatgacccgcgtgctctatgaacgcgcacaggcagagttcggctcggtctccgacgaccagctcgtctacatgatcaccggactcatcttcgccggccacgacaccaccggctcgttcctgggcttcctgcttgcggaggtcctggcgggccgtctcgcggcggacgccgacggggacgccatctcccggttcgtggaggaggcgctgcgccaccacccgccggtgccctacacgttgtggaggttcgctgccacggaggtggtcatccgcggtgtccggctgccccgcggagcgccggtactggtggacatcgagggcaccaacaccgacggccgccatcacgacgccccgcacgctttccacccggaccgcccttcgaggcggcggctcaccttcggcgacgggccgcactactgcatcggggagcagctcgcccagctggaatcgcgcacgatgatcggcgtactgcgcagcaggttcccccaagcccgactggccgtgccgtacgaggagttgcggtggtgcaggaagggggcccagacagcgcggct cactgacctgcccgtctggctgcgttga

The embodiment of the present invention is used fallibility round pcr, using and derive from C-14 '-hydroxylase gene that daunorubicin produces bacterium streptomycete C5 (Streptomyces sp.C5) as the gene that sets out, carry out random mutation, the mutator gene that random mutation is obtained is expressed in universal support, obtain mutant enzyme, carry out enzyme activity determination, compare with the wild-type enzyme work of not sudden change, through BamH I and Hind III double digestion and DNA sequencing checking, prove that clone's gene order is entirely true; The mutant that enzyme work is improved, as candidate target, carries out repeatedly parallel verified, and screening has obtained a mutant E121V that recombinant protein thermostability improves, described mutant is compared with wild-type enzyme, under the same terms, enzyme is lived and is improved more than 30%, is significantly improved.

Accompanying drawing explanation

In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, to the accompanying drawing of required use in embodiment or description of the Prior Art be briefly described below, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skills, do not paying under the prerequisite of creative work, can also obtain according to these accompanying drawings other accompanying drawing.

Fig. 1 is the structural representation of daunorubicin in prior art of the present invention;

Fig. 2 is the structural representation of doxorubicin hydrochloride in prior art of the present invention;

Fig. 3 is that to use voltage be the Nucleotide electrophorogram of 100 volts to the material after Q1 step pcr amplification being finished in the embodiment of the present invention.

Preservation information

Claimed daunorubicin C-14 hydroxylase mutant involved in the present invention, its preservation information is:

Preservation address: Hubei China province wuchang, wuhan Luo Jia Shan Wuhan University Life Science College

Depositary institution: Chinese Typical Representative culture collection center

Classification And Nomenclature:

Streptomyces coeruleorubidus ST-2

Streptomyces coeruleorubidus ST-2

Preservation is called for short: CCTCC

Preservation date: 2012.04.22

Preservation center numbering: CCTCC NO.M2012134

embodiment

Below in conjunction with accompanying drawing of the present invention, technical scheme of the present invention is clearly and completely described, obviously, described embodiment is only the present invention's part embodiment, rather than whole embodiment.Embodiment based in the present invention, those of ordinary skills, not making the every other embodiment obtaining under creative work prerequisite, belong to the scope of protection of the invention.

The present invention uses fallibility round pcr, usings and derives from C-14 '-hydroxylase gene that daunorubicin produces bacterium streptomycete C5 (Streptomyces sp.C5) as the gene that sets out, and carries out random mutation.The Genebank number of logging in of the C-14 '-hydroxylase gene of streptomycete C5 is: U50973, by 422 amino acid, formed, and its DNA sequences encoding comprises 1269bp.

The mutator gene that the present invention obtains random mutation is expressed in universal support, obtains mutant enzyme, carries out enzyme activity determination, compares with the wild-type enzyme work of not sudden change.The mutant that enzyme work is improved, as candidate target, carries out repeatedly parallel verified.

