CN116622777A

CN116622777A - Gene editing construct and use thereof

Info

Publication number: CN116622777A
Application number: CN202310645338.1A
Authority: CN
Inventors: 梁德生; 胡志青; 唐齐玉; 邬玲仟
Original assignee: Shanghai Pingpu Medical Technology Co ltd
Current assignee: Shanghai Pingpu Medical Technology Co ltd
Priority date: 2023-06-01
Filing date: 2023-06-01
Publication date: 2023-08-22

Abstract

The present disclosure provides a gene editing construct for site-directed integration of an exogenous gene into a ribosomal DNA (rDNA) region of a genome and capable of efficiently expressing the exogenous gene carried thereby, and uses thereof.

Description

Gene editing construct and use thereof

Incorporation by reference

All publications, patents, and patent applications cited in this specification are herein incorporated by reference as if each individual publication, patent, or patent application were specifically and individually indicated to be incorporated by reference and set forth in its entirety herein.

Technical Field

The application relates to the field of gene editing, in particular to a gene editing construct and application thereof.

Background

At present, along with the continuous progress of human society, factors influencing diseases are gradually changed, wherein tumors become one of diseases with great concern, and the physical and psychological health of people is seriously influenced. In recent years, gene therapy has become a common treatment in tumor treatment; in general, the gene therapy method is to introduce exogenous genes into target cells through a certain donor vector or mode, so that the exogenous genes can be expressed safely and effectively, thereby achieving the purpose of treating tumor diseases.

Induced Pluripotent Stem Cells (iPSCs) are pluripotent stem cells that have been terminally differentiated by introducing certain specific genetic genes into the somatic cells by laboratory techniques, thereby re-reducing the somatic cells into pluripotent stem cells that have nearly the same function as embryonic stem cells. Induced pluripotent stem cells also have self-renewal and multipotent differentiation potential, and theoretically, they can differentiate into members of three germ layers, i.e., ectoderm, mesoderm, and endoderm, and then subdivide into multiple cell types in humans. At present, the induced pluripotent stem cells are applied to the fields of nervous system diseases, cardiovascular diseases and the like, and in recent researches, the induced pluripotent stem cells are also increasingly applied to the tumor treatment process.

Along with the research of researchers on the technology of the induced pluripotent stem cells, the researchers find that when exogenous genes are introduced into the induced pluripotent stem cells to perform fixed-point integration, the situation that the exogenous genes are expressed insufficiently or are not expressed often exists, and the expression quantity of the exogenous genes in the induced pluripotent stem cells during fixed-point integration is difficult to meet the requirements in the tumor treatment process; but the non-integrated type engineering induced pluripotent stem cells have the problem of being incapable of continuously expressing exogenous genes for a long time, and have limited application range.

Therefore, how to further increase the expression level of exogenous genes during fixed-point integration is one of the problems to be solved in the current induced pluripotent stem cell technology.

Disclosure of Invention

The inventors constructed in a prior study a gene editing construct (also referred to herein as a vector) miniHrneo capable of Site-directed integration of an exogenous gene expression cassette into the cell rDNA region 18S at position 5468 by gene editing (Site-Specific Integration of TRAIL in iPSC-Derived Mesenchymal Stem Cells for Targeted Cancer Therapy, zujia Wang et al Stem Cells Transl Med.2022Mar31; 11 (3): 297-309.Doi:10.1093/stcltm/szab 031). When gene fixed-point integration is carried out on the multicopy locus of the rDNA region, the inventor designs and constructs a miniHrneo vector and an engineered artificial nuclease TALENickases autonomously, wherein one Fok1 cutting domain of the enzyme is inactivated, and the cutting activity is lost, so that DNA double-strand break is not generated, only single-strand break is generated, and the gene fixed-point integration efficiency is improved while cytotoxicity is reduced. However, after site-directed integration of the exogenous gene at 5468 site in the 18S region of the rDNA region of the cell, it was found that there was a problem of insufficient expression of the exogenous gene.

In further research, the inventors have unexpectedly found that when the downstream homology arm in the minihrneo vector is truncated, only 266bp of the downstream homology arm is reserved, the expression of the exogenous gene can be significantly enhanced. Based on this, the present application has been completed.

The application further optimizes the homology arm of the traditional donor template miniHrneo, shortens the downstream homology arm while keeping the upstream homology arm unchanged, improves the expression capacity of exogenous genes, and simultaneously maintains high-level site-directed integration efficiency. In addition, the application also provides a cell prepared by using the optimized donor template, and the cell has the improved exogenous gene expression capacity. The prior art has verified that the rDNA region of the cell belongs to a safe gene targeting region, and in embodiments of the application it is preferred to perform gene targeting in the rDNA region, more preferably in the 18S region of the rDNA region, and most preferably in the 5468 site of the 18S region of the rDNA region.

