CN108102964A - A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application - Google Patents
A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application Download PDFInfo
- Publication number
- CN108102964A CN108102964A CN201711483685.XA CN201711483685A CN108102964A CN 108102964 A CN108102964 A CN 108102964A CN 201711483685 A CN201711483685 A CN 201711483685A CN 108102964 A CN108102964 A CN 108102964A
- Authority
- CN
- China
- Prior art keywords
- proline
- bacterial strain
- trans
- gene
- bp4h
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
- C12R2001/085—Bacillus cereus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/24—Proline; Hydroxyproline; Histidine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
- C12Y114/11002—Procollagen-proline dioxygenase (1.14.11.2), i.e. proline-hydroxylase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention provides a kind of trans 4 hydroxyl L proline synthesis bacterial strains, the bacterial strain is bacillus cereus（Bacillus cereus）HBU AI, depositary institution are China Committee for Culture Collection of Microorganisms's common micro-organisms center, and preserving number is CGMCC No.14164, and preservation date is on May 17th, 2017.The present invention also provides the L proline hydroxylase gene orders of above-mentioned bacterial strains, and by the L proline hydroxylases gene be applied to trans 4 hydroxyl L proline production.The result shows that, engineered strain containing the L proline hydroxylase genes has the ability of higher 4 hydroxyl L proline of synthesis of trans, ferment 52 h when, Hydroxyproline concentration is up to 41.6 g/L in zymotic fluid, and the residual concentration of L proline is 0.8 g/L in product.
Description
Technical field
The invention belongs to microorganisms and gene engineering technology field, relate in particular to a kind of trans -4- hydroxyls-L- dried meat ammonia
Acid synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application.
Background technology
Trans-4-hydroxy-l-proline（trans- 4-Hydroxy-L-proline,trans-Hyp）For imino acid,
It is the product after L-PROLINE (L-Pro) hydroxylating, is easy to derivative, pharmacological activity is various, and training southern class available for a new generation resists
The synthesis of a variety of new creating pharmaceuticals such as raw element, antineoplastic, antihypertensive and new stomach medicine.Due to anti-oxidant, anti-spoke
The effect penetrated, the substance also have important application in cosmetic field.
The production method of trans-4-hydroxy-l-proline mainly has biological extraction method and biological enzyme conversion method.Biology
Extraction method was waited mainly using animal collagen as raw material by strong acid hydrolysis, nitrite-oxidizing and ion-exchange resin purification
Prepared by journey, although the method technology maturation, cost of material is high, and recovery rate is low, and " three wastes " discharge capacity is big, seriously polluted.Biology
Enzyme catalysis method utilizes the catalysis characteristics of proline hydroxylase, is obtained instead by microbe conversion as raw material using L-PROLINE or glucose
Formula -4-hydroxy-L-proline.Biotransformation method reaction condition compared with biological extraction method is mild, and low energy consumption, and pollution is small.
At present, the bacterial strain with trans-4-hydroxy-l-proline complex functionality is had been reported, including：Helix poly spore category bacterium
(Clonostachys cylindrospora), streptomycete (Streptomycete), ash slightly red streptomyces P-8648
(Streptomyces griseoviridus), refer to sporangiocyst bacterium (Dactylosporangium sp. strain RH1).From finger
The gene of isolated coding proline hydroxylase (P4Hs) is widely used in Escherichia coli in sporangiocyst bacterium
(Escherichia coli) and corynebacterium glutamicum (Corynebacterium glutamicum) genetic engineering bacterium
Among structure.Such as patent document（Application number 201510899127.6）In disclose it is a kind of for producing trans -4- hydroxyls
The recombinant bacterial strain of base-L-PROLINE, the bacterial strain are by L-PROLINE '-hydroxylase gene（From finger sporangiocyst bacterium）, wild type L- paddy
Histidine kinase gene, L- paddy ammonia phthalein phosphoric acid reduction enzyme genes and resistant gene are cloned on expression vector respectively, recycle RED weights
Group technology is integrated into genome of E.coli and obtains recombinant bacterial strain.The fermentation that the recombinant bacterial strain is applied to hydroxyproline is given birth to
Production, after testing, after the 70h that ferments, the concentration of hydroxyproline is 28.8g/L in zymotic fluid, and the concentration of L-PROLINE is 2.4g/L.By
This is as it can be seen that using existing method（The gene and its recombinant bacterial strain of the coding proline hydroxylase (P4Hs) of originated from fungus）Production
It is less efficient, and the residual quantity of L-PROLINE is higher.Not yet obtaining at present has trans-4-hydroxy-l-proline production capacity
Simple bacterium bacterial strain and new '-hydroxylase gene separation.