The wild-type C-14 '-hydroxylase gene sequence of streptomycete C5 is:

Msgeaprvavdpfscpmmtmqrkpevhdafreagpvvevnapaggpawvitddalarevladprfvkdpdlaptawrgvddgldipvpelrpftliavdgedhrrlrrihapafnprrlaertdriaaiadrllteladssdrsgepaeliggfayhfpllvicellgvpvtdpamareavgvlkalglggpqsaggdgtdpagdvpdtsalesllleavhaarrkdtrtmtrvlyeraqaefgsvsddqlvymitglifaghdttgsflgfllaevlagrlaadadgdaisrfveealrhhppvpytlwrfaatevvirgvrlprgapvlvdiegtntdgrhhdaphafhpdrpsrrrltfgdgphycigeqlaqlesrtmigvlrsrfpqarlavpyeelrwcrkgaqtarltdlpvwlr

The aminoacid sequence of the wild-type C-14 '-hydroxylase gene of streptomycete C5 is:

atgagcggcgaggcgccgcgggtggccgtcgacccgttctcgtgtcccatgatgaccatgcagcgcaaacccgaggtgcacgacgcattccgagaggcgggccccgtcgtcgaggtgaacgcccccgcgggcggacccgcctgggtcatcaccgatgacgccctcgcccgcgaggtgctggccgatccccggttcgtgaaggaccccgatctcgcgcccaccgcctggcggggggtggacgacggtctcgacatccccgttccggagctgcgtccgttcacgctcatcgccgtggacggtgaggaccaccggcgtctgcgccgcatccacgcaccggcgttcaacccgcgccggctggccgagcggacggatcgcatcgccgcc atcgccgaccggctgctcaccgaactcgccgactcctccgaccggtcgggcgaaccggccgagctgatcggcggcttcgcgtaccacttcccgctgttggtcatctgcgaactgctcggcgtgccggtcaccgatccggcaatggcccgcgaggccgtcggcgtgctcaaggcactcggcctcggcggcccgcagagcgccggcggtgacggcacggaccctgccggggacgtgccggacacgtcggcgctggagagccttctcctcgaagccgtgcacgcggcccggcggaaagacacccggaccatgacccgcgtgctctatgaacgcgcacaggcagagttcggctcggtctccgacgaccagctcgtctacatgatcaccggactcatcttcgccggccacgacaccaccggctcgttcctgggcttcctgcttgcggaggtcctggcgggccgtctcgcggcggacgccgacggggacgccatctcccggttcgtggaggaggcgctgcgccaccacccgccggtgccctacacgttgtggaggttcgctgccacggaggtggtcatccgcggtgtccggctgccccgcggagcgccggtactggtggacatcgagggcaccaacaccgacggccgccatcacgacgccccgcacgctttccacccggaccgcccttcgaggcggcggctcaccttcggcgacgggccgcactactgcatcggggagcagctcgcccagctggaatcgcgcacgatgatcggcgtactgcgcagcaggttcccccaagcccgactggccgtgccgtacgaggagttgcggtggtgcaggaagggggcccagacagcgcggctcactgacctgcccgtctggctgcgttga

Embodiment 1

Step Q1: the clone of the C-14 '-hydroxylase gene of streptomycete C5

Q1: the cloning process of the C-14 '-hydroxylase gene of streptomycete C5, comprises step by step following:

Q11:PCR amplification:

Q111: design pair of primers, wherein draw partly BamHI site and the HindIII site for introducing of horizontal line:

5 '-CT gGATCCaTGGGCGGTGGGCGGTCC-3 ' and

5’-AT AAGCTTCACGGGGCCGGCTTCTCG-3’;

Q112: the streptomycete C5 thalline of take is template, design pcr amplification primer, carries out pcr amplification, PCR system is: 2 μ l PCR buffer(are the damping fluid of PCR reaction, and object is to provide an enzyme the suitableeest and urges reaction conditions); The MgCl of 25mMol/L ₂1 μ l, the dNTP1.5 μ l of 2.5m Mol/L, gets two primers in the above-mentioned Q111 step of 1 μ l, the a small amount of streptomycete C5 of toothpick picking thalline is as template, the Taq enzyme of 2 units (purchase of Shanghai sangon company), dimethyl sulfoxide (DMSO) 1 μ l, finally complements to 20 μ l with sterilized water;

Q113: after sex change 10min, keep sex change 30s in 94 ℃ of environment in 94 ℃ of environment, the 30s that then anneals in 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q114: above-mentioned Q13 step is carried out 30 circulations altogether fully extends 10min subsequently in 72 ℃ of environment;