In a first aspect, the present application provides a gene editing construct comprising a construct scaffold comprising an upstream homology arm, a downstream homology arm, and a multiple cloning site between the upstream homology arm and the downstream homology arm; the nucleotide sequence of the upstream homology arm is shown as SEQ ID NO. 2 or has at least 70%, at least 80%, at least 90%, at least 95% or at least 98% sequence identity with SEQ ID NO. 2, and the nucleotide sequence of the downstream homology arm is shown as SEQ ID NO. 4 or has at least 70%, at least 80%, at least 90%, at least 95% or at least 98% sequence identity with SEQ ID NO. 4; the construct scaffold is a non-viral scaffold. In some embodiments of the application, the starting scaffold of the construct is miniHrneo, i.e., modified and engineered based on miniHrneo plasmids.

In some embodiments of the application, the nucleotide sequence of the upstream homology arm is shown as SEQ ID NO. 2 and the nucleotide sequence of the downstream homology arm is shown as SEQ ID NO. 4.

In some embodiments of the application, the nucleotide sequence of the construct is shown as SEQ ID NO. 27.

In other embodiments of the application, the construct further comprises an exogenous gene inserted at the multiple cloning site. In some embodiments, the exogenous gene encodes a therapeutic peptide, a DNA binding protein, an RNA binding protein, a fluorescent protein, or an enzyme. In still other embodiments, the therapeutic peptide is selected from the group consisting of human interleukin family members (e.g., IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23, and IL-24), tumor necrosis factor family members (e.g., TNF, LTA, LTB, FASLG, TNFSF, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, and EDA), interferons (INF- α, INF- β, and INF- γ), CAR, F8, F9, TNFR, and TRAIL.

In some embodiments of the application, the construct further comprises a promoter located at the multiple cloning site, preferably the promoter is a CMV promoter or an EF1 a promoter. Other promoters known in the art may also be used in the present application.

The application also provides a kit comprising the construct and instructions for use.

In a second aspect, the present application provides a method of gene editing comprising introducing a construct according to the first aspect into a cell, and site-directed integration of a foreign gene into the genome of the cell by a gene editing system.

In some embodiments, the gene editing system is selected from the group consisting of Cre-lox systems, zinc Finger Nucleases (ZFNs), CRISPR-Cas9 or Transcription Activator-Like Effector Nucleases (TALENs), preferably TALENs, more preferably gene editing using artificial nucleases talencackases.

In some embodiments, the site-directed integration site is located at 5468 of the ribosomal RNA transcription region (rDNA region) 18S rRNA transcription region of the genome.

In some embodiments, the cell is a mesenchymal stem cell, T cell, B cell, NK cell, macrophage or induced pluripotent stem cell and derived cells thereof. The derivative cells of the induced pluripotent stem cells are mesenchymal stem cells, T cells, B cells, NK cells, macrophages, hematopoietic cells, endothelial cells, liver cells, cardiac muscle cells, neuronal cells or islet cells differentiated from the induced pluripotent stem cells.

In a third aspect, the application provides a cell obtained after editing by the method of the second aspect.

In a fourth aspect, the application provides a pharmaceutical composition comprising a construct according to the first aspect or a cell according to the third aspect and a pharmaceutically acceptable adjuvant.

In a fifth aspect, the application provides the use of a construct according to the first aspect or a cell according to the third aspect in the manufacture of a medicament for the treatment of a tumour.

The optimized donor template, the cells prepared by the optimized donor template and the kit provided by the application have the capability of improving the expression of exogenous genes. The technical scheme disclosed by the application overcomes the defect of insufficient expression of the exogenous gene of the monoclonal cell after site-directed integration, and is beneficial to promoting the application of the gene therapy technology in the tumor disease treatment process.

Drawings

FIG. 1 shows the construction of a gene editing construct of the application, a novel site-directed integration vector backbone 266-miniHrneo; wherein A is BamHI and NdeI double enzyme cutting miniHrneo plasmid; SHA266 PCR amplified fragment.

FIG. 2 shows 266-miniHrneo plasmid sequencing results; wherein A is the sequencing result of the junction between the upstream SHA266 and the plasmid; sequencing results at the junction of SHA266 downstream and plasmid.

