CN116622601A

CN116622601A - Streptomyces strain and application thereof

Info

Publication number: CN116622601A
Application number: CN202310235307.9A
Authority: CN
Inventors: 谢昌贤; 王月清; 陈红梅; 邹洋; 袁慧平; 张春梅; 王志军; 王鹏飞
Original assignee: Jinhe Bio Technology Co ltd
Current assignee: Jinhe Bio Technology Co ltd
Priority date: 2023-03-13
Filing date: 2023-03-13
Publication date: 2023-08-22

Abstract

The application discloses a streptomycete strain which is a streptomycete strain with a knockout of a Geosmin terpene synthase gene and/or a 2-MIB terpene synthase gene and a methyltransferase gene. According to the application, the method realizes de novo treatment of bad smell of fermentation by knocking out the Geomin terpene synthase 2-MIB terpene synthase and methyltransferase genes Geomin terpene synthase genes and/or 2-MIB terpene synthase and methyltransferase genes, obtains the streptomycete strain with mild smell of tail gas in the fermentation process and improved yield of fermentation products, and remarkably reduces the production cost by applying the streptomycete strain to industrial fermentation production of antibiotics.

Description

Streptomyces strain and application thereof

Technical Field

The application belongs to the field of biological fermentation, and particularly relates to a streptomycete strain and application thereof.

Background

The fermentation production of antibiotics by Streptomyces industrial strains is one of the most important methods for the production of antibiotics, and how to increase the yield and reduce the production cost is always the aim pursued in the field. The fermentation process of streptomyces generates a large amount of tail gas with foul smell, and the components are complex, and the biochemical method or the tail gas treatment device is used for treating the tail gas with high energy consumption, so that enterprises need to consume a large amount of cost to treat the fermentation tail gas, and on the basis of the process, a method capable of reducing the fermentation smell and improving the fermentation yield is needed to be searched for so as to reduce the production cost.

Disclosure of Invention

The inventor of the present application surprisingly found that knockout of the Geomin terpene synthase gene and/or the 2-MIB terpene synthase and methyltransferase gene can greatly reduce bad odors in the tail gas of Streptomyces chapensis, thereby greatly reducing the cost required for tail gas treatment, and more unexpectedly, the antibiotic yield of the strain is also significantly improved after knockout of the Geomin terpene synthase gene and/or the 2-MIB terpene synthase and methyltransferase gene, and completed the present application based on the above.

The first aspect of the present application provides a Streptomyces strain which is Streptomyces chapensis (Streptomyces rimosus) in which the Geomin terpene synthase gene and/or the 2-MIB terpene synthase and methyltransferase genes are knocked out; wherein the 2-MIB terpene synthase and methyltransferase genes comprise a 2-MIB terpene synthase gene and a 2-MIB methyltransferase gene.

In a second aspect, the application provides the use of a Streptomyces strain according to the first aspect of the application for industrial fermentation.

In a third aspect, the present application provides a method for industrially producing terramycin, which comprises fermenting terramycin using the Streptomyces strain provided in the first aspect of the present application.

In a fourth aspect, the application provides a method for increasing the production of oxytetracycline and/or reducing off-flavor in industrial production of oxytetracycline comprising fermentatively producing oxytetracycline using a Streptomyces strain of the first aspect of the application.

The application has the beneficial effects that:

according to the application, by knocking out the genes of the Geomin terpene synthase and/or the 2-MIB terpene synthase and the methyltransferase, the bad smell of fermentation is treated from the beginning, the streptomycete strain with mild smell of tail gas in the fermentation process and improved terramycin yield in the fermentation product is obtained, and the streptomycete strain is applied to industrial fermentation production of terramycin, so that the terramycin yield is improved, the malodorous smell of fermentation tail gas generated in the terramycin production process is reduced, the investment of tail gas treatment is reduced, and the production cost is obviously reduced.

And (3) strain preservation:

name: streptomyces chaplet ZY004 or Streptomyces rimosus ZY004

Preservation date: 2022 12 month 30 day

Preservation unit: china Center for Type Culture Collection (CCTCC)

Address: chinese university of Wuhan

Preservation number: CCTCC No. M20222114

And (3) strain preservation:

name: streptomyces chaplet J1-023 or Streptomyces rimosus J1-023

Preservation date: 2022 12 month 30 day

Preservation unit: china Center for Type Culture Collection (CCTCC)

Address: chinese university of Wuhan

Preservation number: CCTCC No. M20222113

Drawings

FIG. 1 is a schematic diagram of the construction flow of pZY-1, pZY-1 and pZY-2 vectors of example 1;

FIG. 2 is a PCR-validated electrophoresis diagram of the knockout Geosmin terpene synthase double-exchanged strain of example 2; the negative control (water), the original strain J1-023 (WT), the single-exchange strain control and the plasmid (pZY-1) positive control are sequentially arranged from left to right, and 10 candidate double-exchange strains are obtained by Marker (M) and double screens;

FIG. 3 is a PCR-validated electrophoresis diagram of the 2-MIB gene knockout double-exchanged strain of example 3; negative control (water), starting strain J1-023 (WT), plasmid (pZY-2) positive control, marker (M) and 9 candidate double-exchanged strains obtained by double screening are sequentially carried out from left to right;