Q12: the escherichia coli plasmid containing doxA gene builds

Q121:, it is the Nucleotide electrophoresis of 100 volts that the material after first in 1% sepharose, Q1 step pcr amplification being finished is used voltage;

Q122: after rubber tapping, with glue, reclaim the DNA fragmentation that test kit (production of Shanghai Hua Shun biotechnology company limited) reclaims 1400bp left and right, this step can be with reference to precious biotech firm (network address: the method that www.takara.com.cn) 2005-2006 products catalogue specification sheets is described, obtained DNA fragmentation and carrier pTrc99A(Invitrogen company are produced, are contained ammonia benzyl mycin resistant gene) by restriction enzyme BamH I and Hind III, carry out double digestion;

Q123: enzyme is cut product, and again to carry out voltage be the Nucleotide electrophoresis of 100 volts, reclaim gene fragment and carrier that corresponding size is respectively 900bp, 4100bp left and right, after finally carrier and fragment being mixed in the ratio of 1:3, add the T4 ligase enzyme of 1 unit, 16 ℃ connect more than 10 hours.

Embodiment 2

Step Q2: the random mutation to doxA gene

Q21: get primer pair:

5 '-AGCCTGAATCACTTCCGAATTCA-3 ' and

5’-TTCATTGGACCTAATACCGATCA-3’；

Q22: get fallibility PCR reaction system 50 μ l, contain material is: the escherichia coli plasmid containing doxA gene after the Q1 step of 20ng completes, the pair of primers in the Q21 step of each 30pmol, 7mMol/LMgCl ₂, 50mMol/L KCl, 10mMol/L Tris-HCl, (pH value is 8.3), 0.2mMol/L dGTP, 0.2mMol/L dATP, 1mMol/L dCTP, 1mMol/L dTTP, 0.05mMol/L MnC1 ₂, and the Taq enzyme of 5 enzyme activity units (Shanghai sangon company);

Q23: PCR reaction conditions is set is: under 94 ℃ of environment after sex change 10min, then keep 94 ℃ of sex change 30s, the 30s that then anneals under 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q24: Q23 step is repeated to 30 circulations, then fully extend 10min under 72 ℃ of environment;

Q25: use 1% sepharose, carry out voltage and be the Nucleotide electrophoresis of 100 volts, after rubber tapping, reclaim with glue the DNA object fragment that test kit (Shanghai Hua Shun biotechnology company limited) reclaims 1400bp left and right;

Q26: using and reclaim DNA fragmentation after purifying in Q25 step as primer, the escherichia coli plasmid containing doxA gene after Q1 step completes, as masterplate, carries out pcr amplification, specific as follows:

Q261: getting reaction system material proportioning is: the DNA profiling of 20ng, this template is the recombination bacillus coli plasmid after Q1 step completes; Primer 10 μ l, primer is in Q25 step, to reclaim the DNA fragmentation after purifying; 2.5mM dNTP8 μ l, and the KOD polysaccharase of 2 enzyme activity units (toyobo company);

Q262: PCR reaction conditions is set is: in 95 ℃ of environment after sex change 8min, sex change 45s in keeping 95 ℃ of environment, the 45s that then anneals in 58 ℃ of environment extends 5.5min subsequently in 68 ℃ of environment;

Q263:Q262 step repeats 25 circulations altogether, finally in keeping 68 ℃ of environment, fully extends 10min;

Q264: final PCR product, digests after 1 hour with Dpn I enzyme in 37 ℃ of environment, and 10min processes and makes Dpn I enzyme deactivation in 65 ℃ of environment, obtains surpassing 6 * 103 clones' mutant library.