FIG. 3 shows the construction of a novel site-directed integration donor template plasmid 266IL15 carrying the exogenous gene IL 15; wherein, A is BamHI enzyme cutting miniHrneo plasmid; and B, bamHI digestion 266-miniHrneo plasmid.

FIG. 4 shows the results of miniIL15, 266IL15 plasmid sequencing in the examples; wherein, the miniIL15 comprises the sequencing result of the exogenous gene; 266IL15 contains the results of sequencing at the exogenous gene.

FIG. 5 shows the results of site-directed integrated monoclonal identification of miniIL15, 266IL15 in the examples; wherein, A is the identification electrophoresis result of the miniIL15 and 266IL15 fixed-point integrated monoclonal PCR; b, integrating a sequencing result at the positive monoclonal upstream homology arm joint of miniIL15 at a fixed point; and C, sequencing results at a positive monoclonal upstream homology arm joint of the site-directed integration 266IL 15.

FIG. 6 shows Western Blot detection of the expression of the foreign gene protein IL15 in the miniIL15, 266IL15 site-directed integration positive monoclonal; FIG. 6A is a Western Blot result plot; FIG. 6B shows the results of semi-quantitative analysis of Western Blot bands. * P <0.05.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Notwithstanding that the numerical ranges and approximations of the parameters set forth in the broad scope of the application, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. In addition, all ranges disclosed herein are to be understood to encompass any and all subranges subsumed therein. For example, a range recited as "1 to 10" should be considered to include any and all subranges between (inclusive of) the minimum value of 1 and the maximum value of 10; that is, all subranges beginning with a minimum value of 1 or more, e.g., 1 to 6.1, and ending with a maximum value of 10 or less, e.g., 5.5 to 10. In addition, any reference referred to as "incorporated herein" should be understood as being incorporated in its entirety.

It should be further noted that, as used in this specification, the singular forms include the plural of what is meant by them unless clearly and explicitly limited to one what is meant by them. The term "or" may be used interchangeably with the term "and/or" unless the context clearly indicates otherwise.

The term "construct" as used herein refers to a series of DNA molecules constructed artificially, such as amplified gene fragments, vectors for gene delivery of interest when editing genes, TALENickase templates, etc. The term "vector" as used herein refers to a structure that carries a DNA fragment, i.e., a means for delivering a foreign gene fragment into a recipient cell for expression, commonly used vectors such as plasmids, viruses, and the like. The term "plasmid" refers to a circular DNA molecule capable of autonomous replication in bacteria and yeast, which is a common carrier of foreign genes after artificial modification and construction, carrying genetic information or a DNA fragment of interest, and which can be delivered to a host cell for expression. Constructs, vectors, and plasmids are sometimes used interchangeably herein, and furthermore, the terms "construct backbone" and "construct" are sometimes used interchangeably.

The term "exogenous gene", also referred to as "gene of interest", refers to a gene that has been introduced into a recipient cell by a transgenic procedure. Different exogenous genes can be selected according to different disease types or different purposes. Such as the F8 gene in gene therapy for hemophilia a; the F9 gene in hemophilia B gene therapy; the related inhibitor genes IL-24, TRAIL and the like in tumors; the immunomodulating related gene PD1/PDL1 and the like, preferably, the foreign gene is a gene capable of directly expressing a protein, such as IL15 gene and the like.

The term "promoter" refers to a DNA sequence that allows transcription of a gene, which is recognized by RNA polymerase and begins transcription into RNA. Among the promoters used in eukaryotes are CMV, EF 1. Alpha., CAG, PGK1, SV40, etc. Promoters known in the art can be used in the present application.

The B6-hiPSCs are induced pluripotent stem cells which are induced by urine cells of a male donor, are named as 'B6-hiPSCs', have similarity with natural pluripotent stem cells in human bodies, express stem cell genes such as Sox2, nanog, oct4 and the like, can form teratomas in immune deficiency mice, and have the characteristics of self-renewal and multipotent differentiation.

The compositions of the present application may also contain adjuvants such as preserving, wetting, emulsifying and dispersing agents. The avoidance of the presence of microorganisms can be ensured both by the sterilization procedure hereinabove and by the inclusion of various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like in the compositions. In addition, prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption, for example, aluminum monostearate and gelatin.

Examples

Some preferred embodiments and aspects of the application are further described below in conjunction with specific examples, which should not be construed as limiting its scope.