FIG. 4 is a diagram of the transition strain double crossover PCR-verified electrophoresis of the erythromycin resistance gene deleted of example 4; the negative control (-), the original strain J1-023 (WT), the pZY-1 positive plasmid control, the Marker (M) and 7 candidate double-exchanged strains obtained by double screening are sequentially arranged from left to right;

FIG. 5 is a diagram of double-knockout strain double-crossover PCR-verified electrophoresis of example 4; negative control (-), starting strain J1-023 (WT), pZY-2 plasmid positive control, 8 double knockout candidate double-exchanged strains obtained by double screening;

FIGS. 6A and 6B show GC-MS detection results of Geomin and 2-MIB, respectively;

FIG. 7 shows the average terramycin titer results in fermentation products after activation and rejuvenation of single or double knockout strains of examples 2, 3, and 4.

Detailed Description

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described, and it is apparent that the drawings in the description below are only one embodiment of the present application, and other embodiments may be obtained according to these drawings by those skilled in the art.

Definition of the definition

As used herein, the terms "a" and "an" and "the" and similar referents refer to the singular and the plural, unless the context clearly dictates otherwise.

As used herein, the terms "about," "substantially" and "similar to" refer to an acceptable error range for a particular value as determined by one of ordinary skill in the art, which error range may depend in part on the manner in which the value is measured or determined, or on the limitations of the measurement system.

In a first aspect the present application provides a strain of Streptomyces to be modified (Streptomyces rimosus) from which the Geomin terpene synthase gene and/or the 2-MIB terpene synthase and methyltransferase genes have been knocked out, hereinafter also referred to as modified strain. The inventors found that the expression product of a Geosmin terpene synthase gene (also referred to herein simply as a Geosmin gene) is a key enzyme for producing Geosmin (Geosmin), a major source of earthy taste (or soil odor) in soil or water, by streptomyces chapensis; the 2-MIB terpene synthase and methyltransferase genes (also referred to herein simply as 2-MIB genes) include the 2-MIB terpene synthase gene and the 2-MIB methyltransferase gene, the expression products of which are key enzymes for the production of 2-methyl-isotonite (2-MIB) by streptomyces chapensis, wherein 2-MIB is the main source of soil mildew in soil or water. However, the malodorous tail gas of the streptomyces industrial fermentation has complex components, and the proportion of two products of Geosmin and 2-MIB therein or the influence degree on the tail gas smell is not quite clear. The inventors have unexpectedly found that knockout of the genes of the Geomin terpene synthase and/or the 2-MIB terpene synthase and methyltransferase in Streptomyces strains can greatly improve the malodor in the tail gas of Streptomyces fermentation products, and more unexpectedly, the yield of Streptomyces fermentation secondary metabolites, such as antibiotics, can be significantly improved after knockout of the genes of the Geomin terpene synthase and/or the 2-MIB terpene synthase and methyltransferase. Thereby reducing the production cost of producing antibiotics by fermentation of streptomycete.

The gene knockout in the application belongs to the technology of editing gene (group), and means that the expression of the whole gene is eliminated by means of mutation, disruption of the gene reading frame and the like at the genome level. In general, such gene editing changes can be stably inherited to the next generation.

In some embodiments, the Geosmin terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID No. 17; preferably, the Geosmin terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 17.