Embodiment 3

Q3: the screening of mutant library:

Q31: mutant transforms: the mutant that after step 2 being completed by electric-shocking method, structure obtains is transformed into (Invitrogen company) in competent cell E.coli DH10B;

Q32: the competent cell E.coli DH10B cell completing after Q31 step transforms is coated containing on the antibiotic LB flat board of ammonia benzyl, cultivated in 37 ℃ of environment; On described LB flat board, also contain in addition peptone 1%, yeast extract 0.5%, sodium-chlor 1%, agar 2%;

Q33: screening mutant and evaluation:

Q331: the thalline growing on picking LB flat board is transferred in liquid LB test tube, in 37 ℃ of culture environment, be placed in the shaking table incubated overnight of 220 revs/min, second day is transferred in the 250ml shaking flask of loading amount 50ml LB substratum, after 3 hours, thalline is carried out to 1mMIPTG induction, continue to cultivate after 18h, the speed of 4000 revs/min, after centrifugal 15 minutes, is collected thalline;

Q332: the transformation experiment that the thalline of collecting is carried out to daunorubicin: in the 0.1M phosphoric acid buffer of 2ml, (pH7.0) dissolves 0.2g daunorubicin, the above-mentioned thalline that adds equivalent, in 37 ℃ of water-baths, shake with the speed of 200 revs/min, after lasting 30 minutes, measure the increasing amount of Farmorubine Hydrochloride;

Q34: from completing above-mentioned mutant gene engineering bacteria storehouse in steps, screening obtains the mutant gene engineering bacteria that enzyme activity is improved.

By aforesaid method, inventor's screening has obtained a mutant that recombinant protein thermostability improves, and is designated as E121V.The mutant obtaining is respectively with the difference of the gene that sets out:

The amino acid of the 121st of E121V sports α-amino-isovaleric acid by L-glutamic acid, and accordingly, in its DNA sequences encoding, the GAG of 361-363bp becomes GTG;

Described mutant is compared with wild-type enzyme, and under the same terms, enzyme live to improve more than 30%, is significantly improved, and the data that in this mutant gene engineering bacteria, enzyme and doxA wild-type enzyme are compared are provided in form 2.

Aminoacid sequence and gene order to mutant in said gene engineering bacteria are measured, and find and the gene that sets out, and compare, and have the amino acid of a position that variation has occurred, and change has also occurred corresponding coding DNA, as shown in table 1:

Table 1, the mutant aminoacid sequence and the gene order result of variations that obtain

Numbering	Amino acid position	Amino acid changes	Nucleotide position	Nucleotide changes
					E121L	121	L-glutamic acid → α-amino-isovaleric acid	361-363bp	GAG→GTG

Embodiment 4

This wild-type enzyme being mentioned in the embodiment of the present invention and mutant enzyme enzyme activity comparative approach are:

41. thalline (thick enzyme) preparation

Get respectively the thalline lml of fermentation culture in embodiment 3.3, add and in centrifuge tube l.5m1, carry out centrifugally, abandon supernatant part;

With the sodium phosphate buffer of 0.1mMol/L, pH7.0 carry out resuspended after, in ultrasonic disruption instrument, carry out ultrasonication cell, it is 5 watts that power is set, the ultrasonic time length is 5 seconds, intermittently 15 seconds as a circulation;

Carry out stopping after 15 circulations, by the crude enzyme liquid obtaining at 4 ℃ with the speed of 12000 revs/min, carry out centrifugal 10min, get supernatant part, be placed at 4 ℃ standby;

42. enzymic catalytic reactions

By the crude enzyme liquid obtaining in 41 steps, get in the 400 μ l of daunorubicin substrate that 400 μ l add 0.1g/L, carry out enzymatic reaction;

After above-mentioned steps completes, in the shaking bath of 37 ℃, with the speed of 150 revs/min, vibrate, after reaction 30min, add 10% hydrochloric acid of 800 μ l, with stopped reaction;

43. enzyme assaies

By after 5 times of the described reactant dilutions completing in 42 steps, with the speed of 13000 revs/min, centrifugal 5min, gets supernatant and partly carries out HPLC mensuration.

The method that HPLC measures doxorubicin hydrochloride is as follows:

Chromatographic column: Alltima HP C18,250mm * 4.6mm, 5 μ m

Guard column: Alltech Alltima C18,7.5 * 4.6mm, 5 μ m

Column temperature: room temperature

Flow rate of mobile phase: 2ml/min

Detect wavelength: 254nm

Method: gradient elution

Minute	0	2	4	2	2	2
							%A	75	75	40	40	75	75

Moving phase preparation:

A:2.04g/L potassium dihydrogen phosphate aqueous solution, PH3.0

B: acetonitrile

Preparation A: take 2.04g dipotassium hydrogen phosphate and be dissolved in 990ml pure water, the phosphoric acid with 85% is adjusted PH to 3.0, is settled to 1L, through 0.45 μ m micro-pore-film filtration.