Example 1 site-directed integration donor template homology arm design

(1) Primer is designed by utilizing Primer Premier software, and PCR amplification is carried out on gene segments in 2000bp ranges on the upstream and downstream of a gene fixed-point target site-rDNA region 5468 site. (PCR amplification was performed using primers 18S-1-F/R, 18S-2-F/R, ITS1-1-F/R, ITS1-2-F/R, ITS1-5-F/R, respectively). The primers used are shown in Table 1.

TABLE 1

The PCR system is as follows:

the PCR reaction was performed according to the following procedure:

(2) The PCR products were sequenced by biological company (Beijing qingke biosciences Co., ltd.). The traditional site-directed integration donor template is designed according to the sequencing result, and specifically, the homology arms are as follows: the upstream homology arm selects the sequence 933bp upstream of the rDNA region 5468 site (SEQ ID NO: 2) and the downstream homology arm selects the sequence 576bp downstream of the rDNA region 5468 site (SEQ ID NO: 3).

(3) In the embodiment, the traditional site-directed integration donor template is further optimized, namely, a 1-266bp part is selected from the downstream homology arm, and the novel site-directed integration vector is obtained.

EXAMPLE 2 novel site-directed integration vector backbone 266-miniHrneo construction

(1) Enzyme digestion the sequence of the published Site-directed integration donor template backbone plasmid miniHrneo ("Site-Specific Integration of TRAIL in iPSC-Derived Mesenchymal Stem Cells for Targeted Cancer Therapy", zujia Wang, et al Stem Cells Transl Med,11 (3): 297-309, 2022.3.10) is shown in SEQ ID NO:1 (published academic paper (Liu Bo. Anti-tumor research of human iPSC ribosomal gene region IL24 gene targeting and its differentiated MSCs [ D ]. Changsha: university of middle and south, 2017:19-25) discloses specific structures of the non-viral human ribosomal DNA (hrDNA) targeting vector mini-pHrneo). The minihrneo plasmid was digested with BamHI (NEB, cat No. R0136V) and NdeI (NEB, cat No. R0111V) in the following manner:

the mixture was left at 37℃for 6 hours.

(2) The miniHrneo is used as a template, the upstream homology arm sequence is shown as SEQ ID NO. 2, and the downstream homology arm sequence is shown as SEQ ID NO. 3. The 1-266bp (SEQ ID NO: 4) fragment of the downstream homology arm (SHA 266) was PCR amplified. The primers and sequences used are shown in Table 2.

TABLE 2

(3) Agarose gel electrophoresis

(i) 0.6g agarose (Biowest, cat. No. 111860) was weighed, poured into a conical flask, 60mL of 0.5 XTBE was added and boiled for 3min. Cooling at room temperature for 10-20min, pouring into a glue plate, inserting comb teeth, and standing until it solidifies.

(ii) Taking off the comb teeth, and placing the glue into an electrophoresis tank. Pour 0.5 XTBE into the electrophoresis tank until the gel block is completely gone. The enzyme-digested product in (1) and the PCR-amplified fragment in (2) are added to the spotted wells.

(iii) Electrophoresis was started (180V, 60 min).

(4) DNA recovery

(i) The gel block was immersed in EB dye solution in a dark room for 15min.

(ii) The gel block is taken out, washed by running water, and then a target fragment (shown in figure 1) is cut out under an ultraviolet lamp, and is put into an EP tube for marking.

(iii) The target band DNA was recovered according to the instructions using FastPure Gel DNA Extraction Mini Kit (Vazyme, cat. DC 301-01).

(5) Downstream homology arm ligation vector

UsingII One Step Cloning Kit (Vazyme, cat. No. C112-01) the right homology arm was ligated into a plasmid with the left homology arm.

The following system was formulated on ice:

after 30min of reaction at 37℃in a dry thermostat, the reaction mixture was immediately placed on ice.

(6) Transformation

Taking DH5 alpha competence, and thawing on ice for 5min;

10. Mu.L of ligation product was mixed with 50. Mu.L of DH 5. Alpha. Competence and left standing at low temperature for 30min;

opening the water bath box, and raising the temperature to 42 ℃;

heating the mixture in a water bath for 45s, and standing at low temperature for 2min again;

adding 100 mu L of LB solution without antibiotics into an ultra-clean bench, placing on a shaking table at 37 ℃ and shaking at 190rpm for 50min;

coating all the liquid on an ampicillin-containing solid LB culture dish in an ultra-clean bench, and standing for 12-16h at a constant temperature of 37 ℃;

five white single colonies are picked in the liquid LB containing ampicillin in the next day, marked, placed on a shaking table at 37 ℃ and gently shaken at 220rpm for 7 hours;

sequencing bacterial liquid.