Geomin terpene synthase gene: GTGGTGGCGGAGCCGTTTGAGTTGCCGGGGTTTTATCTGCCGTACCCGGCTCGGATGAACGCGGGGCTGGAGGAGGCTCGGCGGCATTCCAAGGAGTGGGCTCGGGGGATGGGGATGTTGGAGGGGTCGGGGGTTTGGGGGGAGGGGGATTTGGATGCGCATGATTACGCGTTGTTGTGTGCGTACACCCATCCGGACTGTTCGGCGGATGTGCTGTCGCTGGTGACGGACTGGTATGTGTGGGTGTTCTTTTTCGACGATCATTTCTTGGAGGCGTTCAAGCGGACGCAGGACCGGGTGGGCGGGAAGGCGTATCTGGATCGGCTGCCGTTGTTCATGCCGATGGATCTGGGTACGCCGGTGCCGGAGCCGGCCAATCCGGTGGAGGCGGGGCTGGCGGATCTGTGGGCTCGGACGGTGCCTTCCATGTCGGAAGGGTGGCGGGCCCGGTTCCGGGAGAGTACCGAGCATTTGCTGAATGAGTCGTTGTGGGAGTTGTCCAACATCAATGCCGGGCGGTTGCCCAATCCCGTCGAGTACATCGAGATGCGGCGGAAGGTGGGTGGTGCGCCTTGGTCGGCGGGGCTGGTGGAGTTCGCCGCGCAGGCCGAGGTGCCGGCGGCGGTGGCCGGGGCGCGGCCGTTGCGGGTGCTGAGGGATACGTTCGCGGACGCGGTGCATCTGCGGAACGACGTGTTCTCGTACCAGCGGGAGACCGAGGAGGAGGGGGAACTCAGCAACGGGGTGCTGGTGCTGGAGAATTTTCTGGGGTGTTCGACGCAGGAGGCGGCGGAAGCCGTCAATGATCTGATCACTTCGCGGGTGCAGCAGTTCGAGAACACGGTGATGACGGAACTGCCGGTGCTGTTCGCGGAGAAGGGGCTGAGTCCGCGGGAGTGTGCGGACGTGCTGGCTTACGCCAAGGGGTTGCAGGACTGGCAGGCGGGCGGGCATGAGTGGCACATGCGGTCGAGCCGGTACATGAACGGGGGTGGGGAGGCGGCGGACGCGGGTGCGGGTGCGAGCTGGTCGCCGTTTGTGTTCGGCGGGTTGGGGACTTCCGGGGCGGATGTGCGGAAGGCCGTGGCGGTTACCGGGGCCAAGCGGGTGCGGAACTTCACGCATGTGCCGTATCAGAAGGTGGGGCCTTCACAGCTGCCGGATTTCTTCATGCCGTTCGCGACGATGTTGAGTCCGCATCTGGATGGGGCGCGGGTGAACACGGTGGAATGGGCGCGGCGGATGGGGCTGCTGCGGCCGCAGGCCGGAGTGCCGCTTTCGGGGATCTGGGACGAGGGGAAGCTGAAGGATTACGACTTCCCGTTGTGCGCAGCCGGGCTGCATCCCGACGCGACGCCGGAGGAACTGGACCTGTCGTCGCAGTGGCTGACCTGGGGGACGTACGGGGACGATTACTACCCCGCGGTGTTCGGGGCGGTACGGAATCTGGCCGGGGCGAAGGCGTGCAATGCGCGGCTTTCGGCGCTGATGCCGGTGGAGGACGGCGCGGCCGCGCCGGAGCCGGCGAACGCGATGGAACGCGGGCTGGCCGATCTGTGGGTCCGTACGACGGAATCGATGGACGCGGAGGCGCGGAAGACGTTCCGGGACAGCGTCGAGGCGATGACGGCCGGGTGGATCTGGGAGTTGGAGAACCAGGCGCTGCATCACATTCCCGATCCGGTGGATTACATCGAGATGCGGCGGGCGACGTTCGGCTCCGACATGACGATGAGCCTGAGCCGTGTCGGGCATGGGCGGCGGGTGCCGGAGGAGATTTATCGCAGTGGGACCATGCGTTCGCTGGAGAACGCCGCGGCCGACTACGCGACGCTGATGAACGACGTGTTCTCGTACCAGAAGGAGATCGAGTACGAGGGTGAGGTGCACAACGGGGTTCTGGTGGTGCAGAACTTCTTCGACTGCGACTATCCGACGGCGCTCGCGATCGTGCACGACCTCATGACGTCACGTATGCGGGAGTTCCAGCATGTGGCGGCGAACGAACTGCCGGTGCTTTACGACGACTTCGATCTGTCGGAGGAAGCGCGGGCACTGCTGGACGGGTACGTGAAGGAACTGGAGAACTGGATGTCCGGAATACTGACCTGGCATCGAGGGTGCCGGCGGTATCGCGAGGAGGACTTGCGGCGGCATAAGGGAGATAAGGGCGGTATGGGTTCGGGGGTGCGGAGCGGGGCGGTCGCCGGTGCGGCTGAGGCCGTGGCGGCCGGGGCTGGTGAGTGGAGTGGGCGGCCTACTGGGCTGGGGACCTCGGCGGCGCAGGTGGCCTTGCGACAGGCAACTCCGGTGCGGCAGTAG (SEQ ID NO. 17)

In some embodiments, the 2-MIB terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID No. 18; preferably, the 2-MIB terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 18.

2-MIB terpene synthase gene: ATGACCACACCCGCCACCGAAACCGCCACCGCGTTCAAGCTGCCCGGCCCACCCAGCCTCGCCCGCGCCCGGCCGACCCGGCGCGGCGGCGCCGTCCCCGGGCTGAGGTACCGTTCCGTCGCGCCGGCCGACCCGGAGAAGGCCGCGGAAATCGACCGCAGGCTGGAGGAGTGGGCTCGCCGGCTGGACCTGTTCCCCTCGAAGTGGTCGGGCGACTTCACCGACTTCCAGGTCGGCCGGGCCGTCGTCCTGCAACATCCCGCGGCGGCCGACCTGGAACGCCTCACCGTCGCGGGCAAACTGCTGCTGGCCGAGAACATCGTCGACAGTTGCTACTGCGAGGAGGACGAGGGCAAAGGCGGCGCGCGCCGTGGTCTGGGCGGCCGCCTGATCATCGCGCAGTCGGCTCTCGATCCGTTCCACGGCACTCCTGAGACGGAGGAGGAGTGGCGCCAGGGTGTGCAGGCCGACGGGCCCCTGCGCTCGTACTACTGGGCCCTGAAGGATTACGCGGCCCTCGCCACCCCCAGCCAGACCGTCCGGTTCGTCCACGACATGGCCCGGCTGCACCTCGGCTACCTCGCCGAGGCGTCCTGGGCCGAGACGCGGCACATGCCGCGCGTGGGGGAGTACCTGGTGATGCGGCAGTTCAACAACTTCCGCCCCTGCCTGTCGATCGTCGACGCCGTGGACGGCTACGAGCTGCCCGAGGCCGTGTACGCCCGCCCGGAGATCCAGCGGATCACCGCCCTGGCCTGCAACGCCACGACCATCGTCAACGACCTGTACTCCTTCACCAAGGAGCTGGCGAGCGACCCGGACCACCTGAACCTGCCCCAGGTGGTCGCCGCCAACGACCAGTGCGGTCTGAAGGCCGCGTATCTGAAGAGCGTCGATATCCACAACCAGATCATGGAGGCGTACGAGACGGAGGCGGCCGAGCTGGCCGGGACCTCCCCGCTCGTCGAGCGGTACACCCGGAGCCTGTCCGACTGGGTGGCCGGCAACCACGAGTGGCACGCCACCAACTCCGACCGCTATCACCTGCCCAACTACTGGTAG (SEQ ID NO. 18)