The content of the invention
It is an object of the invention to provide a kind of simple bacterial strain with trans-4-hydroxy-l-proline production capacity,
To the problems of existing method.
The second object of the present invention be to provide it is a kind of come from above-mentioned bacterial strains, there is trans-4-hydroxy-l-proline life
The L-PROLINE '-hydroxylase gene of production capacity power, further to overcome existing trans-4-hydroxy-l-proline production method efficiency
The problems such as L-PROLINE residual quantity low, in synthetic product is high.
The third object of the present invention is to provide a kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE
The purposes of '-hydroxylase gene.
An object of the present invention is achieved through the following technical solutions：A kind of trans-4-hydroxy-l-proline synthesis
Bacterial strain, the bacterial strain are bacillus cereus（Bacillus cereus）HBU-AI, depositary institution are protected for Chinese microorganism strain
Administration committee's common micro-organisms center is hidden, preserving number is CGMCC No.14164, and preservation date is on May 17th, 2017.
For the HBU-AI bacterial strains of the present invention by being obtained in air, acquisition methods are as follows：
（1）The L-PROLINE standard aqueous solution of 50 g/L is prepared, and under the conditions of 20 DEG C ~ 30 DEG C, it is open in air to place one
Week.
（2）By solution sterile water gradient dilution to 10-7, it is 10 to choose dilution gradient-3、10-4、10-5Dilution 100
μ L are applied on LB tablets, 30 DEG C of constant temperature incubation 2d.
（3）It is observed that colonial morphology is similar under different dilution factors, picking single bacterium falls within the LB liquid containing L-PROLINE respectively
In body culture medium, 37 DEG C, 200 rpm are cultivated, and after 48 h are centrifuged 2 min, are obtained phase respectively zymotic fluid in 9000 r/min
The supernatant of corresponding bacterium colony.
（4）Detect the L-PROLINE activity of conversion of each bacterium colony：
The 50 μ L of supernatant of corresponding bacterium colony is taken to be added in 1.5 mL centrifuge tubes respectively, 0.125 is added in into centrifuge tube
200 μ L of mol/L sodium tetraborates aqueous solution, 410 μ L of pure water, 320 μ L of acetonitrile, the acetonitrile solution of 0.38 mol/L FMOC-Cl
20 μ L, are placed in after vortex vortex mixer shakes 5 s and stand 10 min, finally cross 0.45 μm of miillpore filter and are analyzed in RP-HPLC.
Liquid-phase condition is as follows：Chromatographic column is Agilent Extend C-18（4.6 mm × 250 mm, 5 μm, Agilent
Company）, mobile phase A be 0.1% trifluoroacetic acid aqueous solution, Mobile phase B be 0.1% trifluoroacetic acid acetonitrile solution, Detection wavelength 263
Nm, 5 μ L of sample size；
Condition of gradient elution is as follows：0–5 min（30% B）, 5-8 min（30%–40% B）, 8-15 min（40% B）, 15-20
min（40%-50% B）, 20-25 min（50% B）, 25-30 min（50%–90% B）, 30-38 min（90% B）, 38-
41min（90%-30% B）, 41-45 min（30% B）.
（5）The higher bacterial strain of activity of conversion is chosen as candidate strain and verifies the activity of conversion of each bacterial strain, L-PROLINE
The detection method of activity of conversion is the same as the（4）Step, testing result are as shown in table 1.
Table 1：
The result shows that：No. 3 bacterial strains obtained from air be one plant can Efficient Conversion L-PROLINE be trans -4- hydroxyls-L-
The bacterial strain of proline, changing effect is as shown in Figure 1, the L-PROLINE of bacterial strain conversion 3g/L generates trans -4- hydroxyls-L- dried meat
The concentration of propylhomoserin is 1.86 g/L, obtains the conversion ratio that this bacterial strain conversion L-PROLINE is trans-4-hydroxy-l-proline and is
62.0 %。
The identification of No. 3 bacterial strains
Thalli morphology observation, physiological and biochemical analysis are carried out to the single bacterium colony with hydroxylase activity of acquisition, and bacterial strain is carried out
16S rDNA sequence analyses.