Sample preparation:

Take 0.14g oxalic acid hydrate and 4g fermented product is dissolved in 25ml volumetric flask.The methyl alcohol that adds 10ml heats 1h in 50 ℃ of water-baths.Filter paper filtering.Sample introduction after filtering with microporous membrane.

The preparation of reference substance: the powder that precision takes 35mg is designated as M1, is placed in 100ml volumetric flask, adopts methanol constant volume to 100ml, as mother liquor.

With 2.5 times of methyl alcohol dilutions, sample introduction after 0.2 μ m filtering with microporous membrane.With 10 times of methyl alcohol dilutions, sample introduction after 0.2 μ m filtering with microporous membrane.According to the accurate mass of M1, calculate the content of reference substance solution.Measure each time, the sample introduction number of times of reference substance solution should not be less than twice, and by the most suitable parameter of curve of calculated by peak area.

According to the sample numerical value of measuring, determine the position in typical curve, thereby obtain the absolute figure that working sample enzyme is lived, an enzyme activity unit is defined as per minute and produces the required enzyme amount of 1 micromole's doxorubicin hydrochloride.

44. bacterial enzyme specific activitys

The enzyme simultaneous test alive of above-mentioned steps 43, independently carries out more than 3 times, and the average enzyme activity determination result obtaining is as shown in table 2 below:

The situation comparison alive of the wild-type enzyme that table 2. does not suddenly change and the enzyme of mutant enzyme

Wild-type enzyme (U/ml)	Mutant enzyme (U/ml)
		0.25±0.02	0.38±0.04

From table result, the wild-type C-14 hydroxylase not suddenling change, its enzyme activity is 0.25U/ml, and is 0.38U/ml through the mutant enzyme vigor of sudden change, enzyme activity has improved 52%.Therefore, mutant enzyme is obviously better than wild-type enzyme aspect enzymatic activity.

The DNA sequence dna of the daunorubicin C-14 hydroxylase mutant that the embodiment of the present invention produces is:

atgagcggcgaggcgccgcgggtggccgtcgacccgttctcgtgtcccatgatgaccatgcagcgcaaacccgaggtgcacgacgcattccgagaggcgggccccgtcgtcgaggtgaacgcccccgcgggcggacccgcctgggtcatcaccgatgacgccctcgcccgcgaggtgctggccgatccccggttcgtgaaggaccccgatctcgcgcccaccgcctggcggggggtggacgacggtctcgacatccccgttccggagctgcgtccgttcacgctcatcgccgtggacggtgaggacca ccggcgtctgcgccgcatccacgcaccggcgttcaacccgcgccggctggccg tgcggacggatcgcatcgccgccatcgccgaccggctgctcaccgaactcgccgactcctccgaccggtcgggcgaaccggccgagctgatcggcggcttcgcgtaccacttcccgctgttggtcatctgcgaactgctcggcgtgccggtcaccgatccggcaatggcccgcgaggccgtcggcgtgctcaaggcactcggcctcggcggcccgcagagcgccggcggtgacggcacggaccctgccggggacgtgccggacacgtcggcgctggagagccttctcctcgaagccgtgcacgcggcccggcggaaagacacccggaccatgacccgcgtgctctatgaacgcgcacaggcagagttcggctcggtctccgacgaccagctcgtctacatgatcaccggactcatcttcgccggccacgacaccaccggctcgttcctgggcttcctgcttgcggaggtcctggcgggccgtctcgcggcggacgccgacggggacgccatctcccggttcgtggaggaggcgctgcgccaccacccgccggtgccctacacgttgtggaggttcgctgccacggaggtggtcatccgcggtgtccggctgccccgcggagcgccggtactggtggacatcgagggcaccaacaccgacggccgccatcacgacgccccgcacgctttccacccggaccgcccttcgaggcggcggctcaccttcggcgacgggccgcactactgcatcggggagcagctcgcccagctggaatcgcgcacgatgatcggcgtactgcgcagcaggttcccccaagcccgactggccgtgccgtacgaggagttgcggtggtgcaggaagggggcccagacagcgcggctcactgacctgcccgtctggctgcgttga

From above-mentioned sequence table, DNA sequence dna the 5th row of the daunorubicin C-14 hydroxylase mutant that the embodiment of the present invention produces adds the part that the part of horizontal line is sudden change, from original A, becomes T.