(7) Small-scale extraction of 266-minihrneo plasmid

Checking the sequencing sequence, and selecting a correct bacterial solution for sequencing (the result is shown in figure 2); the complete 266-minihrneo plasmid sequence is shown in SEQ ID NO. 27.

Taking a 15mL centrifuge tube, sucking bacterial liquid into the centrifuge tube in an ultra-clean bench, adding 8mL of ampicillin-containing liquid LB, fixing to a shaking table at 37 ℃ and lightly shaking at 220rpm for 12 hours;

the plasmids were extracted in small amounts and labeled using Endo-free Plasmid Mini Kit II (OMEGA, cat. Number D6950-02) strictly following the procedures described;

plasmid concentration was determined using Nanodrop 1000, labeled on the tube wall, and stored at-20 ℃ for later experiments.

Example 3 construction of donor template plasmid 266IL15 containing exogenous Gene IL15

(1) The human IL15 CDS sequence containing the EF 1. Alpha. Promoter was synthesized by Bio Inc. (Shanghai Biotechnology Co., ltd.).

(2) The miniHrneo and 266-miniHrneo plasmids were digested with BamHI as described above.

(3) The human IL15 CDS sequence (SEQ ID NO: 16) containing the EF 1. Alpha. Promoter was amplified by PCR. The primers and sequences used are shown in Table 3:

TABLE 3 Table 3

(4) Agarose gel electrophoresis, DNA recovery of the digested product (as shown in FIG. 3) and PCR products were performed as described above.

(5) The method comprises the following stepsII One Step Cloning Kit the human IL15 CDS sequence containing EF1 alpha promoter is connected into miniIL15 (SEQ ID NO: 19) and 266IL15 (SEQ ID NO: 20) respectively, and then transformed and sequenced, and the bacterial liquid plasmid with correct sequencing is selected for small extraction (shown in figure 4) to obtain miniIL15 and 266IL15 site-directed integration donor template plasmid.

EXAMPLE 4 identification of 266IL15 targeting to cells and exogenous Gene expression

1. Novel site-directed integration donor template plasmid 266IL15 targeting B6-hiPSCs

(1) A12-well plate was prepared, and 500. Mu.L of diluted Matrigel (Corning, cat. No. 354277) was added to each well, and the mixture was allowed to stand at room temperature for 12 hours or more.

(2) After the B6-hiPSCs were grown to 80% confluence, the supernatant was discarded, 1mL of mTESR1 Plus (Stem Cell, cat# 100-0276) was added, and Y27632 (Stem Cell, cat# 72302) was added at a final concentration of 10. Mu.M, and the cells were placed in an incubator.

(3) After 2h, the cells were removed and the supernatant was discarded after blowing the cells. Cells were rinsed once with 1 XPBS (Hyclone, cat. No. SH 30028.02), trypLE Select (Gibco, cat. No. 12563-011) was added to the bottom of the via and left at room temperature for 3min. Simultaneous removal of Nuclear transfer kit Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza, cat. No. VPH-5022, containing support 1 and Solution 2 reagents)

(4) TrypLE Select was aspirated, and the cells were gently scraped 2-3 times with 1mL mTESR1 Plus medium to completely shed the cells.

(5) The cells were counted with a modified Bob counter plate.

(6) Two 15mL centrifuge tubes were taken, the cell suspension was aliquoted from the well plate into the tubes and centrifuged at 170g for 5min.

(7) Two sterilized EP tubes were taken, 18. Mu.L of support 1 and 82. Mu.L of Solution 2 were added to each tube, gently mixed, and left to stand for 20min.

(8) 5. Mu.g of miniL 15 and 266IL15 plasmids were added to the EP tube, respectively, and 5. Mu.g of artificial nucleases TALENickases-L and TALENickases-R plasmids constructed by the present inventors were added, respectively (TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus, yong Wu, et al Biochem Biophys Res Commun.2014Mar 28;446 (1): 261-6.doi:10.1016/j.bbrc.2014.02.099, see paragraph "2.2.plasma", text listed in appendix.) were gently mixed and allowed to stand for 10min.

(9) The supernatant in the 15mL centrifuge tube was pipetted off, the cell pellet in the centrifuge tube was resuspended with the mixed solution in the EP tube, and the cell suspension was then carefully transferred to a nuclear rotor.

(10) The nuclear transfer instrument is opened, the nuclear transfer cup is placed into the nuclear transfer instrument, and nuclear transfer is started.