Strain classification feature is respectively：
2 ~ 3 millimeters of colony diameter, white colony, relatively dry, edge is irregular, and when being cultivated in LB fluid nutrient mediums, thalline exists
It is in short and small straight-bar under light microscope；
When being detected using API50 CH kits, bacterial strain can utilize D-ribose, glucose, fructose, mannose, N- acetyl-glucose
Amine, salicin, maltose, sucrose, trehalose, starch, glycogen, aesculin ferrum citricum.
According to the strain construction phylogenetic tree that the 16 above-mentioned screenings of srDNA sequence pairs obtain, as shown in Fig. 2, utilizing
API50 CH kits carry out API detections to above-mentioned bacterial strains, and most the bacterial strain is accredited as bacillus cereus at lastBacillus Cereus,Number is HBU-AI.Preservation is carried out to the bacterial strain, depositary institution is general for China Committee for Culture Collection of Microorganisms
Logical microorganism center, preserving number are CGMCC No.14164, and preservation date is on May 17th, 2017.
A kind of L-PROLINE '-hydroxylase gene from above-mentioned trans-4-hydroxy-l-proline synthesis bacterial strain, the L-
The nucleotide sequence of proline hydroxylase gene is named as Bp4h as shown in SEQ ID NO.1.
A kind of recombinant vector containing above-mentioned L-PROLINE '-hydroxylase gene.Further, the recombinant vector is above-mentioned
The restructuring of L-PROLINE '-hydroxylase gene, Pidolidone kinase gene and L- glutamyl phosphates reductase gene coexpression carries
Body；Wherein, Pidolidone kinase gene（ProB）With L- glutamyl phosphate reductase genes（ProA）Derive from Escherichia coli
DH5a bacterial strains.
A kind of engineering colon bacillus BL21 by above-mentioned construction of recombinant vector（DE3）.
The construction method of engineering bacteria containing above-mentioned L-PROLINE '-hydroxylase gene, comprises the following steps：
（1）The amplification of L-PROLINE '-hydroxylase gene Bp4h：To L-PROLINE '-hydroxylase gene Bp4h primers pair, F-
Bp4h as shown in SEQ ID NO.2 and R-Bp4h, as shown in SEQ ID NO.3, expands to obtain Bp4h segments using round pcr；
（2）The acquisition of Pidolidone kinase gene ProB and L- glutamyl phosphate reductase gene ProA genes：With Escherichia coli
The genomic DNA of DH5a bacterial strains is template, with primers F-proB, shown in SEQ ID NO.4 and R-proA, such as SEQ ID NO.5
It is shown, it expands to obtain proBA segments using round pcr；
（3）The structure of recombinant bacterial strain：Bp4h segments and proBA segments are building up in expression vector pTRC99a, obtained
Recombinant vector is transformed into e. coli bl21 by pTRC99a-Bp4h-proBA recombinant vectors（DE3）In bacterial strain, and induce its table
It reaches.
A kind of application of above-mentioned L-PROLINE '-hydroxylase gene in trans-4-hydroxy-l-proline is produced.
The beneficial effects of the present invention are：One plant is obtained from air new has synthesis of trans -4- hydroxyl-L- dried meat ammonia
The bacterium bacterial strain of sour ability, and the L-PROLINE '-hydroxylase gene sequence of the bacterial strain is obtained, with existing finger sporangiocyst bacterium
（Dactylosporangiumsp.）P4h gene orders（GeneBank accession number： D78338.1 ）Similitude only has 84%, expands
The big source of '-hydroxylase gene.