The above; be only the specific embodiment of the present invention, but protection scope of the present invention is not limited to this, is anyly familiar with those skilled in the art in the technical scope that the present invention discloses; can expect easily changing or replacing, within all should being encompassed in protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion by the described protection domain with claim.

Claims (8)

1. a daunorubicin C-14 hydroxylase mutant, is characterized in that, in the C-14 hydroxylase sequence of the genes encoding of daunorubicin C-14 hydroxylase mutant, the L-glutamic acid of the 121st sports α-amino-isovaleric acid.

2. a kind of daunorubicin C-14 hydroxylase mutant according to claim 1, is characterized in that, in the DNA sequence dna of daunorubicin C-14 hydroxylase mutant, the GAG of 361-363bp sports GTG.

3. a kind of daunorubicin C-14 hydroxylase mutant according to claim 1, is characterized in that, in the C-14 hydroxylase sequence of the genes encoding of the recombinant expression plasmid of daunorubicin C-14 hydroxylase mutant, the L-glutamic acid of the 121st sports α-amino-isovaleric acid.

4. a genetic engineering bacterium for daunorubicin C-14 hydroxylase mutant, is characterized in that, described genetic engineering bacterium is that the recombinant expression plasmid by daunorubicin C-14 hydroxylase mutant is transformed into host cell and obtains.

5. the genetic engineering bacterium of a kind of daunorubicin C-14 hydroxylase mutant according to claim 4, is characterized in that, the host cell of the genetic engineering bacterium of described daunorubicin C-14 hydroxylase mutant is intestinal bacteria.

6. a kind of daunorubicin C-14 hydroxylase mutant according to claim 1, is characterized in that, the DNA sequence dna of described daunorubicin C-14 hydroxylase mutant is cloned into host cell, and the production for Zorubicin by the fermentation thalline of this host cell.

7. according to claim 1,2,3,4,5 or 6 arbitrary described a kind of daunorubicin C-14 hydroxylase mutant, it is characterized in that, described daunorubicin C-14 hydroxylase mutant, its genetic engineering bacterium, its recombinant expression plasmid and encoding gene thereof all can be applied in Zorubicin, pidorubicin production.

8. a production method for daunorubicin C-14 hydroxylase mutant gene engineering bacteria, comprises the following steps:

Q1: the gene clone method of the C-14 '-hydroxylase gene of bacterium streptomycete C5, comprises step by step following:

Q11:PCR amplification:

Q111: design pair of primers:

5 '-CTGGATCCATGGGCGGTGGGCGGTCC-3 ' and

5’-ATAAGCTTCACGGGGCCGGCTTCTCG-3’;

Q112: the streptomycete C5 thalline of take is template, design pcr amplification primer, carries out pcr amplification, and PCR system is: 2 μ l PCR buffer, the MgCl of 25mMol/L ₂1 μ l, the dNTP1.5 μ l of 2.5m Mol/L, gets two primers in the above-mentioned Q111 step of 1 μ l, and a small amount of streptomycete C5 of toothpick picking thalline is as template, the Taq enzyme of 2 units, dimethyl sulfoxide (DMSO) 1 μ l, finally complements to 20 μ l with sterilized water;

Q113: after sex change 10min, keep sex change 30s in 94 ℃ of environment in 94 ℃ of environment, the 30s that then anneals in 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q114: above-mentioned Q13 step is carried out 30 circulations altogether fully extends 10min subsequently in 72 ℃ of environment;

Q12: the escherichia coli plasmid containing doxA gene builds:

Q121:, it is the Nucleotide electrophoresis of 100 volts that the material after first in 1% sepharose, Q1 step pcr amplification being finished is used voltage;

Q122: after rubber tapping, reclaim with glue the DNA fragmentation that test kit reclaims 1400bp left and right, obtained DNA fragmentation and carrier pTrc99A are carried out to double digestion by restriction enzyme BamH I and Hind III;