In some embodiments, the 2-MIB methyltransferase gene comprises a nucleotide sequence that has at least 90%, at least 95%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID No. 19; preferably, the 2-MIB methyltransferase gene has the nucleotide sequence shown as SEQ ID NO. 19.

2-MIB methyltransferase gene: ATGCCGACCCAGTCCACGTACCAGGCGCGCGTCGCCGAGTACTGGAACACCGAGGAGAACCCGGTCAATCTGGAACTCGGCAAGATCGACGACCTGTATCACCACCACTACGGCATCGGGGACGCCGACCGGTCCGTGCTGGACGAACCGGACCCCGTCCGGCGCCGCGAACGCATCACCGGTGAACTGCACCGCCTCGAACACGCCCAGGCCGAACTGCTCGCCTCCCACCTCGGCGCGCTGTCGCCCACCGACCGTGTCTTCGACGCCGGGTGCGGACGCGGCGGCGGCAGCGTGGTCGCGCATCTGCGCCACGGCTGCTACACCGATGGGGCCACCATCTCCGCCAAGCAGGCCGACTTCGCCAATGAGCAGGCCCGCAAGCGCGGCATCGACGACAAGGTGCGCTACCACCACCGCAACATGCTCGACACCGGCTTCGCCACCGGCGCGTACGCGGCGTCCTGGAACAACGAGTCGACCATGTACGTCGAGCTGGACCTGCTGTTCGCCGAGCACGCGCGGCTGCTGCGGCGCGGCGGGCGCTATGTGGTGATCACCGGCTGCTACAACGACGCCTACGGGCGCGCCTCCCGCGAGGTGTCCCTGATCAACGCCCACTACATCTGCGACATCCATCCGCGGTCGGCGTACTTCCGCGCGATGGCCCGCCACCGGCTGGTCCCGGTGCACGTCCAGGACCTCACCGCGGCCACCATCCCGTACTGGGAATTGCGCAGCCAGGCCGACCACCTGGTCACCGGCATTGAGGAAACCTTTCTGACCGCCTACCGCAACGGCAGCTTTCAGTATCTGCTGATCGCCGCCGACCGGATCTGA (SEQ ID NO. 19)

In some embodiments, the engineered strain is Streptomyces cratus with two knockout of the Geomin terpene synthases and 2-MIB terpene synthases and methyltransferases genes.

In some embodiments, the engineered strain has a reduced content of Geosmin of at least 90%, preferably at least 95%, preferably at least 98% compared to the starting strain; and/or the content of 2-MIB is reduced by at least 90%, preferably by at least 95%, preferably by at least 98%.

In some embodiments, the content of Geosmin in the engineered strain is less than 1ppm, preferably less than 0.5ppm, more preferably less than 0.2ppm, and/or the content of 2-MIB is less than 1ppm, preferably less than 0.5ppm, more preferably less than 0.2ppm.

In some embodiments, the "content of Geosmin" or "content of 2-MIB" may be understood as the content of Geosmin or 2-MIB in the thallus or in the fermentation product thereof during at least one fermentation cycle of the streptomyces rimosus. The term "fermentation cycle" as used herein has its ordinary meaning, meaning the time elapsed from the start of fermentation to the end of fermentation, or it can be understood that fermentation process is generally performed when oxytetracycline is produced by fermentation using the Streptomyces chapensis in a laboratory or industrial process.

In some embodiments, the starting strain of the engineered strain is Streptomyces cratus (Streptomyces rimosus) J1-023, with a accession number of CCTCC M20222113. The inventor finds that streptomyces for industrial production of terramycin with higher terramycin titer can be further obtained by knocking out the genes of the Geomin terpene synthase and/or the 2-MIB terpene synthase and the methyltransferase on the basis of the streptomyces chapicola J1-023.

In some embodiments, the titer of the engineered strain oxytetracycline is increased by at least 7.5% compared to the starting strain Streptomyces cratus (Streptomyces rimosus) J1-023.

In some embodiments, the modified strain is Streptomyces cratus (Streptomyces rimosus) ZY004 (herein may be abbreviated as ZY 004) with a preservation number of CCTCC M20222114.

In some embodiments, the industrial fermentation comprises industrial production of oxytetracycline.

The Streptomyces strain is used for industrial fermentation, the malodorous smell of fermentation products is obviously reduced, and the tail gas treatment is relatively easy; further, the yield of the modified strain terramycin is further improved, so that the cost of industrial production is reduced.