Using the L-PROLINE '-hydroxylase gene and L-PROLINE generation gene（ProBA genes）Common structure bifunctional enzyme
Expression vector, and further construct from the engineering large intestine bar that one step Efficient Conversion of glucose is trans-4-hydroxy-l-proline
Bacterium.The engineering colon bacillus is applied to the production of trans-4-hydroxy-l-proline, with the prior art（It ferments after 70h, ferments
The concentration of hydroxyproline is 28.8g/L in liquid, and the concentration of L-PROLINE is 2.4g/L）It compares, production efficiency of the present invention significantly carries
Height, ferment 52 h when, Hydroxyproline concentration is up to 41.6 g/L in zymotic fluid, and the residual concentration of L-PROLINE is 0.8 in product
g/L。
Description of the drawings
When Fig. 1 is verifies bacterial strain HBU-AI activity of conversion of the present invention, the Chromatographic Comparison of fermented and cultured based specimen before and after fermentation
Figure；Wherein, a is L-PROLINE and trans-4-hydroxy-l-proline standard items chromatogram；B is fermentation primary fermentation bouillon-like
Product chromatogram；C is fermentation broth sample chromatogram after fermentation.
Fig. 2 is the phylogenetic tree of bacterial strain HBU-AI of the present invention.
Fig. 3 is the conversion Dynamic Graph that engineering bacteria fermentation of the present invention produces trans-4-hydroxy-l-proline.
Specific embodiment
Below by embodiment, the present invention will be described in detail, and the experimental method used in following embodiments is unless otherwise specified
For conventional method.The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1：
Bacterial strain HBU-AI construction of gene library and extraction '-hydroxylase gene
（1）The genomic DNA of bacillus cereus HBU-AI is extracted, the total DNA of bacterial strain HBU-AI is digested using Sau3AI,
Digestion system is：Restriction endonuclease 2 uL, DNA 1.5 uL, 10 X Buffer 5 uL, 50 uL of total volume, remaining dd H2O is supplied,
37 DEG C, react 60min.
（2）It is connected using BamHI digested vectors pUC19, digestion system is：Restriction endonuclease 1.5 uL of 2 uL, DNA,
10 X Buffer, 5 uL, 50 uL of total volume, remaining dd H2O is supplied, 37 DEG C, reacts 15min.
（3）The DNA fragmentation that digestion obtains is connected with the carrier pUC19 through digestion, connection product electricity transformation receptor bacterium E
.coli DH5a, bacterium colony are coated on the LB tablets containing ampicillin, and 37 DEG C are inverted culture 16-20 h, will be grown
Single bacterium colony be inoculated into 96 orifice plates of the LB fluid nutrient mediums accordingly containing 3 g/L L-PROLINEs, in 37 DEG C culture
The bacterial strain with trans-4-hydroxy-l-proline activity of conversion is checked with chloramine-t method after 24 h.
（4）The bacterial strain that trans-4-hydroxy-l-proline activity of conversion should mutually be had by choosing is transferred to 5 mL LB（Containing 50 mg/
mL Amp）In, 37 DEG C, 200 rpm overnight incubations take broth extraction plasmid, and plasmid is sent to Beijing Hua Da by digestion verification
Sequencing is carried out, used method is sequenced for Sanger methods.It analyses and compares to obtain L-PROLINE hydroxylase through sequence B last
Gene（Bp4h genes）Sequence is as shown in SEQ ID NO.1.
（5）The activity of above-mentioned L-PROLINE '-hydroxylase gene is verified：
Primer pair is designed to the '-hydroxylase gene after sequence verification：F-Bp4h：ATGCTGACCCCGAC（SEQ ID NO.2 institutes
Show）, R-Bp4h：CTAGACGGGCTGGGCCAGCGCGAAG（Shown in SEQ ID NO.3）；Amplification obtains Bp4h segments.Wherein,
PCR reaction systems are：10 X Buffer 5uL, dNTP 1uL, DNA profiling 1uL, primers F 2uL, primer R 2uL, Taq enzyme
0.5uL, ddH2O 38.5uL；Response procedures are：95℃ 3min；95 DEG C of 15s, 56 DEG C of 15s, 72 DEG C of 60s, 35 are followed
Ring；72℃ 5min；The Bp4h segments of amplification with cloning vector PMD19 are connected, obtain PMD19-Bp4h.