Q123: enzyme is cut product, and again to carry out voltage be the Nucleotide electrophoresis of 100 volts, reclaim gene fragment and carrier that corresponding size is respectively 900bp, 4100bp left and right, after finally carrier and fragment being mixed in the ratio of 1:3, add the T4 ligase enzyme of 1 unit, 16 ℃ connect more than 10 hours;

Q2: the random mutation to doxA gene

Q21: get primer pair:

5 '-AGCCTGAATCACTTCCGAATTCA-3 ' and

5’-TTCATTGGACCTAATACCGATCA-3’；

Q22: get fallibility PCR reaction system 50 μ l, contain material is: the escherichia coli plasmid containing doxA gene after the Q1 step of 20ng completes, the pair of primers in the Q21 step of each 30pmol, 7mMol/LMgCl ₂, 50mMol/L KCl, 10mMol/L Tris-HCl, 0.2mMol/L dGTP, 0.2mMol/LdATP, 1mMol/L dCTP, 1mMol/L dTTP, 0.05mMol/L MnC1 ₂, and the Taq enzyme of 5 enzyme activity units;

Q23: PCR reaction conditions is set is: under 94 ℃ of environment after sex change 10min, then keep 94 ℃ of sex change 30s, the 30s that then anneals under 72 ℃ of environment, keeps extending 2min in 72 ℃ of environment;

Q24: Q23 step is repeated to 30 circulations, then fully extend 10min under 72 ℃ of environment;

Q25: use 1% sepharose, carry out voltage and be the Nucleotide electrophoresis of 100 volts, after rubber tapping, reclaim with glue the DNA object fragment that test kit reclaims 1400bp left and right;

Q26: using and reclaim DNA fragmentation after purifying in Q25 step as primer, the escherichia coli plasmid containing doxA gene after Q1 step completes, as masterplate, carries out pcr amplification, specific as follows:

Q261: getting reaction system material proportioning is: the DNA profiling of 20ng, this template is the recombination bacillus coli plasmid after Q1 step completes; Primer 10 μ l, primer is in Q25 step, to reclaim the DNA fragmentation after purifying; 2.5mM dNTP8 μ l, and the KOD polysaccharase of 2 enzyme activity units;

Q262: PCR reaction conditions is set is: in 95 ℃ of environment after sex change 8min, sex change 45s in keeping 95 ℃ of environment, the 45s that then anneals in 58 ℃ of environment extends 5.5min subsequently in 68 ℃ of environment;

Q263:Q262 step repeats 25 circulations altogether, finally in keeping 68 ℃ of environment, fully extends 10min;

Q264: final PCR product, digests after 1 hour with Dpn I enzyme in 37 ℃ of environment, and 10min processes and makes Dpn I enzyme deactivation in 65 ℃ of environment, obtains surpassing 6 * 103 clones' mutant library;

Q3: the screening of mutant library:

Q31: mutant transforms: the mutant that after step Q2 being completed by electric-shocking method, structure obtains is transformed in competent cell E.coli DH10B;

Q32: the competent cell E.coli DH10B cell completing after Q31 step transforms is coated containing on the antibiotic LB flat board of ammonia benzyl, cultivated in 37 ℃ of environment; On described LB flat board, also contain in addition peptone 1%, yeast extract 0.5%, sodium-chlor 1%, agar 2%;

Q33: screening mutant and evaluation:

Q331: the thalline growing on picking LB flat board is transferred in liquid LB test tube, in 37 ℃ of culture environment, be placed in the shaking table incubated overnight of 220 revs/min, second day is transferred in the 250ml shaking flask of loading amount 50ml LB substratum, after 3 hours, thalline is carried out to 1mMIPTG induction, continue to cultivate after 18h, the speed of 4000 revs/min, after centrifugal 15 minutes, is collected thalline;

Q332: the thalline of collecting is carried out dissolve 0.2g daunorubicin in the 0.1M phosphoric acid buffer of the conversion of daunorubicin: 2ml, the above-mentioned thalline that adds equivalent, in 37 ℃ of water-baths, shake with the speed of 200 revs/min, continue after 30 minutes, measure the increasing amount of Farmorubine Hydrochloride;

Q34: from completing above-mentioned mutant gene engineering bacteria storehouse in steps, screening obtains the mutant gene engineering bacteria that enzyme activity is improved.