(11) Immediately after completion of nuclear transfer, 500. Mu.L of mTESR1 Plus was added thereto, and the mixture was allowed to stand for 5 minutes.

(12) Matrigel for coated well plates was pipetted.

(13) The cell suspension was inoculated and 10. Mu.M Y27632 was added.

(14) Shaking, standing in a cell incubator, and changing the liquid after 12h of nuclear transfer (using mTESR1 Plus medium containing 10 mu M Y27632).

(15) After 24h of nuclear transformation mTeSR1 Plus medium exchange was used. When the cell confluency reached 80%, medium containing G418 (Sigma, cat. A1720) was added for selection culture.

2. Obtaining positive monoclonal of 266IL15 site-directed integration

(1) Taking a 6cm cell culture dish, adding diluted Matrigel until the Matrigel is over the bottom, and standing at room temperature for more than 12 hours.

(2) The cells after nuclear transformation of miniIL15 and 266IL15 were removed, and the supernatant was discarded after pipetting. Rinsed once with 1 XPBS, added to TrypLE Select until the bottom is gone, and left at room temperature for 3min.

(3) TrypLE Select was aspirated, and the cells were gently scraped 2-3 times with 1mL mTESR1 Plus medium to completely shed the cells.

(4) Counting with a counting plate.

(5) A15 mL centrifuge tube was taken, 700. Mu.L of the clone supplement (Stem Cell, cat. No. 05888) and 7mLmTesR1 Plus medium were added and mixed upside down.

(6) Matrigel in a 6cm cell culture dish was discarded, and 3mL of mTESR1 Plus containing the cloneR supplement was taken and 500 cells were added thereto. Shaking, and culturing in a cell incubator.

(7) When cells in a 6cm dish grew to half a microscope field, 48 well cell culture plates were taken, diluted Matrigel was added until the bottom of the plates was gone, and coated overnight at room temperature.

(8) Matrigel in the well plate was discarded and an appropriate amount of mTeSR1 Plus was added until the bottom was cleared.

(9) Single cell clone with better growth state in a 6cm cell culture dish is selected under a lens, and is picked into a 48-hole cell culture plate by using a small Tip, marking is carried out, and each hole is inoculated with one clone. Culturing in a cell culture box.

(10) And (5) carrying out passage when the number of the monoclonal cells is increased. Monoclonal Cell gDNA was extracted using FastPure Cell/Tissue DNA Isolation Mini Kit (Vazyme, cat. DC 102-01).

(11) The sequences spanning the upstream homology arm region were PCR amplified, agarose gel electrophoresis, and PCR products sequenced as described above.

The primers and sequences used were as follows:

18S-2-F：GGCCCGAAGCGTTTACTTTGAA(SEQ ID NO:21)

screenL-R4：CTGCGTGCAATCCATCTTGTTC(SEQ ID NO:22)

based on the electrophoresis results and sequencing results (as shown in FIG. 5), a positive monoclonal was obtained that was targeted to the human IL15 CDS sequence containing the EF 1. Alpha. Promoter at the 5468 site of the rDNA region. After screening for 25 days by using G418, 31 monoclonal were selected from the cells of nuclear transfer miniIL15 and 266IL15, respectively, and PCR was used for site-directed integration identification, and sequencing was confirmed for the monoclonal identified as positive by PCR. It was identified that the site-directed integration efficiency of 266IL15 was 9/31 (29.03%) and that of miniIL15 was 9/31 (29.03%), i.e., the novel site-directed integration vector used shortened the downstream homology arm for increased homology, but the site-directed integration efficiency was not affected.

qRT-PCR detection of the expression of the Positive monoclonal foreign Gene mRNA

(1) Positive monoclonal cells were used to extract RNA, after the supernatant was aspirated, 1 x DPBS was rinsed twice, 1mL of pre-chilled Trizol (Invitrogen, cat No. 15596026) at 4 ℃ was added to each well, after 2min waiting the cells were gently blown down and the cell suspension transferred to sterile enzyme-free EP tubes.

(2) After 2min, 250. Mu.L of chloroform was introduced into the EP tube, and the mixture was left for another 5min after mixing. Put into a centrifuge and centrifuged for 10min at 13000 g.

(3) The supernatant was transferred to a new sterile enzyme-free EP tube and marked. Adding 0.5 times volume of isopropanol, mixing, and standing for 10min. Put into a centrifuge and centrifuged for 10min at 13000 g.

(4) The upper liquid was sucked off, 500. Mu.L of 75% ethanol was added to the tube, and after mixing, the mixture was left standing for a while, and the mixture was put into a low-temperature centrifuge pre-cooled in advance, and centrifuged at 13000g for 10min.

(5) The supernatant was removed by aspiration and the pellet was air dried.

(6) Add 20. Mu.L of sterile, enzyme-free ddH ₂ O was dissolved, and the concentration and OD were measured by Nanodrop 1000 and labeled on the vessel wall.

(7) RNA concentration was diluted to 30 ng/. Mu.L and reverse transcription was performed using HiScript II Q RT SuperMix for qPCR (+gDNA wind) (Vazyme, cat. No. R223-01) according to the protocol.

(8) To each tube of the reverse transcription product, 80. Mu.L of RNase-free ddH2O was added to dilute the cDNA and a subsequent qRT-PCR experiment was performed using ChamQ SYBR qPCR Master Mix (Vazyme, cat. No. Q711-02).

(9) The qRT-PCR system was as follows:

the primers and sequences used are shown in Table 4:

TABLE 4 Table 4

qRT-PCR reactions were performed as follows:

(10) The transcriptional expression of the IL15 gene was analyzed using Bio-Rad CFX Manager software.

The qRT-PCR detection result shows that the mRNA content of the positive monoclonal exogenous gene obtained by using the novel fixed-point integrated vector is higher, and the novel fixed-point integrated vector improves the expression capacity of the exogenous gene.

Western Blot detection of the expression of the foreign Gene of the Positive monoclonal

(1) Positive monoclonal cells of miniIL15 and 266IL15 are integrated in a fixed point in a 12-hole plate, the confluence degree reaches 90%, the culture medium is sucked and removed, and the cells are washed twice by 1 xDPBS;

(2) Adding 100 mu L of cell lysate and 1 mu L of PMSF into each well, gently scraping the cells by Tip, and lysing for 30min on ice;

(3) Cell lysates were transferred to EP tubes. Performing ultrasonic pyrolysis for 3-4 s/time, wherein each time is 5s apart, and the total time is 7-8 times;

(4) Centrifuging at 12000g for 10min at 4deg.C;

(5) The centrifuged supernatant was transferred to a new EP tube, using Pierce ^TM BCA Protein Assay Kit (Thermo Scientific, cat. 23225) kit for BCA protein quantification according to instructions;

(6) Preparation of SDS-PAGE gels: cleaning a glass plate, cleaning a gel-making glass plate with a detergent, washing with clear water, washing with ddH2O, drying with an electric hair drier, and preparing a separating gel and a concentrated gel according to instructions by using an SDS-PAGE gel preparation kit (product number 20328ES50 of the company of Hibiscus biological technology (Shanghai));

(7) Loading: placing the prepared SDS-PAGE gel in an electrophoresis tank, preparing fresh 1×running buffer, adding the fresh 1×running buffer into the electrophoresis tank, and adding prepared protein samples into the wells in sequence;

(8) Constant current 80V electrophoresis for 30min, and then 120V electrophoresis for 60min;

(9) Transferring: pre-preparing a1 x transfer buffer, pre-cooling in a refrigerator at-20 ℃, cutting a PVDF film, soaking in methanol for 5min, balancing in a film transfer solution for 20min, and performing film transfer operation;

(10) Constant voltage 252mA electrophoresis for 90min;

(11) Closing: after the film transfer is completed, soaking the PVDF film in 5% skimmed milk, and sealing for 1h in a shaking table;

(12) Diluting the primary antibody to a proper concentration by using TBST, covering a PVDF film, incubating overnight at 4 ℃, and washing 3 times by using a decolorizing shaker at room temperature by using TBST for 10min each time;

(13) Absorbing and discarding the primary antibody, adding the secondary antibody, incubating for 1h by a shaking table, and washing with TBST for 3 times, each time for 10min;

(14) And developing the protein bands.

As shown in FIG. 6, the results of Western Blot detection show that the IL15 protein expression amount of B6-hiPSCs is 1, wherein the IL15 protein relative expression amounts of positive monoclonal 266IL15 Clone 19, 266IL15 Clone 22 and 266IL15 Clone 26 of site-directed integration 266IL15 are relatively high, respectively 1.79+ -0.06, 1.89+ -0.32 and 1.83+ -0.41, and the IL15 protein relative expression amounts of three positive monoclonal IL15 proteins of site-directed integration miniIL15 are respectively 0.88+ -0.33, 0.62+ -0.43 and 0.51+ -0.55. Clone unintegrated Clone, which was not site-integrated with IL15, was a negative monoclonal, and the relative expression level of IL15 protein was 0.59.+ -. 0.24. Namely, the expression quantity of the positive monoclonal exogenous gene protein obtained by using the novel site-directed integration vector is higher.

Therefore, in the embodiment of the application, the expression capacity of the exogenous gene is improved by using the optimized site-directed integration template vector.

All publications and patents mentioned in this specification are herein incorporated by reference. Various modifications and variations of the described methods and compositions of the application will be apparent to those skilled in the art without departing from the scope and spirit of the application. Although the application has been described in terms of specific preferred embodiments, it should be understood that the application as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the application which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Reference is made to:

1.TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus，Biochem Biophys Res Commun.2014Mar 28；446(1):261-6.doi:10.1016/j.bbrc.2014.02.099.

2.Site-Specific Integration of TRAIL in iPSC-Derived Mesenchymal Stem Cells for Targeted Cancer Therapy，Stem Cells Transl Med.2022Mar 31；11(3):297-309.doi:10.1093/stcltm/szab031。

Claims

1. a gene editing construct comprising a construct scaffold comprising an upstream homology arm, a downstream homology arm, and a multiple cloning site between the upstream homology arm and the downstream homology arm;

the nucleotide sequence of the upstream homology arm is shown as SEQ ID NO. 2 or has at least 70%, at least 80%, at least 90%, at least 95% or at least 98% sequence identity with SEQ ID NO. 2, and the nucleotide sequence of the downstream homology arm is shown as SEQ ID NO. 4 or has at least 70%, at least 80%, at least 90%, at least 95% or at least 98% sequence identity with SEQ ID NO. 4; and

the construct scaffold is a non-viral scaffold.

2. The construct of claim 1, wherein the nucleotide sequence of the upstream homology arm is shown in SEQ ID No. 2 and the nucleotide sequence of the downstream homology arm is shown in SEQ ID No. 4.

3. Construct according to claim 1 or 2, comprising the nucleotide sequence as shown in SEQ ID No. 27.

4. A construct according to any one of claims 1 to 3, further comprising an exogenous gene at the multiple cloning site, the exogenous gene encoding a therapeutic peptide, a DNA binding protein, an RNA binding protein, a fluorescent protein or an enzyme.

5. The construct of claim 4, wherein the therapeutic peptide is selected from the group consisting of human interleukin family members (e.g., IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23, and IL-24), tumor necrosis factor family members (e.g., TNF, LTA, LTB, FASLG, TNFSF, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, and EDA), interferons (INF-a, INF- β, and INF- γ), CARs, F8, F9, TNFR, and TRAIL.

6. Construct according to any one of claims 1 to 5, further comprising a promoter located at the multiple cloning site, preferably the promoter is a CMV promoter or an EF1 a promoter.

7. A method of gene editing comprising introducing the construct of any one of claims 1 to 6 into a cell, and site-directed integration of an exogenous gene into the genome of the cell by a gene editing system.

8. The method of claim 7, wherein the gene editing system is selected from the group consisting of Cre-lox system, zinc Finger Nucleases (ZFNs), CRISPR-Cas9 or Transcription Activator-Like Effector Nucleases (TALENs), preferably TALENs, more preferably gene editing using artificial nucleases talencackases.

9. The method of claim 7 or 8, wherein the site-directed integration site is located at 5468 site of the ribosomal RNA transcription region (rDNA region) 18S rRNA transcription region of the genome.

10. The method according to any one of claims 7 to 9, wherein the cells are selected from mesenchymal stem cells, T cells, B cells, NK cells, macrophages or induced pluripotent stem cells and derived cells thereof.

11. The method of claim 10, wherein the induced pluripotent stem cell-derived cell is a mesenchymal stem cell, T cell, B cell, NK cell, macrophage, hematopoietic cell, endothelial cell, hepatocyte, cardiomyocyte, neuronal cell, or islet cell differentiated from the induced pluripotent stem cell.

12. The method of any one of claims 7 to 11, wherein the exogenous gene is selected from the group consisting of CAR gene, interleukin-15, interleukin-24, F8, F9, TNFR, and TRAIL.

13. A cell obtained after editing by the method of any one of claims 7 to 12.

14. A pharmaceutical composition comprising a construct according to any one of claims 1 to 6 or a cell according to claim 13 and a pharmaceutically acceptable adjuvant.

15. Use of a construct according to any one of claims 1 to 6 or a cell according to claim 13 in the manufacture of a medicament for the treatment of a tumor.