PMD19-Bp4h is transferred to escherichia coli DH5a bacterial strain, screens positive transformant, after sequence verification is errorless, extracts matter
Grain, double digestion, the target fragment of recycling and the expression vector pTRC99a phases of similary double digestion are carried out with EcoRI and HindIII
Even, wherein, digestion system is：Plasmid 15uL, 10 X M Buffer 5uL, EcoRI 2uL, HindIII 2uL, ddH2O
26uL, 37 DEG C of digestions are stayed overnight；Linked system is：Target fragment 7uL, carrier 1uL, 10 X Buffer 1uL, T4 ligases
1uL, 16 DEG C of connection 3h, obtains pTRC99a-Bp4h.
PTRC99a-Bp4h is converted to e. coli bl21（DE3）In, SDS-PAGE analyses are carried out after IPTG is induced,
And fermenting experiment is carried out to thalline, the activity that L-PROLINE is converted to it carries out HPLC analyses（Liquid-phase condition is the same as embodiment 1）.
The result shows that：It obtains more than 1000 transformants altogether according to library constructing method, all transformants is subjected to L- dried meat ammonia
Acid activity detects, and finally found that a transformant has trans-4-hydroxy-l-proline activity of conversion, through sequencing analysis, the hydroxyl
Change enzyme gene sequence with referring to sporangiocyst bacterium（Dactylosporangium sp.）P4h gene orders（GeneBank accession number：
D78338.1）Similitude only has 84%.'-hydroxylase gene after sequence verification is cloned into expression vector pTRC99a, conversion is extremely
E. coli bl21（DE3）, have protein expression band, fermented L- dried meat in molecular weight for 30 KDa or so through SDS-PAGE analyses
Propylhomoserin activity verification, the recombination bacillus coli of the hydroxylase sequence construct have the energy of production trans-4-hydroxy-l-proline
Power.
The structure of the engineering colon bacillus of 2 L-PROLINE '-hydroxylase gene of embodiment and ProBA gene co-expressings
（1）The acquisition of ProBA genes
Using the genomic DNA of escherichia coli DH5a bacterial strain as template, with primers F-proB：TATGGTAC
CAACTGCCGCTAGGCTTGCTG（Shown in SEQ ID NO.4）And R-proA：GTAGGATCCCGTCAATGGCCTTGTGAATC
（Shown in SEQ ID NO.5）Amplification obtains proBA genetic fragments；It with cloning vector PMD19 is connected, converts Escherichia coli
DH5a bacterial strains screen positive transformant, are sequenced to verify the correctness of sequence.
（2）Recombinant bacterial strain is built
It is template with foregoing plasmid PMD19-Bp4h, carries out double digestion with EcoRI and BamHI respectively, recycles target fragment；With
EcoRI and BamHI carries out double digestion to expression vector pTRC99a, makes its linearisation, recycles target fragment；By above-mentioned two piece
Section connects 1 h with T4 ligases at 16 DEG C.Connection product converts e. coli strain bl21, screens positive transformant, obtains
pTRC99a-Bp4h（Other conditions are the same as embodiment 2）.
With the operation of similar embodiment 2, using plasmid PMD19-proBA as template, carried out respectively with BamHI and HindIII
Double digestion, the target fragment of recycling；PTRC99a-Bp4h is subjected to double digestion with BamHI and HindIII, recycles target fragment；
Above-mentioned two segment is connected, connection product conversion e. coli strain bl21 screens positive transformant, obtains recombinant bacterial strain.
（3）Recombinant bacterial strain is verified by the activity of one step Synthesis trans-4-hydroxy-l-proline of glucose：
Seed liquor preparation method：The glycerol tube of the bacterial strain frozen is taken out from -80 DEG C of refrigerators, is rule on LB solid mediums, 37 DEG C of trainings
Case culture is supported, picking single bacterium colony is accessed in 20 mL LB liquid, and 37 DEG C of cultures, cultured bacterium solution is as seed liquor.
Shake-flask seed is forwarded to liquid amount as in the 5 L fermentation tanks of 1.5 L using the inoculum concentration of 1vol%, fermentation medium
Ingredient is：20.0 g/L of glucose, 3.0 g/L of dikalium phosphate, 0.5 g/L of sodium chloride, 1.0 g/L of ammonium chloride, ferrous sulfate 0.3
G/L, 5.0 g/L of peptone, 5.0 g/L of yeast extract, ammonia benzyl mycin 0.1g/L.