In a third aspect, the present application provides a method for industrially producing oxytetracycline, comprising fermentatively producing oxytetracycline using the Streptomyces strain provided in the first aspect of the present application.

The Streptomyces strains of the present application and their use are described below by way of specific examples.

Example 1 knockout vector construction

By utilizing the Gibson assembly principle, the left and right homology arms, the pJTU1278 enzyme cutting vector and the two ends of the inserted erythromycin resistance gene fragment are provided with 20bp homology sequences through primers. The genome of Streptomyces chapensis J1-023 (CCTCC M20222113) was obtained by phenol-chloroform extraction, and the left homology arm was amplified by the upstream primer G-UHA-F,5'-GCGGTGGCGGCCGCTCTAGACCGGGCTAGGAGGAGTTGGATG-3' (SEQ ID NO. 1) and the downstream primer G-UHA-R,5'-GCCCCACCCTCTCGTCGTCCGTC-3' (SEQ ID NO. 2) using the genome of Streptomyces chapensis J1-023 as a template. The right homology arm was amplified by the upstream primer G-DHA-F,5'-ATTCGGTCCTCGGGATATGAGGGGAGCGTC GGGGCCGGAGG-3' (SEQ ID NO. 3) and the downstream primer G-DHA-R,5'-TCGACGGTATCGAT AAGCTTACGCGGGCGCCGCCGACCTGC-3' (SEQ ID NO. 4). Erythromycin resistance gene was amplified by using plasmid pMG36e as a template through the upstream primer G-ery-F,5'-GGACGACGAGAGGGTGGGGCTTACTTATTAAA TAATTTATAGC-3' (SEQ ID NO. 5) and the downstream primer G-ery-R,5'-TCATATCCCGAGGACCG AATTC-3' (SEQ ID NO. 6). The pJTU1278 vector is linearized by selecting double enzyme cutting sites XbaI/HindIII, and the Geomin knockout vector pZY-1 is obtained by a Gibson assembly mode. The constructed vector is verified by 1 generation sequencing, and the result shows that the vector is constructed successfully. In addition, to construct a transition vector that rejects the erythromycin resistance gene, the fragments except the erythromycin resistance gene were assembled by Gibson according to the procedure and primers described above, and a transition vector pZY-1 that does not contain the erythromycin resistance gene was constructed.

And constructing the carrier for knocking out the 2-MIB according to the operation flow. Amplifying the left homology arm by the upstream primer 2M-UHA-F,5'-GCGGTGG CGGCCGCTCTAGAGGAGCCTTACGCCTGAACGACGAC-3' (SEQ ID NO. 7) and the downstream primer 2M-UHA-R,5'-GCCGCCGACCGGATCTGAGGAAC-3' (SEQ ID NO. 8); amplifying the right homology arm by the upstream primer 2M-DHA-F,5'-GTCCGTACTCCACTGGTCAGTCG-3' (SEQ ID NO. 9) and the downstream primer 2M-DHA-R,5'-TCGACGGTATCGATAAGCTTTGGGCCGTATGTCCAGTGATTCG-3' (S EQ ID NO. 10); the erythromycin resistance gene is amplified by using a plasmid pMG36e as a template through an upstream primer 2M-ery-F2,5'-ACC GCATCAACGGACCCGAG-3' (SEQ ID NO. 11) and a downstream primer 2M-ery-R2,5'-ACTCGCTGGC CATCCTCGTG-3' (SEQ ID NO. 12), the pJTU1278 vector treatment is consistent with that of a Geomin knockout vector, and a 2-MIB gene knockout vector pZY-2 is obtained through a Gibson assembly mode. The constructed vector is verified by 1 generation sequencing, and the result shows that the vector is constructed successfully.

Wherein, pZY-1 and pZY-1 are shown in the figure 1, and the construction flow of the pZY-2 vector is shown in the figure.

Example 2 construction of a Geomin terpene synthase single knockout Strain

2.1 transformation of E.coli and Streptomyces chapensis

Inoculating 80-100 ul of J1-023 seed preservation solution to a streptomyces griseus bran solid culture medium, wherein the streptomyces griseus bran solid culture medium is 7.5% bran and 2.4% agar strips, adjusting the pH value to 6.9-7.0, and sterilizing at 121 ℃ for 30min. The inoculated culture medium is placed in a constant temperature incubator at 34 ℃ for 3 days, and then placed in a constant temperature incubator at 30 ℃ for 1 day. J1-023 after the completion of the cultivation had a thick white spore layer.

The constructed pZY-1 plasmid was electrotransformed into E.coli DH10B, and it was confirmed that DH10B containing the correct plasmid was obtained. J1-023 was transferred with DH10B containing the correct plasmid and helper strain ET12567/pUB307 by triple parental conjugation. E.coli DH10B and ET12567/pUB307 were cultured overnight to OD 0.6-0.8, respectively, for further use. Collecting a J1-023 spore, collecting in 4-6 ml TES buffer solution (0.05M, pH=8.0), heat-shocking at 50deg.C for 10min, adding equal volume of pre-germination medium (1% OXIDYeast extract; 1% SIGMA casein hydrolysate), and adding CaCl with final concentration of 5mM ₂ Mixing the above liquids uniformly, and then placing the mixture in a shaking table at 37 ℃ for incubation for 2.5-3 h. Re-suspending the cultured Escherichia coli with sterile water or LB culture solution by centrifuging at 3500rpm for 5min, washing the Escherichia coli twice, and culturing with 1-1.5 ml sterile water or LBRe-suspending the bacteria by the nutrient solution; according to J-023: DH10B: 0.5ml of bacterial liquid is added into ET12567/pUB 307=1:1:1 volume ratio respectively, the final volume is 1.5ml, and the bacterial liquid is uniformly mixed and then coated on an MS culture medium (2% mannitol; 2% soybean cake powder; 5g agar powder/250 ml split charging; sterilization at 120 ℃ C. For 30 min). Culturing for 8-12 h, and respectively mixing trimethoprim, erythromycin and thiostrepton according to the final concentration of 50ug/ml;50ug/ml;30ug/ml of the solution was dissolved in 1ml of sterilized water, the joint transfer plate was covered with 1ml of sterilized water containing an antibiotic, and after the covering, the plate was air-dried for about 1 hour and incubated at 34℃for 4 days.

2.2 screening of Mono-crossover strains

The spiny yellow binder colony is picked up, the amplified culture is carried out on MS solid culture medium (trimethoprim, erythromycin and thiostrepton are added in the same concentration as the above antibiotic coverage), and after 4 days of culture, 2cm multiplied by 2cm colony spores are picked up for nucleic acid extraction. The spores are moved into 50ul of 50% dimethyl sulfoxide solution, the spores are placed in boiling water for 5min, ice bath for 5min, boiling water for 3min, ice bath for 3min, boiling water for 3min and ice bath for 3min, wall breaking treatment is carried out, the treated thalli are centrifuged at 8000rpm for 5min, and the supernatant is taken as a template. Primer pairs Geo-F4,5'-GCACGTATGCCTTGCACCTC-3' (SEQ ID NO. 13) and Geo-R4,5'-AGCGACGACTCCAACCGAC-3' (SEQ ID NO. 14) are used as verification primers for PCR identification of the binding molecules, and the correct single crossover strain shows a 1357bp band and a 2644bp band simultaneously during agarose electrophoresis. As shown in FIG. 2, the lanes labeled "single swap" show the correct single swap strain identification bands.

2.3 construction of a Geomin Single knockout terpene synthase Strain

The correct single crossover strain was isolated as single colonies according to the three-zone streak method on MS solid medium (antibiotic added only to 50ug/ml erythromycin), after 4 days of culture, single colonies were selected, and each single colony was simultaneously plated on MS solid medium added with 50ug/ml erythromycin and 30ug/ml thiostrepton and MS solid medium added only with 50ug/ml erythromycin, respectively. The coated culture plates were observed after 4 days of incubation. Colonies growing only in MS solid medium added with only 50ug/ml erythromycin can appear in the first round of double screening, PCR verification is carried out on the colonies according to the boiling fungus extraction nucleic acid method flow and verification primers in the single-exchange strain verification in 2.2, agarose electrophoresis results are shown in figure 2, a verification group with only 1357bp of amplification results is taken as a double-exchange modified strain for single knockout of the Geosmin terpene synthase gene, and the 9 obtained double-exchange modified strains are named ZY1-1 to ZY1-8 and ZY1-10.

Example 3 2-construction of MIB terpene synthase and methyltransferase Gene knockout Strain

The pZY-2 vector was introduced into the starting strain J1-023 by the three-parent ligation transfer according to the procedure in 2.1 of example 2. The correct single crossover strain was isolated as single colonies according to the three-zone streak method on MS solid medium (antibiotic added only to 50ug/ml erythromycin), after 4 days of culture, single colonies were selected, and each single colony was simultaneously plated on MS solid medium added with 50ug/ml erythromycin and 30ug/ml thiostrepton and MS solid medium added only with 50ug/ml erythromycin, respectively. The coated culture plates were observed after 4 days of incubation. Colonies growing only in MS solid medium added with only 50ug/ml erythromycin appear in the first round of double screening, PCR verification is carried out on the colonies according to the boiling fungus extraction nucleic acid method flow in single exchange strain verification in 2.2 and the upstream primer 2M-ery-F2,5'-ACCGCATCAACGGACCCGAG-3' (SEQ ID NO. 15) and the downstream primer 2M-ery-R2,5'-ACTCGCTGGCCATCCTCGTG-3' (SEQ ID NO. 16) as verification primers, an agarose electrophoresis result is shown in FIG. 3, and a verification group with only 1261bp appears as a double exchange modified strain of single knockout 2-MIB terpene synthase and methyltransferase genes, and the obtained 7 double exchange modified strains are named ZY1-M3 to ZY1-M9.

EXAMPLE 4 construction of Geomin and 2-MIB double knockout Strain

4.1 construction of a knockout erythromycin resistance Gene Strain

pZY-1 vector was introduced into strains ZY1-1 to ZY1-8, and ZY1-10, respectively, of single knockout Geosmin terpene synthase by tri-parental ligation transfer according to the procedure in example 2, 2.1. The PCR identification of the binders was performed according to the procedure and validation primers in 2.2, with the correct single crossover strain appearing simultaneously with bands of 322bp and 1357bp on agarose electrophoresis. Single colonies were isolated on non-resistant MS medium according to the procedure in 2.3, double screening was performed on non-resistant MS plates and MS plates with only 50ug/ml erythromycin added, respectively, until candidate strains grown on non-resistant MS medium were obtained, and PCR verification was performed with the verification primers in 2.2, with only 323bp strains appearing on agarose electrophoresis being the correct reject erythromycin resistance gene transition strain. Wherein, the strain with 1357bp is verified by PCR to be a strain which is not subjected to double exchange, if the strain candidate strain is verified by the first round, the strain growing on the MS plate containing erythromycin can be passaged in an anti-MS culture medium, single colony is separated and double screening operation is performed until the strain candidate strain is obtained. By the above procedure, 7 candidate strains (grown only in the medium without resistance) were obtained, and PCR was performed using the primers verified in 2.2, and the electrophoresis results are shown in FIG. 4. 4 correct transitional strains were obtained. Respectively named as ZY1-7, ZY1-9, ZY1-10 and ZY 1-11.

4.2 construction of Geomin and 2-MIB double knockout Strain

The pZY-2 vector was introduced into strain ZY1-11 by triparental ligation transfer according to the procedure described in example 2, and single crossover strain verification was performed according to the procedure described in example 3, with the correct single crossover strain occurring in agarose electrophoresis with 1261bp and 2179bp bands, according to the procedure described in example 2.2. Single colonies were isolated according to the three-zone streak method on MS medium with only 50ug/ml erythromycin according to 2.3 procedure, and after 4 days of culture, single colonies were picked and individually plated on MS medium with 50ug/ml erythromycin and 30ug/ml thiostrepton and MS medium with only 50ug/ml erythromycin. After 4 days of culture, the first round of double screening was observed to show strains grown only on MS medium plates containing erythromycin, giving a total of 8 candidate strains, which were PCR verified using the verification primers of example 3, and the electrophoresis results are shown in FIG. 5, in which only 1261bp of the strain was found to be the correct double knockout strain. Through verification, 8 double knockout strains are obtained and named ZY2-1 to ZY2-8.

EXAMPLE 5 domestication rejuvenation and product detection of engineered strains

The process of genetic engineering affects the metabolic and growth state of industrial strains, so that successful construction of single-and double-knockout bacteria is required for passaging activation and rejuvenation. 50ml of streptomyces chapensis bran culture medium (7.5% bran, pH is adjusted to 6.9-7.0, sterilization is carried out at 121 ℃ for 30 min) is filled into a eggplant-shaped bottle to prepare a culture inclined plane, after 4 days of culture, the thick spore is picked up, and a single colony with deep back pigment is inoculated into the test tube inclined plane (20 ml of streptomyces chapensis bran culture medium). After 4 days of culture, selecting a region with thick spore and solid mycelium, and marking a spore layer with the thickness of 1cm multiplied by 1cm for shaking, wherein the method comprises the following steps: culturing in 30% TSB (OXIO) liquid medium at 30deg.C for 1 day, transferring to fermentation medium for 5-7 days (5% corn starch; 2% soybean cake powder; 1.4% calcium carbonate; 0.4% sodium chloride; 1.4% ammonium sulfate; 0.4% corn steep liquor; 0.02% amylase) at 10% inoculum size (see Shouliang Yin et al, identification of a cluster-situated activator of oxytetracycline biosynthesis and manipulation of its expression for improved oxytetracycline production in Streptomyces rimosus, microbial Cell Factories,2015, 14). After 7 days of fermentation, the odor molecules in the fermentation liquid are detected by GC-MS, and the molecular weight extraction detection of m/z=95 and m/z=112 shows that compared with the original strain J1-023, the chromatographic peaks of Geomin or 2-MIB are not existed in the single-knockout modified strain, and the chromatographic peaks of Geomin and 2-MIB are not existed in the double-knockout strain. The GC-MS results of the double knockout strain (ZY 2-8) and the starting strain J1-023 are shown in FIG. 6A and FIG. 6B, wherein the graph A in FIG. 6A shows a gas chromatograph, the peak time of Geomin is about 8.40min, and the graph B shows a mass spectrum of Geomin; FIG. 6B is a diagram of a gas chromatograph, the peak time of 2-MIB is about 6.72min, and the diagram B is a diagram of a mass spectrum of 2-MIB; as can be seen from the figure, the engineered strain no longer produced Geomin and 2-MIB.

Double blind odor experiments were performed by randomly extracting 21 volunteers, placing the double knockout modified strain (ZY 2-8) fermentation broth and the starting strain (J1-023) fermentation broth in glass triangular flasks labeled a and B, respectively, and the volunteers participating in odor assessment did not inform the triangular flasks of the fermentation broth information before starting the experiment, and were responsible for the samplers waiting outside the experimental site and did not participate in the odor assessment experiment. Finally, the number of people with a light fishy smell of the bottle A is 20, and 1 person cannot respectively smell light and heavy in two bottles. Double-blind odor assessment experiments show that 95.2% of volunteers can distinguish the modified strain from the original strain by the characteristic of reducing the fishy smell of the fermentation broth.

The titer of the modified strain is then determined by taking a proper amount of fermentation broth, acidifying the solid oxalic acid to pH=1.5-2.0, standing for 5 minutes, filtering the acidified broth with filter paper in a dry test tube, taking 1ml of acidified filtrate to dilute 10 times with ultrapure water, sucking the diluted filtrate, adding 0.01mol/L HCl 9ml and 0.05% FeCl ₃ 10ml, shaking and standing for 20 minutes. The oxytetracycline standard substance is prepared into 25000mg/L standard substance solution, then the standard substance solution is diluted to 20000mg/L, 15000mg/L and 10000 mg/L5000 mg/L in sequence, the standard substance solution is placed in a cuvette with the thickness of 1cm, and a linear standard curve of absorbance and concentration of the standard substance solution at 500nm is established by an ultraviolet-visible spectrophotometer. And taking out a proper amount of acid filtrate after pretreatment, recording an absorbance value by using an ultraviolet-visible spectrophotometer, substituting the absorbance value into an established oxytetracycline standard curve, and multiplying the standard curve by a dilution factor to obtain oxytetracycline titer. The results of detecting the terramycin titer in the fermentation product by the method are shown in figure 7, wherein the average titer of the initial strain is about 21976mg/L, the average titer of terramycin in the single-knock-out Geomin strain after selection is 23700mg/L, which is improved by 7.8% compared with the initial strain, the average titer of terramycin in the single-knock-out 2-MIB strain after selection is 23617mg/L, which is improved by 7.5% compared with the initial strain, the average titer of terramycin in the double-knock-out strain after selection is 24025mg/L, which is improved by 9.3% compared with the initial strain. Wherein, the double knockout strain (ZY 2-8) with highest terramycin titer is named ZY004 and is preserved in China center for type culture Collection, with the preservation number: the titer of the CCTCC No. M20222114 is improved by about 10 percent compared with that of the original strain.

Example 6 construction and product detection of Geomin and 2-MIB double knockout Streptomyces cratus JCM 4667

Obtaining a streptomyces roseus JCM 4667 (accession number: ATCC 23955) genome by a phenol-chloroform extraction method, constructing a knockout vector by adopting the same method as that of example 1 and constructing a streptomyces roseus JCM 4667 strain by double knockout of Geomin and 2-MIB by adopting the same method as that of example 4 by taking the streptomyces roseus JCM 4667 genome as a template, and carrying out domestication rejuvenation and product detection of the modified strain by adopting the same method as that of example 5, wherein the result shows that the streptomyces roseus JCM 4667 terramycin titer of the original strain is about 600 mg/L; the average titer of the strain after transformation is about 680mg/L, and the titer is improved by 13.3%.

The results of the above examples demonstrate that gelsmin and/or 2-MIB gene knockout can increase streptomyces chapicol potency.

The foregoing description of the preferred embodiments of the application is not intended to limit the application to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the application are intended to be included within the scope of the application.

Claims

1. A streptomyces strain that is a streptomyces chapicolus (Streptomyces rimosus) with a Geosmin terpene synthase gene and/or a 2-MIB terpene synthase and methyltransferase gene knocked out, wherein the 2-MIB terpene synthase and methyltransferase genes comprise a 2-MIB terpene synthase gene and a 2-MIB methyltransferase gene;

preferably, the Geosmin terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98% or at least 99% identity with the sequence shown in SEQ ID No. 17; preferably, the Geosmin terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 17;

preferably, the 2-MIB terpene synthase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98% or at least 99% identity to the sequence shown in SEQ ID No. 18; preferably, the 2-MIB terpene synthase gene has a nucleotide sequence shown in SEQ ID NO. 18;

preferably, the 2-MIB methyltransferase gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 98% or at least 99% identity with the sequence shown in SEQ ID No. 19; preferably, the 2-MIB methyltransferase gene has the nucleotide sequence shown as SEQ ID NO. 19.

2. The Streptomyces strain according to claim 1, which is Streptomyces chapensis double knocked out of the Geomin terpene synthase gene and the 2-MIB terpene synthase and methyltransferase genes.

3. The streptomyces strain according to claim 1 or 2, wherein the content of Geosmin is below 1ppm, preferably below 0.5ppm, more preferably below 0.2ppm.

4. Streptomyces strain according to claim 1 or 2, wherein the content of 2-MIB is less than 1ppm, preferably less than 0.5ppm, more preferably less than 0.2ppm.

5. The Streptomyces strain according to claim 1, wherein the production of oxytetracycline is increased by at least 7.5% compared to the starting strain.

6. The Streptomyces strain according to any one of claims 1 to 5, wherein the starting strain is Streptomyces cratus (Streptomyces rimosus) J1-023.

7. The Streptomyces strain according to claim 6, which is Streptomyces cratus (Streptomyces rimosus) ZY004 with a preservation number of CCTCC M20222114.

8. Use of the streptomyces strain according to any of claims 1 to 7 for industrial fermentation.

9. The use of claim 8, wherein the industrial fermentation comprises industrial production of oxytetracycline.

10. A method for industrially producing oxytetracycline, comprising fermentatively producing oxytetracycline using the streptomyces strain according to any one of claims 1-7.

11. A method for increasing the production of oxytetracycline and/or reducing off-flavor in industrial production of oxytetracycline comprising fermentatively producing oxytetracycline using a streptomyces strain as described in any one of claims 1-7.