The cultivation temperature of fermentation tank is set as 28 DEG C, initial to stir 200 r/min, DO automatic controls are in 10-30%（It is closed with rotating speed
Connection）, 1.8 L/min of throughput；The concentration of glucose in fermentation tank is maintained by continuously adding in 20.0 g/L, fermentation process
In sampled per 2h, measure the content of its pH value, thalline OD values, L-PROLINE and hydroxyproline, thalline OD600And dry cell weight
（CDW）Reduction formula it is as follows：OD600 4.24=1 gCDWL-1。
The result shows that：ProBA genes, sequencing knot are obtained by template amplification of the genomic DNA of escherichia coli DH5a bacterial strain
Fruit identification is errorless, and the size of the genetic fragment is 2358bp.'-hydroxylase gene after sequence verification and proBA genes are led to respectively
The mode for crossing digestion connection is connected in expression vector pTRC99a, is converted to e. coli bl21（DE3）.Through SDS-PAGE points
Analyse has the protein band of hydroxylase in molecular weight for 30 KDa or so；Molecular weight for 40 KDa or so have Pidolidone kinases and
The protein band of L-Glutamine phosphate dehydrogenase.
It is verified through 5L ferment tanks glucose activity, as shown in figure 3, the recombination bacillus coli of the hydroxylase sequence construct
Ability with production trans-4-hydroxy-l-proline, and when fermenting 52 h, Hydroxyproline concentration is reachable in zymotic fluid
41.6 g/L, the residual concentration of L-PROLINE is 0.8 g/L.It follows that L-PROLINE '-hydroxylase gene of the present invention（Nucleotide
Sequence is as shown in SEQ ID NO.1）Compared with the '-hydroxylase gene of existing originated from fungus（Refer to sporangiocyst bacterium '-hydroxylase gene）In hydroxyl
There is prominent advantage in proline production application.
SEQUENCE LISTING
<110>University Of Hebei
<120>A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 819
<212> DNA
<213> Bp4h
<400> 1
atgctgaccc cgaccgaacc gaaacagtat cgtgaagcgg gctatctgct gattgaagat 60
ggcctgggcc cgcgtgaagt tgactgcctg cgtcgtgctg ctgctgctct gtacgctcag 120
gactctccgg accgtaccct ggaaaaagac ggtcgtaccg ttcgtgctgt tcacggttgc 180
caccgtcgtg acccggtttg ccgtgacctg gttcgtcacc cgcgtctgct gggtccggct 240
atgcagatcc tgtctggtga cgtttacgtt caccagttca aaatcaacgc taaagctccg 300
atgaccggtg acgtttggcc gtggcaccag gactacatct tctgggctcg tgaagacggt 360
atggaccgtc cgcacgttgt taacgttgct gttctgctgg acgaagctac ccacctgaac 420
ggtccgctgc tgttcgttcc gggtacccac gaactgggtc tgatcgacgt tgaacgtcgt 480
gctccggctg gtgacggtga cgctcagtgg ctgccgcagc tgtctgctga cctggactac 540
gctatcgacg ctgacctgct ggctcgtctg accgctggtc gtggtatcga atctgctacc 600
ggtccggctg gttctatcct gctgttcgac tctcgtatcg ttcacggttc tggtaccaac 660
atgtctccgc acccgcgtgg tgttgttctg gttacctaca accgtaccga caacgctctg 720
ccggctcagg ctgctccgcg tccggaattc ctggctgctc gtgacgctac cccgctggtt 780
ccgctgccgg ctggcttcgc gctggcccag cccgtctag 819
<210> 2
<211> 14
<212> DNA
<213> F-Bp4h
<400> 2
atgctgaccc cgac 14
<210> 3
<211> 25
<212> DNA
<213> R-Bp4h
<400> 3
ctagacgggc tgggccagcg cgaag 25
<210> 4
<211> 29
<212> DNA
<213> F-proB
<400> 4
tatggtacca actgccgcta ggcttgctg 29
<210> 5
<211> 29
<212> DNA
<213> R-proA
<400> 5
gtaggatccc gtcaatggcc ttgtgaatc 29
Claims (7)
1. a kind of trans-4-hydroxy-l-proline synthesizes bacterial strain, it is characterized in that, the bacterial strain is bacillus cereus
（Bacillus cereus）HBU-AI, depositary institution are China Committee for Culture Collection of Microorganisms's common micro-organisms center,
Preserving number is CGMCC No.14164, and preservation date is on May 17th, 2017.
2. a kind of L-PROLINE hydroxylase base from trans-4-hydroxy-l-proline synthesis bacterial strain described in claim 1
Cause, it is characterized in that, the nucleotide sequence of the L-PROLINE '-hydroxylase gene is as shown in SEQ ID NO.1.
3. a kind of recombinant vector of the L-PROLINE '-hydroxylase gene containing described in claim 2.
4. recombinant vector according to claim 3, it is characterized in that, the recombinant vector is the L-PROLINE hydroxylase base
The recombinant vector of cause, Pidolidone kinase gene and L- glutamyl phosphates reductase gene coexpression.
5. a kind of engineering colon bacillus BL21 of construction of recombinant vector as described in claim 3 or 4（DE3）.
6. a kind of construction method of the engineering bacteria of the L-PROLINE '-hydroxylase gene containing described in claim 2, it is characterized in that, bag
Include following steps：
（1）The amplification of L-PROLINE '-hydroxylase gene Bp4h：To L-PROLINE '-hydroxylase gene Bp4h primers pair, F-
Bp4h as shown in SEQ ID NO.2 and R-Bp4h, as shown in SEQ ID NO.3, expands to obtain Bp4h segments using round pcr；
（2）The acquisition of Pidolidone kinase gene ProB and L- glutamyl phosphate reductase gene ProA genes：With Escherichia coli
The genomic DNA of DH5a bacterial strains is template, with primers F-proB, shown in SEQ ID NO.4 and R-proA, such as SEQ ID NO.5
It is shown, it expands to obtain proBA segments using round pcr；
（3）The structure of recombinant bacterial strain：Bp4h segments and proBA segments are building up in expression vector pTRC99a, obtained
Recombinant vector is transformed into e. coli bl21 by pTRC99a-Bp4h-proBA recombinant vectors（DE3）In bacterial strain, and induce its table
It reaches.
7. the L-PROLINE '-hydroxylase gene described in a kind of claim 2 ~ 6 is in trans-4-hydroxy-l-proline is produced
Using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711483685.XA CN108102964B (en) | 2017-12-29 | 2017-12-29 | A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711483685.XA CN108102964B (en) | 2017-12-29 | 2017-12-29 | A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108102964A true CN108102964A (en) | 2018-06-01 |
| CN108102964B CN108102964B (en) | 2019-11-26 |
Family
ID=62214941
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711483685.XA Active CN108102964B (en) | 2017-12-29 | 2017-12-29 | A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108102964B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699168A (en) * | 2021-04-23 | 2021-11-26 | 河北牧群生物科技有限公司 | Gene sequence of PHA (polyhydroxyalkanoate) synthesized by coding HBU-AI (bacillus cereus) and application of gene sequence |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509813A (en) * | 2012-06-20 | 2014-01-15 | 江南大学 | Method for production of L-4-hydroxyproline by using recombinant escherichia coli fermentation |
| CN103146720B (en) * | 2013-03-01 | 2014-12-03 | 河北博伦特药业有限公司 | Trans-4-hydroxy-L-proline hydroxylase modifying gene with high transformation rate and application thereof |
| CN104278047A (en) * | 2013-07-04 | 2015-01-14 | 江南大学 | Method for enhancing activity of trans-4-hydroxyproline biosynthesis system containing recombinant DNA |
| CN105483069A (en) * | 2015-12-09 | 2016-04-13 | 浙江绿创生物科技有限公司 | Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain |
| CN106085931A (en) * | 2016-03-04 | 2016-11-09 | 江苏大成医药科技股份有限公司 | Produce engineering bacteria and the application thereof of trans 4 hydroxyprolines |
-
2017
- 2017-12-29 CN CN201711483685.XA patent/CN108102964B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509813A (en) * | 2012-06-20 | 2014-01-15 | 江南大学 | Method for production of L-4-hydroxyproline by using recombinant escherichia coli fermentation |
| CN103146720B (en) * | 2013-03-01 | 2014-12-03 | 河北博伦特药业有限公司 | Trans-4-hydroxy-L-proline hydroxylase modifying gene with high transformation rate and application thereof |
| CN104278047A (en) * | 2013-07-04 | 2015-01-14 | 江南大学 | Method for enhancing activity of trans-4-hydroxyproline biosynthesis system containing recombinant DNA |
| CN105483069A (en) * | 2015-12-09 | 2016-04-13 | 浙江绿创生物科技有限公司 | Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain |
| CN106085931A (en) * | 2016-03-04 | 2016-11-09 | 江苏大成医药科技股份有限公司 | Produce engineering bacteria and the application thereof of trans 4 hydroxyprolines |
Non-Patent Citations (3)
| Title |
|---|
| TAKESHISHIBASAKI等: "Construction of a novel hydroxyproline-producing recombinant Escherichia coli by introducing a proline 4-hydroxylase gene", 《JOURNAL OF BIOSCIENCE AND BIOENGINEERIN》 * |
| 盛花开等: "重组大肠杆菌多基因串联表达合成反式-4-羟基-L-脯氨酸", 《生物技术》 * |
| 袁春伟等: "重组大肠杆菌BL21(pUC19-Hyp)产羟脯氨酸的补料分批培养", 《生物加工过程》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699168A (en) * | 2021-04-23 | 2021-11-26 | 河北牧群生物科技有限公司 | Gene sequence of PHA (polyhydroxyalkanoate) synthesized by coding HBU-AI (bacillus cereus) and application of gene sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108102964B (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Assawamongkholsiri et al. | Photo-fermentational hydrogen production of Rhodobacter sp. KKU-PS1 isolated from an UASB reactor | |
| RU2460789C2 (en) | New hydrogenase seq id no:5 purified from thermococcus onnurienus na1 with help of carbon monoxide, genes coding it, and methods for producing hydrogen with use of microorganism having said genes | |
| CN103952318B (en) | High yield citric acid waste residue bacterium FY2013 and its application | |
| CN106434483B (en) | A kind of lactobacillus buchneri and its application | |
| CN106191077B (en) | A kind of mibemycin positive regulating gene milR and its it is overexpressed genetic engineering bacterium, preparation method and application | |
| CN102181470B (en) | Method for improving yield of Streptomyces antibiotics and plasmid thereof | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN115820527B (en) | Recombinant halomonas for producing mevalonate and construction method and application thereof | |
| CN106148259A (en) | Produce recombinant bacterium of C4H9NO2 and preparation method and application | |
| CN109897862A (en) | GentamicinB produces bacterium and its preparation method and application | |
| CN102061278B (en) | Methylovorus sp. MP688 and application thereof | |
| Morsy et al. | Dark and photofermentation H2 production from hydrolyzed biomass of the potent extracellular polysaccharides producing cyanobacterium Nostoc commune and intracellular polysaccharide (glycogen) enriched Anabaena variabilis NIES-2095 | |
| CN108102964B (en) | A kind of trans-4-hydroxy-l-proline synthesis bacterial strain and its L-PROLINE '-hydroxylase gene and application | |
| CN109486834A (en) | The Recombinant Lactococcus lactis and construction method of high-yield lactic acid streptostacin | |
| CN105176904B (en) | Engineering strain streptomyces tsukubaensis L21 and its application | |
| CN107805621A (en) | A kind of method using the hydroxyl L proline of Escherichia coli synthesis of trans 4 | |
| CN110106191A (en) | Artificial synthesized Vitreoscilla hemoglobin gene and corresponding engineered strain and application | |
| Liu et al. | A mutation upstream of an ATPase gene significantly increases magnetosome production in Magnetospirillum gryphiswaldense | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain | |
| Xiao et al. | Endophytic fungi from Dongxiang wild rice (Oryza rufipogon Griff.) show diverse catalytic potential for converting glycyrrhizin | |
| CN111041020B (en) | Isocitrate lyase mutant, mutant gene and application thereof in preparation of vitamin B12In (1) | |
| CN103667107A (en) | Enterococcus faecium strain capable of producing L-lactic acid | |
| CN107674839A (en) | A kind of method of Fusarium solani and its fermenting and producing dextranase | |
| CN108359629A (en) | Hydrogenlike silicon ion recombinant bacterium and its construction method and application | |
| CN105586280B (en) | Inositol is for enhancing purposes, the purposes of gene, expression vector of bacterial strain tolerance and application thereof, bacterial strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |