WO2022242623A1 - Cell expressing trail, preparation method therefor and application thereof - Google Patents

Abstract

The present invention relates to a TALEN/TALENickase-mediated non-viral gene targeting plasmid, and an iPSCs stem cell with the N-terminus being fused with an isoleucine zipper and integrated with a TRAIL expression cassette, and an application thereof. The sequence of the plasmid is represented by SEQ ID NO:1. The plasmid, when used in combination with gene editing tool TALEN, may achieve site-directed integration of therapeutic gene TRAIL. The risk of random integration of viral vectors is avoided, and the continuity and the high level of gene expression are ensured. Since the present invention uses iPSCs with site-directed integration of TRAIL as the source of MSCs, the limitation of tissue-derived MSCs is overcome, the tissue-derived MSCs can be obtained continuously, and the method has applicability and economic value. TRAIL-iMSCs can continuously express TRAIL, has the effect of inducing apoptosis of various types of tumor cells, and exhibits potential in anti-tumor applications.

Description

Cell expressing TRAIL, preparation method and application

This application claims the priority of the Chinese patent application submitted to the China Patent Office on May 17, 2021, with the application number 202110533654.0, and the title of the invention is "Plasmid, Stem Cells and Applications", and the application number submitted on May 17, 2021 is PCT /CN2021/094149, the priority of the PCT international patent application titled "Plasmid, Stem Cell and Application", the entire content of which is incorporated in this application by reference.

technical field

The invention relates to a non-viral gene plasmid mediated by TALEN/TALENickase, an iPSCs stem cell integrated with a TRAIL expression framework fused with an isoleucine zipper at the N end and an application thereof.

Background technique

Based on the tropism and low immunogenicity of mesenchymal stem/stromal cells (MSCs) to the tumor microenvironment, both natural MSCs and genetically modified MSCs are widely used in the research and application of tumor therapy. A large number of existing studies have shown that the use of viral vector gene transduction of MSCs targeted therapy of cancer is effective. However, the loss of pluripotency and proliferative ability of MSCs derived from adult organ tissues after serial passage in vitro, the non-sustained expression or insufficient expression of therapeutic genes, and the potential risk of viral genome insertion have seriously hindered their clinical application. Our strategy avoids the risk of viruses and the limitations of primary MSCs, designed and constructed human induced pluripotent stem cells with site-specific integration of TRAIL, and prepared TRAIL-MSCs therapeutic agents with tumor-suppressing effects. This strategy has the advantages of providing unlimited sources, stable quality, high homogeneity, and relatively controllable TRAIL-integrated mesenchymal stem cells for the individual needs of different patients. It can realize industrial production and has the characteristics of broad clinical application and market prospects.

In recent years, both preclinical research and clinical trials of cancer treatment have shown great enthusiasm for cell-based therapeutic strategies. Among them, mesenchymal stem cells (MSCs) have become an excellent cell carrier for delivering anti-cancer genes/drugs to malignant tumor cells due to their tropism to in situ and metastatic tumors and low immunogenicity, and are widely used. Used in in vitro and in vivo cancer models and clinical trials ^[1-2] . A large number of studies have shown that gene-modified MSCs carrying suicide genes, anti-oncogenes or oncolytic adenoviruses are an effective strategy for targeted therapy of cancer ^[3] .

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the TNF superfamily, which can selectively and preferentially induce tumor cell apoptosis by activating specific receptors (DR4/DR5), but has no toxicity to normal cells Therefore, it is a potential anticancer molecule ^[4-5] . A large number of existing studies have demonstrated that TRAIL-engineered MSCs can target the tumor microenvironment and effectively exert anticancer activity in various cancers. Viral vectors are the most commonly used gene therapy vectors and are widely used in clinical trials of cancer treatment. More and more studies have shown that it is effective to use viral vectors to load therapeutic gene TRAIL into MSCs ^[6-7] . However, these studies have shown that there is a non-sustained or underexpressed defect in the therapeutic gene.

Induced pluripotent stem cells (iPSCs) are pluripotent stem cells induced by adult cells through reprogramming technology, which can be cultured and expanded in large quantities in vitro, and can continuously produce a large number of different types of cells through directional induced differentiation. In clinical research and treatment ^[9-10] . Therefore, iPSCs have gradually become the best source for obtaining MSCs. iPSC-derived MSCs have similar advantages to iPSCs: (1) can be induced from autologous skin fibroblasts or cells from various tissue sources, avoiding immune rejection, disease infection, ethics and other related issues caused by allogeneic transplantation; (2) ) iPSCs can be passed down indefinitely in principle, so MSCs derived from them can also be continuously obtained; (3) MSCs derived from a single iPSC cell clone theoretically have higher homogeneity. Based on the above characteristics, iPSCs can be used as an unlimited source of MSCs to meet the individual needs of patients, and solve the obstacles of limited sources, unstable quality, and low homogeneity of intermediate mesenchymal stem cells in clinical use.

MSCs derived from iPSCs have been used in several clinical trials, including graft-versus-host disease (GvHD), critical limb ischemia (CLI) and osteoarthritis, and COVID-19 intensive care unit (ICU) patients, etc., confirming that iPSCs-derived MSCs are safe and well tolerated ^[11] . It reveals that iPSCs-derived MSCs have a broad application range and market prospects, and there is currently no report that genetically modified iPSCs-derived MSCs have entered clinical trials.

Contents of the invention

The inventors unexpectedly discovered in the research that by integrating a polynucleotide encoding TRAIL protein or its variants in the ribosomal RNA transcription region of induced pluripotent stem cells (iPSCs), induced pluripotent stem cells stably expressing TRAIL protein or its variants can be obtained (TRAIL-iPSCs). The construction method has high integration efficiency, and it is easy to obtain a large number of iPSCs integrating the target polynucleotide for subsequent screening of monoclonal cell lines, and the stable iPSCs obtained by screening can express TRAIL protein or its variants continuously and for a long time. The TRAIL-iPSCs maintain the differentiation potential of directed differentiation into different cell types, and can be differentiated into mesenchymal stem cells (TRAIL-iMSCs) stably expressing TRAIL protein or its variants, and the TRAIL-iMSCs can effectively induce tumor cell Apoptosis can be used for tumor or cancer therapy.

In a first aspect, the present invention provides a method for constructing induced pluripotent stem cells (iPSCs) stably expressing a TRAIL protein or a variant thereof, comprising integrating a polynucleotide encoding a TRAIL protein or a variant thereof into the induced pluripotent stem cell The ribosomal RNA transcribed region of the genome.

The term "gene editing" refers to the editing (directed transformation) of the target gene and its transcription products to achieve the addition and deletion of specific DNA fragments, the deletion and replacement of specific DNA bases, etc., in order to change the sequence of the target gene or regulatory elements, expression or function.

In some embodiments, the integration is carried out by gene editing, and all gene editing techniques known in the prior art can be used in the present invention, as long as the site-specific integration of the target polynucleotide can be achieved, such as Cre-lox system, Zinc Finger Nucleases (ZFN), CRISPR or TALEN, preferably CRISPR or TALEN, more preferably TALEN/TALENickase-mediated gene editing. The Cre-Lox system is a recombinase system found in P1 phage. By using the mechanism of recombinase Cre to specifically recognize the LoxP recombination site, genes such as gene knockout, inversion and translocation can be achieved in target cells and tissues. Edit function. ZFNs (zinc-finger nucleases) are composed of a zinc finger protein domain that determines its specificity and a Fok I nuclease domain that cuts DNA, and is an artificial nuclease. The CRISPR system is mainly composed of Cas9 protein and single-stranded guide RNA (sgRNA), in which the Cas9 protein plays the role of cutting DNA double strands, and the sgRNA acts as a guide. Under the guidance of the sgRNA, the Cas9 protein can be Different target sites are cleaved to achieve double-strand breaks in DNA. The core of TALENs (transcription activator-like effector nucleases) technology is the TALE protein. The main structure of the TALE protein is divided into three parts, including: the tandem repeat sequence (Repeat domain) of the central domain, the nuclear localization signal and the acidic transcription activation domain , where the tandem repeat sequence of the central domain is the region where TALENs technology specifically recognizes DNA sequences.

In some embodiments, the ribosomal RNA transcribed region is selected from the transcribed region of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcribed region of 18S rRNA.

The term "ribosomal RNA transcribed region" refers to a region of the genome that can be transcribed into ribosomal RNA (rRNA). The ribosomal RNA transcription region has multiple copies in the genome. Among the four rRNA genes in the human genome, the 18S, 5.8S and 28S rRNA genes are connected in series, and each gene is separated by a spacer, with hundreds of copies The 5S rRNA gene is on another chromosome, with about 500 copies arranged in series on the chromosome.

Since the ribosomal RNA transcription region has multiple copies, selecting the ribosomal RNA transcription region as the integration site, that is, the site of gene editing, greatly improves the efficiency of gene editing, and can quickly obtain a large number of candidate cells carrying the target gene. In addition, since the ribosomal RNA transcription region has multiple copies, the presence of an integrated target gene in some copies will not affect the normal transcription level of ribosomal RNA. In addition, the ribosomal RNA transcription region does not encode proteins, nor does it regulate gene expression, and integration in some copies will not affect the original protein expression of the cell.

In some embodiments, the integration occurs at a specific site, which can be a different location in the transcribed region of the ribosomal RNA. Preferably, the integration occurs at position 5468 of the 18S rRNA transcribed region. The "5468 position of the 18S rRNA transcribed region" or "5468 position" mentioned herein have the same meaning and can be used interchangeably. "5468 site" refers to the +5468 site of the 18S rRNA gene.

The term "TRAIL protein or variant thereof" and "TRAIL protein" are used interchangeably herein to refer to wild-type TRAIL protein or various variants that perform the same function as wild-type TRAIL protein, and the variants may be wild-type Insertion, deletion or replacement of one or more amino acids in the amino acid sequence of the TRAIL protein may also be a fusion protein. In some embodiments, the TRAIL protein is ILZ-TRAIL (SEQ ID NO:8).

In some embodiments, the method for constructing an induced pluripotent stem cell stably expressing a TRAIL protein or a variant thereof comprises the following steps:

1) inserting the polynucleotide encoding the TRAIL protein or its variant into a vector targeting the ribosomal RNA transcription region, preferably a mini-pHrneo vector;

2) introducing the vector obtained in step 1) into iPSCs; and

3) Screening the iPSCs obtained in step 2) to obtain a stable cell line carrying the polynucleotide encoding the TRAIL protein or a variant thereof in the ribosomal RNA transcription region.

The present invention also provides iPSCs stably expressing TRAIL protein or its variants produced by said method, also referred to herein as TRAIL-iPSCs.

In a second aspect, the present invention provides a kind of iPSCs (TRAIL-iPSCs) stably expressing TRAIL protein or its variants, wherein the ribosomal RNA transcription region of the genome of the iPSCs is integrated with the TRAIL protein or its variants of polynucleotides.

In some embodiments, the ribosomal RNA transcribed region is selected from the transcribed region of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcribed region of 18S rRNA.

In some embodiments, the integration is at a specific site located at position 5468 of the 18S rRNA transcribed region.

In some embodiments, the TRAIL protein or variant thereof is selected from ILZ-TRAIL, FLAG-TRAIL, His-TRAIL, Leucine Zipper TRAIL (IZ-TRAIL), TNC-TRAIL, ScFv:TRAIL (such as CD19:TRAIL, EGFR:TRAIL) and TRAIL mutants (such as D269H mutant and S159R mutant), preferably ILZ-TRAIL (SEQ ID NO:8).

The present invention also provides a kind of TRAIL-iPSCs, which was preserved in China Center for Type Culture Collection with the preservation number CCTCC NO: C2021120 on May 12, 2021.

In a third aspect, the present invention provides the use of the TRAIL-iPSCs in preparing differentiated cells stably expressing TRAIL protein or its variants, such as differentiated NK cells, T cells or mesenchymal stem cells, preferably mesenchymal stem cells .

The present invention provides the use of the TRAIL-iPSCs and differentiated cells thereof in the preparation of medicines for treating tumors or cancers. The present invention also provides a pharmaceutical composition for treating tumor or cancer, which comprises the TRAIL-iPSCs described in the second aspect and the differentiated cells described in the third aspect.

In a fourth aspect, the present invention provides a kind of mesenchymal stem cells (TRAIL-iMSCs) stably expressing TRAIL protein or its variants, wherein the ribosomal RNA transcription region of the genome of the mesenchymal stem cells is integrated with the A polynucleotide of a TRAIL protein or variant thereof.

In some embodiments, the TRAIL-iMSCs are differentiated from the TRAIL-iPSCs.

In some embodiments, the ribosomal RNA transcribed region is selected from the transcribed region of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcribed region of 18S rRNA.

In some embodiments, the integration is at a specific site located at position 5468 of the 18S rRNA transcribed region.

In some embodiments, the TRAIL protein or variant thereof is selected from ILZ-TRAIL, FLAG-TRAIL, His-TRAIL, Leucine Zipper TRAIL (IZ-TRAIL), TNC-TRAIL, ScFv:TRAIL (such as CD19:TRAIL, EGFR:TRAIL) and TRAIL mutants (such as D269H mutant and S159R mutant), preferably ILZ-TRAIL (SEQ ID NO:8).

The present invention also provides a kind of TRAIL-iMSCs, which was preserved in the China Center for Type Culture Collection with the preservation number CCTCC NO: C2021121 on May 12, 2021.

In the fifth aspect, the present invention provides the use of the TRAIL-iMSCs in the preparation of a drug for treating tumor or cancer. The present invention also provides a pharmaceutical composition for treating tumor or cancer, which comprises the TRAIL-iMSCs described in the fourth aspect.

In the sixth aspect, the present invention provides a method for treating tumor or cancer, comprising administering the TRAIL-iPSCs described in the second aspect, the differentiated cells described in the third aspect and/or the TRAIL-iPSCs described in the third aspect to a subject in need thereof. TRAIL-iMSCs described in four aspects.

The present invention provides a non-viral gene plasmid mediated by TALEN/TALENickase, an iPSCs stem cell integrated with a TRAIL expression framework fused with an isoleucine zipper at the N-terminal and its application

Some technical solutions of the present invention are as follows:

A plasmid, the sequence of the plasmid is shown in SEQ ID NO:1. SEQ ID NO: 1 is a mini-pHrneo vector carrying the ILZ-TRAIL coding sequence, the sequence is as follows:

Wherein the amino acid sequence encoded by the ILZ-TRAIL coding sequence is:

MKQIEDKIEEILSKIYHIENEIARIKKLIGEREFVRERGPQRVAAHITGTRGRRSNTLSSPNSKNEKALGRKINSWESSRSGHSFLSNLHLRNGELVIHEKGFYYIYSQTYFRFQEEIKENTKNDKQMVQYIYKYTSYPDPILLLMKSARNSCWSKDAEYVGLYSIYQGGGIFELKENDRID8VSVTNEH(

The plasmid uses a sequence of 1531bp from +4533 to +6064 in the upstream and downstream of human rDNA transcription region 5468 as the homology arm sequence. The length of the left homology arm (LHA) is 935bp, and the right homology arm (RHA) It is 591bp; between the two homologous arms contains a promoterless resistance selection gene NEO expression box with a pair of loxP sequences on both sides.

The right homology arm (RHA) sequence is:

The left homology arm (LHA) sequence is:

A method for constructing a plasmid, the plasmid is based on a non-viral human ribosomal DNA (hrDNA) targeting vector, and the CMV promoter-driven ILZ-TRAIL (AA.114-281) (PLoS One.2009; 4(2):e4545.doi:10.1371/journal.pone.0004545.Epub 2009 Feb 20) The expression frame was inserted into the restriction enzyme site of the backbone and constructed.

Preferably, the non-viral human ribosomal DNA targeting vector is mini-pHrneo (Oncotarget, 2017, Vol.8, (No.25), pp:40791-40803, Enhanced tumor growth inhibition by mesenchymal stem cells derived from iPSCs with targeted integration of interleukin24 into rDNA loci).

Non-viral human ribosomes have been disclosed in published dissertations (Liu Bo. Human iPSCs ribosomal gene region IL24 gene targeting and anti-tumor research on differentiated MSCs [D]. Changsha: Central South University, 2017: 19-25) Specific structure of the DNA (hrDNA) targeting vector mini-pHrneo.

The reason why this backbone is used in the present invention is that this vector has significantly shortened homology arms compared to other non-viral vectors. Thus, a plasmid of suitable size will be obtained, which is smaller than ordinary plasmids, thereby improving the targeting efficiency. However, the plasmid should not be too small, otherwise the difficulty of targeting will increase.

The restriction enzyme cutting site can be the enzyme cutting site corresponding to conventional restriction enzymes such as BamH1, Nhe1, Xba1, etc., as shown in FIG. 18 .

Preferably, other TRAIL variants can also realize site-directed integration of rDNA regions, for example, TRAIL variants such as IZ-TRAIL, TNC-TRAIL, HSA-TRAIL, PEG-TRAIL, Fc-sc-TRAIL and other N-terminal fusion forms , help to improve the stability and lethality of TRAIL. High-affinity receptor variants of TRAIL include TRAIL variants containing a single amino acid mutation S159R with high affinity for DR4, TRAIL variants containing an amino acid mutation D269H with high affinity for DR5, and the like. All of the above TRAIL variants can be integrated in the rDNA region by the technical route of the present invention, and have a certain tumor-suppressing effect.

However, ILZ-TRAIL (AA.114-281) has stronger antitumor effect than sTRAIL (AA.114-281), because:

The fusion of ILZ can promote and stabilize the trimerization of TRAIL and improve the toxicity to tumor cells. And the present invention has also proved this point by many tests.

A human induced pluripotent stem cell TRAIL-iPSCs, the preservation number of the stem cell TRAIL-iPSCs is CCTCC NO: 2021120, preserved in the China Center for Type Culture Collection, the preservation time is May 12, 2021, and the preservation address is Hubei, China Wuhan University, Wuhan City, Province.

A method for constructing the above-mentioned stem cell TRAIL-iPSCs is obtained by performing single-cell nuclear transfer (Nucleofector) on iPSCs (induced pluripotent stem cells) with the above-mentioned plasmid.

A directed differentiation cell, which is obtained by directed differentiation of stem cells TRAIL-iPSCs.

Preferably, the directionally differentiated cells can be various types of cells, such as endothelial cells, lymphocytes, stem cells, etc., and the differentiated cells can secrete TRAIL to exert the inhibitory effect on tumor cells.

A mesenchymal stem cell TRAIL-iMSCs derived from human induced pluripotent stem cells, the preservation number of the stem cell TRAIL-iMSCs is CCTCC NO: 2021121, and it is preserved in the China Center for Type Culture Collection, and the preservation time is May 12, 2021 , and the depository address is Wuhan University, Wuhan City, Hubei Province, China.

A method for constructing the above-mentioned stem cell TRAIL-iMSCs, which is obtained by directional differentiation of the stem cell TRAIL-iPSCs clone.

Preferably, stem cell TRAIL-iPSC clones are directedly differentiated into stem cell TRAIL-iMSCs using STEMdiff ^TM Mesenchymal Progenitor Kit (Catalog #05240) from Stem Cell Company.

The present invention also provides the application of the above-mentioned plasmid, the above-mentioned stem cell TRAIL-iPSCs, the above-mentioned directed differentiation cell or the above-mentioned stem cell TRAIL-iMSCs in the preparation of a drug or a kit for treating tumors.

The present invention also provides a drug or kit for treating tumors, the drug or kit contains the above-mentioned plasmid, the above-mentioned stem cell TRAIL-iPSCs, the above-mentioned directed differentiation cells or the above-mentioned stem cell TRAIL-iMSCs.

The present invention is further explained below:

The existing strategies for preparing engineered MSCs mainly have the following disadvantages:

1. Currently, viral vectors are used to prepare engineered TRAIL-MSCs: when using viral vectors, potential immune responses and unexpected genome integration events should be strictly considered.

The viral vector-mediated random integration strategy has the risk of potential immune response and unexpected genome integration events, and the expression of the integrated gene TRAIL has unstable/insufficient defects: viral vector-mediated random integration of therapeutic genes into the genome, therapeutic gene The expression of the virus may be affected by the position effect, resulting in non-sustained expression or insufficient expression; the random insertion of the viral genome into other endogenous gene sites may destroy the expression of endogenous genes or activate harmful genes that were not originally expressed. All of the above have seriously hindered the progress of clinical application of engineered TRAIL-MSCs.

Our strategy is to use the gene editing tool TALEN and homologous recombination to prepare cells that integrate TRAIL at the rDNA site, avoiding the risk of viruses, and sustainably and stably expressing TRAIL at a high level.

2. MSCs currently used in clinical trials are all derived from adult tissue (bone marrow, fat) or umbilical cord:

Even MSCs that meet the minimum qualification criteria specified by the ISCT (International Society for Cellular Therapy) often exhibit significant batch-to-batch variability in phenotype and function based on donor, tissue source, culture conditions, and passage Even in the same cell population, obvious heterogeneity can be observed, which makes the reproducibility of experiments/results challenged, and the evaluation standard is difficult to unify; in addition, invasive acquisition methods (except umbilical cord source) will also make The potential of MSCs for clinical translation is greatly reduced.

Our strategy is to induce differentiation of hiPSCs with rDNA site-specific integration of TRAIL into TRAIL-iMSCs. The derived MSCs have the advantages of good uniformity, stable quality and unlimited yield.

3. The TRAIL protein fused with isoleucine zipper (ILZ) at the N-terminus has been confirmed in multiple reports for its anti-tumor function (see references 13-16 for details), and the fusion of ILZ can promote and stabilize Trimerization of TRAIL increases cytotoxicity. The current studies are virus-mediated ILZ-TRAIL therapy (see references 17-19 for details) or anti-tumor studies of virus-mediated ILZ-TRAIL transduction of MSCs (see references 20-22 for details). Likewise, limitations of viral vectors and primary MSCs cannot be avoided.

Our strategy is to target the TRAIL protein expression cassette with N-terminal fusion isoleucine zipper into therapeutic cells in a site-specific way, so as to overcome the above-mentioned shortcomings.

In order to realize the safe, stable and effective expression of TRAIL in MSCs, we constructed a non-viral gene targeting system mediated by TALEN/TALENickase. In the present invention, the N-terminal can be efficiently fused with isoleucine zipper (isoleucine zipper) The TRAIL expression framework was integrated into the ribosomal DNA (rDNA) locus of human iPSCs. Subsequently, after obtaining site-directed integration of TRAIL-iPSCs, a large number of therapeutic TRAIL-MSCs can be obtained through directed differentiation.

Based on the above research progress and existing technical obstacles, the present invention provides a method and cell preparation for preparing standardized, normalized, stable quality, and relatively controllable therapeutic-grade TRAIL-MSCs, which will have broad application prospects and market value.

The invention avoids the risks brought by virus transduction tissue-derived MSCs and overcomes the limitations of objective existence, and uses gene editing technology to realize the precise addition of TRAIL gene in the rDNA region of hiPSCs, and induces the differentiation of TRAIL-iPSCs to TRAIL-iMSCs , can obtain a steady stream of MSCs with good uniformity and stable expression of TRAIL, which has clinical application value and the prospect of large-scale production.

Concrete train of thought and flow process of the present invention are as shown in Figure 5, specifically as follows:

(1) Construction of rDNA region targeting vector mini-pHrneo-ILZ-TRAIL

The rDNA region targeting vector mini-pHrneo-ILZ-TRAIL uses a 1531bp sequence from +4533 to +6064 upstream and downstream of the 5468 site of the human rDNA transcription region as the homology arm sequence, and the length of the left homology arm (LHA) is 935bp , the right homology arm (RHA) is 591bp. Between the two homologous arms of the vector, there is a promoter-free NEO expression cassette with a pair of loxP sequences on both sides and an ILZ-TRAIL (AA.114-281) expression cassette driven by a CMV promoter. The final product was confirmed by Sanger sequencing, and no mutation occurred.

The main components of the carrier are shown in Figure 1.

(2) Culture and targeting of iPSCs

Human iPSCs were seeded in well plates pre-coated with Matrigel, and maintained daily culture with mTeSR1 from Stem Cell Company. The iPSCs used for nuclear transfer targeting should be of low passage and good morphology.

The mini-pHrneo-ILZ-TRAIL combined with TALEN/TALENickase targets specific sites in the rDNA region, and the targeting schematic diagram is shown in Figure 4.

(3) PCR identification: identified hiPSCs clones with site-specific integration of ILZ-TRAIL

After a period of G418 screening of the nuclear-transferred hiPSCs, only the cell clones grow to an appropriate size, and the single clones are picked out by mechanical methods. These cell clones are called G418-resistant clones. Firstly, suitable primers were designed, the gDNA of these clones were identified by PCR, and the PCR products were sequenced to further confirm the site-specific integration of ILZ-TRAIL in the rDNA region. The obtained TRAIL-iPSCs clones were expanded in vitro and karyotyped.

(4) Directed differentiation into TRAIL-iMSCs

According to the instructions of Stem Cell's STEMdiff ^TM Mesenchymal Progenitor Kit (Catalog #05240), TRAIL-iPSC clones can be directedly differentiated into TRAIL-iMSCs, and their morphology can be observed and identified.

(5) TRAIL protein expression level of TRAIL-iPSCs and TRAIL-iMSCs

The cell lysate of TRAIL-iPSCs and TRAIL-iMSCs was taken for WB to detect the expression level of TRAIL in the lysate.

(6) Induce apoptosis of various tumor cells

After the tumor cells were co-cultured with iMSCs or TRAIL-iMSCs for 72 hours, the apoptosis of tumor cells was detected by flow cytometry.

The beneficial effects of the present invention are:

(1) The present invention utilizes the gene editing tool TALEN to realize the site-specific integration of the therapeutic gene TRAIL, avoiding the risk caused by the random integration of viral vectors, and ensuring the sustained and high level of therapeutic gene expression.

(2) The present invention uses iPSCs with fixed-point integration of TRAIL as the source of MSCs, which overcomes the limitations of tissue-derived MSCs, can be continuously obtained, and has applicability and economic value.

(3) TRAIL-iMSCs express TRAIL sustainably, which has the effect of inducing apoptosis on a variety of tumor cells, showing the application potential of anti-tumor.

(4) Through the previous data verification, the rDNA targeting vector can target iPSCs with the assistance of the gene editing tool TALEN/TALENickase, and the targeting efficiency is higher than that of other sites previously reported, which has the advantage of high efficiency ^[12] .

(5) The targeted TRAIL-iMSCs were passaged multiple times, and the detection of karyotype and stem cell markers showed that targeting the rDNA region can not only stabilize inheritance, but also not change the biological characteristics of stem cells, which is stable and safe advantage.

(6) The expression level of TRAIL-iMSCs with site-specific integration of rDNA region of the present invention is higher than that of virus-integrated TRAIL-MSCs. On the one hand, prior art (Sun, X.Y., et al., MSC(TRAIL)-mediated HepG2 cell death in direct and indirect co-cultures. Anticancer Res, 2011.31(11):p.3705-12.) utilizes plasmid transient After transfecting MSCs, the TRAIL secretion level of MSCs-sTRAIL was only about 3 times higher than that of untransfected MSCs, while the TRAIL secretion level of TRAIL-iMSCs involved in the present invention was about 5 times higher than that of BMSCs (as shown in Figure 16). In other studies using adenovirus-transduced TRAIL-MSCs, the expression level of TRAIL would gradually decrease over time (Park, S.A., et al., Combination treatment with VPA and MSCs-TRAIL could increase anti-tumor effects against intracranial glioma. Oncology reports, 2021.45(3): p.869-878.). However, the continuous passage in vitro of TRAIL-iMSCs obtained by the non-virus site-specific integration strategy in the present invention will not affect the expression of TRAIL protein in cells (as shown in FIG. 15 ). On the other hand, the present application has also verified this point through multiple tests.

Description of drawings

Figure 1 is a schematic diagram of the main components of the vector mini-pHrneo-ILZ-sTRAIL and mini-pHrneo-flTRAIL vectors;

Figure 2 shows the detection of TRAIL protein expression in the cell supernatant after mini-pHrneo-ILZ-sTRAIL and mini-pHrneo-flTRAIL were transfected into HEK293T cells;

Figure 3 is normal cultured hiPSCs;

Figure 4 is a schematic diagram of rDNA region targeting;

Fig. 5 is the flowchart of the scheme of the present invention;

Fig. 6 is the cycle condition figure of PCR;

Figure 7 is the PCR identification of hiPSCs clones with site-specific integration of ILZ-TRAIL;

Fig. 8 is the sequencing identification of PCR product;

Figure 9 is Southern Blotting identification of TRAIL-iPSCs;

Figure 10 is the karyotype identification of TRAIL-iPSCs (left) and hiPSCs (right);

Figure 11 is the cell morphology of iMSCs and TRAIL-iMSCs;

Figure 12 shows the results of flow cytometric analysis of TRAIL-iMSC surface markers;

Figure 13 is the identification of iMSC multi-lineage differentiation potential;

Figure 14 is the protein expression detection of TRAIL-iPSCs;

Figure 15 is the detection of protein expression of different passages of TRAIL-iMSCs;

Figure 16 is ELISA detection of TRAIL expression level in cell culture supernatant, (A) iPSCs, (B) iMSCs;

Figure 17 is the apoptosis induced by TRAIL-iMSCs in A375, A549, MCF-7 and HepG2 cells;

Figure 18 is a restriction multiple cloning site map of the Mini-pHrneo vector.

Detailed ways

Example 1

(1) Construction of rDNA region targeting plasmids mini-pHrneo-ILZ-TRAIL and mini-pHrneo-flTRAIL (full-length TRAIL)

Because TRAIL needs to be hydrolyzed into the blood circulation and bind to its receptor to activate the channel transduction pathway of target cells, the present invention hopes to select a TRAIL variant that is easier to secrete extracellularly than full-length membrane-type TRAIL. The TRAIL variant selected in the present invention is ILZ-TRAIL (AA.114-281).

The present invention is based on the non-virus mentioned in the published dissertation (Liu Bo. Human iPSCs ribosomal gene region IL24 gene targeting and anti-tumor research of MSCs [D]. Changsha: Central South University, 2017: 19-25). The human ribosomal DNA (hrDNA) targeting vector mini-pHrneo is used as the backbone. This plasmid uses a sequence of 1531bp in length from +4533 to +6064 upstream and downstream of the 5468 site of the human rDNA transcription region as the homology arm sequence, and the left homology The length of the arm (LHA) is 935bp and the right homology arm (RHA) is 591bp. Between the two homologous arms of the vector, there is a promoterless NEO expression cassette with a pair of loxP sequences on both sides. In the present invention, the CMV promoter-driven ILZ-TRAIL (AA.114-281) expression cassette is inserted into the BamH1 restriction site of mini-pHrneo to construct minipHrneo-ILZ-TRAIL, and the final product is identified by Sanger sequencing. The schematic diagram of the main components of the carrier is shown in Figure 1.

At the same time, the flTRAIL expression cassette driven by the CMV promoter was inserted into the BamH1 restriction site of mini-pHrneo to construct mini-pHrneo-flTRAIL. The foreign expression cassette can be inserted into the restriction multiple cloning site of mini-pHrneo (Figure 18), and the multiple cloning site can be designed and selected by the operator.

(2) The constructed plasmid was transfected into HEK293T cells and the expression of TRAIL protein in the cell culture supernatant was detected by Western blot

2.1 Take a 6-well cell culture plate, inoculate 8×10 ⁵ HEK293T cells in each well, shake well, put it in a cell culture incubator, and change the medium every other day.

2.2 When the cells grow to 90% confluence, use lipo2000 to transfect the minipHrneo-ILZ-TRAIL plasmid and mini-pHrneo-flTRAIL plasmid into HEK293T cells respectively;

2.3 The cell supernatant was collected 72 hours after transfection, and the expression level of TRAIL protein in the cell supernatant was detected by Western Blot. The results are shown in Figure 2. In the cell culture supernatant, the transfected minipHrneo-ILZ-TRAIL plasmid group expressed TRAIL protein The amount was significantly higher than that of the transfection mini-pHrneo-flTRAIL plasmid group, therefore, we used the minipHrneo-ILZ-TRAIL plasmid in subsequent experiments.

(3) Culture of iPSCs and iPSCs targeting (mini-pHrneo-ILZ-TRAIL, TALEN/TALENickase mediated)

Human iPSCs were cultured in pre-coated Matrigel well plates and maintained daily culture with Stem Cell's mTeSR1. The iPSCs used for nuclear transfer targeting should be low-passage and well-formed. The morphology of normally cultured hiPSCs is shown in Figure 3.

The single-cell nucleotransfer of iPSCs was performed using the Amaxa Human Stem Cell Nucleofector Starter Kit from LONZA. The schematic diagram of targeting the rDNA region is shown in Figure 4. Pre-warm the kit at room temperature for 30 minutes before nuclear transfer.

3.1 2 hours before nucleotransfer, the iPSCs culture dish was replaced with fresh medium, and a final concentration of 10 μM Y27632 (STEMCELL Technologies, #72304) was added.

3.2 Discard the mTeSR1 medium (STEMCELL Technologies, #85850), and wash the cells twice with 1×DPBS.

3.3 Add 1-2mL TrypLE Express to digest the cells at room temperature for 3 minutes, gently tap the culture dish, observe under the microscope and find that the cells become round and sticky, discard the TrypLE Express, add 3mL mTesR1 medium and blow down the cells.

3.4 Blow down the cells fully and resuspend into a single cell suspension. After counting the cells, centrifuge at 175g for 5min at room temperature.

3.5 After the supernatant was discarded, 1×DPBS was added to resuspend the cells, and 3×10 ⁶ cells were divided into 15mL centrifuge tubes, and centrifuged again at room temperature at 175g for 5min.

3.6 Prepare the nuclear transfer solution while centrifuging, add 82 μL Solution2 and 18 μL Supplement1 to a 1.5mL EP tube, and mix 5 μg of the targeting plasmid mini-pHrneo-ILZ-TRAIL and the nucleic acid tool enzyme TALEN/TAlENickases designed to target the rDNA site ^{[ 12]} 5 μg of each was added to it, mixed evenly, and allowed to stand at room temperature for 5 minutes.

3.7 Discard the supernatant in the centrifuge tube, resuspend the iPSCs with the nuclear transfer solution containing the mixed plasmids, and transfer them to the LONZA nuclear transfer cup, and pay attention not to generate air bubbles in the cup during the transfer.

3.8 Cover the nuclear transfer cup tightly and put it into the nuclear transfer instrument (LONZA, 2B), and select the nuclear transfer program B-016 for nuclear transfer.

3.9 Immediately after the nuclear transfer is completed, add 500 μL mTeSR1 to the nuclear transfer cup, mix gently with a disposable plastic tip to neutralize the cells, and incubate at 37°C for 5 minutes.

3.10 Inoculate the nucleated iPSCs into a well plate pre-coated with Matrigel, add fresh mTeSR1 medium, and add Y27632 at a final concentration of 10 μM, shake well and place in a constant temperature incubator at 37°C with 5% CO ₂ saturated humidity nourish.

3.11 Change the fresh medium 12 hours after nucleotransfer and add Y27632 at a final concentration of 10 μM again, and observe the cell adhesion under the microscope. Subsequently, the medium was replaced with fresh medium every day.

(4) Screening and identification of targeted iPSCs

4.1 Screening of G418-resistant cell clones:

4.1.1 The iPSCs after nuclear transfer were replaced with fresh mTeSR1 medium every day, and the cell morphology and density were observed under the microscope.

4.1.2 On the 3rd to 4th day after nuclear transfer, when the cell density reaches 50-60%, replace the mTeSR1 medium containing G418 with a final concentration of 50 μg/mL every day to screen the cells.

4.1.3 After continuous 4-5 days of G418 drug screening, cells without NEO gene integration gradually fall off and die, and only a small part of resistant clones can survive;

4.1.4 Digest the surviving cells with 1-2mL TrypLE Express at room temperature for 2-3 minutes, tap the culture dish gently, observe under the microscope that the cells become round and gradually fall off, add 3-5mL mTesR1 medium to stop the digestion, Use a large Tip to blow off the detached cells and resuspend them into a single cell suspension. After counting the cells, centrifuge at 175g for 5min at room temperature;

4.1.5 Take 1000 cells and inoculate them in a 6cm dish pre-coated with Matrigel, culture with 3mL mTesR1 containing 10% CloneR additive (STEMCELL Technologies, #05888), and then change the medium according to the instructions of CloneR.

4.1.6 When the single-cell clone in the 6cm dish grows to half the size of the field of view of the 10x lens (about 10-12 days), use a medium tip to pick the clone and inoculate it into a 24-well plate pre-coated with Matrigel, and add fresh mTesR1 medium, shake well and place in a constant temperature incubator at 37°C with 5% CO ₂ saturated humidity. .

4.1.7 When the single-cell clone grows up, transfer it from the 24-well plate to two wells of the 24-well plate. One line is used for cell expansion and culture, and the other line is used for extracting gDNA for subsequent identification.

4.2 Manual extraction of iPSCs gDNA:

4.2.1 Discard the culture medium in the cell cloning culture dish, add 1×DPBS to wash the cells twice.

4.2.2 After discarding the DPBS, digest the cells with an appropriate amount of TrypLE Express at room temperature for 3 minutes, and observe under the microscope that the cells become round and gradually fall off, discard the TrypLE Express immediately, and add 1 mL of 1×DPBS to blow the cells down.

4.2.3 After transferring the cell suspension to a 1.5mL EP tube, centrifuge at 175g for 5min at room temperature.

4.2.4 After aspirating and discarding the medium, add 500 μL of 1×DPBS to wash the cells once, and centrifuge again at room temperature at 175 g for 5 min.

4.2.5 After discarding the DPBS, add 0.5mL cell nucleus lysate (containing 20μg/mL RNase), vortex to mix and resuspend.

4.2.6 Add 70 μL of 10% SDS to each tube of sample to denature the cell protein, gently invert and mix until viscous and transparent.

4.2.7 Add 6 μL of proteinase K to the EP tube, invert and mix well, then place on a constant temperature shaker at 37°C at 90 rpm to digest until the liquid becomes clear.

4.2.8 Add an equal volume of saturated phenol to the EP tube, invert it up and down 100 times to mix well, and then see the formation of an emulsion, and centrifuge at room temperature at 12,800rpm for 10min.

4.2.9 Transfer the upper aqueous phase in the tube to a new 1.5mL EP tube, add an equal volume of saturated phenol and chloroform mixture (1:1) and mix by inverting up and down 100 times, then centrifuge at room temperature 12,800rpm for 10min .

4.2.10 Transfer the upper aqueous phase to a new 1.5mL EP tube, add 2 times the volume of -20°C pre-cooled anhydrous ethanol and mix gently by inverting. White flocculent DNA precipitation can be observed. The DNA precipitate was collected by centrifugation at rpm for 10 min.

4.2.11 Discard the supernatant, add 0.5mL 70% ethanol to wash once, and centrifuge at 12,800rpm at 4°C for 5min.

4.2.12 Discard the supernatant, discard the residual liquid after pointing away, and let it dry at room temperature for 15-20 minutes in a sterile operating table. After the white precipitate is invisible, add 15-30 μL of sterilized water, mix well and let the gDNA fully dissolve.

4.2.13 Measure the OD value of the extracted gDNA.

4.3 PCR identification of site-specific G418-resistant cell clones

Using the gDNA (genomic DNA) of the extracted G418-resistant cell clone as a template, the primers Screen-F1/R1 across the upstream homology arm region and the primer Screen-F2/R2 across the downstream homology arm region were designed for PCR amplification identification. If the picked single-cell clone is site-directed integration clone, the PCR product fragment sizes corresponding to the primers are 1652bp and 1492bp respectively.

Table 1 PCR primers

The PCR system is:

The PCR cycling conditions are shown in Figure 6.

The results are shown in Figure 7. The clones with the expected bands in the PCR products of the two pairs of primers and confirmed by sequencing were "ILZ-TRAIL" site-specific integration clones. A total of 5 ILZ-TRAIL site-specific integration hiPSCs clones were identified.

The PCR products of the five hiPSCs clones with site-specific integration of ILZ-TRAIL were sequenced to further confirm the site-specific integration of ILZ-TRAIL in the rDNA region, and the results are shown in Figure 8.

4.4 Southern blot identification of "ILZ-TRAIL" site-directed integration clones

The DIG HIGH PRIME DNA LABELING kit of Roche Company was used for probe labeling, and the probe was designed on the NEO gene. DIG High Prime DNA Labeling and Detection Starter Kit I kit detects target DNA fragments. If the PCR confirms that the "ILZ-TRAIL" site-directed integration clone does not have non-site-specific integration, then the gDNA of the cell is digested with Xho I, and a probe-labeled 6.5kb fragment can be detected by Southern Blot analysis.

4.4.1 Probes are prepared as follows:

Table 2 Probe Primers

name	sequence
NEO-probe-F	CCGGTCTTGTCGATCAGGATGA (SEQ ID NO: 6)
NEO-probe-R	CAGAGTCCCGCTCCAGAAGAACT (SEQ ID NO: 7)

PCR reaction system for preparing probes:

4.4.2 Southern blot was performed according to the standard protocol. The results are shown in Figure 9. Five ILZ-TRAIL-site-integrated hiPSCs clones were identified by Southern Blotting, and only a single 6.5kb band was seen, which was consistent with the theory and further confirmed that the obtained clones were hiPSCs clones with LZ-TRAIL-site-specific integration. , no non-fixed-point integration occurred.

4.5 Detection of iPSCs karyotype:

In order to confirm that the site-specific integration of exogenous genes into the rDNA region will not affect the cytogenetic characteristics, a nuclear analysis is performed to detect whether the karyotype does not change.

4.5.1 Before the detection of cell karyotype, fresh mTeSR1 medium was replaced, and an appropriate amount of colchicine was added to make the final concentration 0.6 μg/mL to treat the cells for 3 hours.

4.5.2 Discard the medium and wash the cells twice with 1×DPBS.

4.5.3 Add an appropriate amount of 0.25% trypsin-EDTA to digest the cells at 37°C for 3 minutes. When the cells become round and fall off gradually, add 3 times the volume of mTeSR1 medium to stop the digestion, blow off the cells and collect the suspension into a 15ml centrifuge tube , Centrifuge at 1500 rpm for 10 min at room temperature.

4.5.4 Discard the supernatant, add 0.075M KCl 7mL pre-warmed at 37°C, blow vigorously with a straw 100 times, and place in a constant temperature water bath at 37°C for 20 minutes of hypotonicity;

4.5.5 Add 1.5mL of a ready-made fixative mixed with methanol and acetic acid at a ratio of 3:1 and gently mix the suspension, pre-fix in a water bath at 37°C for 5min, and centrifuge at room temperature at 1500rpm for 10min.

4.5.6 Discard the supernatant, add 8mL of fixative and mix the suspension gently, fix in a water bath at 37°C for 5min, and then centrifuge at 1500rpm for 10min at room temperature. Then, repeat the fixation once more.

4.5.7 After adding an appropriate amount of fixative to resuspend, use -20°C pre-cooled glass slides for dropping. 2 drops per tablet, a total of 6 drops. Subsequently, the slices were baked in an oven at 75°C for 3h.

4.5.8 G banding: Add 30mL 0.85% normal saline and 30mL trypsin-EDTA solution prepared by 0.02% EDTA solution and 0.5mL 2.5% trypsin into the vertical dye vat. Adjust the pH of the prepared trypsin-EDTA solution to 7.0-7.2, and pre-warm at 37°C for 5 minutes. Put the baked chromosome specimen slices into the trypsin-EDTA solution and shake gently for 20-120s to digest, then stop the digestion in normal saline immediately and rinse twice. Then stain with Giemsa for 3-5min, rinse with tap water and dry.

4.5.9 Analyze the number of 20 chromosome cleavage phases and the structure of 5 cleavage phases under a microscope.

The results are shown in Figure 10, no abnormal karyotype was found.

(5) Directed differentiation of TRAIL-iPSCs to TRAIL-iMSCs

According to the instructions of STEMdiff ^TM Mesenchymal Progenitor Kit (Catalog #05240) from Stem Cell Company, the integrated TRAIL-iPSC clones were directedly differentiated into TRAIL-iMSCs.

5.1 Coat the 12-well plate with Mtrigel in advance: place overnight at 37°C, discard before use;

5.2 Use TrypLE ^TM Express to digest TRAIL-iPSCs to be differentiated at room temperature for 3 minutes, resuspend with TeSR ^TM -E8 ^TM to prepare a single cell suspension, and count the total number of cells with a hemocytometer; take out about 150,000 cells and inoculate to 12 Add mTeSR 1 medium containing 10 μM Y-27632 to one well of the well plate for culture (shake the cell culture plate well before putting it into the constant temperature incubator);

5.3 Cultivate for 1-2 days until the confluence of TRAIL-iPSCs clones reaches 40-50% (preferably no more than 50%), discard the medium and wash twice with DPBS, add 1ml 15-25℃ pre-warmed STEMdiff to each well ^TM -ACF Mesenchymal Induction Medium begins to induce differentiation, record P0 generation;

5.4 Use STEMdiff ^TM -ACF Mesenchymal Induction Medium to change the medium every day for 3 consecutive days (do not wash the cells when changing the medium, it is easy to blow off the cells, once the successfully differentiated cells are blown off, transfer the cells to a 6-well plate later During the period, the cells will be very thin and the state and activity of the cells will not be good) (the cells will grow very full during these 4 days, which is a normal phenomenon);

5.5 Aspirate and discard the culture medium on the 4th day, wash twice with DPBS (don’t wash the cells with a tip to avoid blowing off the cells), add 1ml 15-25℃ pre-warmed MesenCult ^TM -ACF Medium to each well, and add 1μL of 10mM Y-27632;

5.6 On the 5th day, replace with fresh MesenCult ^TM -ACF Medium and continue culturing, while adding 1 μL of 10 mM Y-27632. (Never blow out the cells when changing the medium, as it will blow off many successfully differentiated cells, try not to grow too full). At the same time, coat the 6-well plate with MesenCult ^TM -ACF Attachment Substrate and put it in a constant temperature incubator overnight;

5.7 Aspirate and discard the medium on the 6th day, wash the wells twice with DPBS; use TrypLE ^TM Express to digest the cells at room temperature for 90 seconds, then aspirate and discard the TrypLE ^TM Express, blow up the cells with 2ml complete MesenCult ^TM -ACF Medium, and inoculate them until the pre-coated Add 2 μL of 10 μM Y-27632 to the wells of the 6-well plate of MesenCult ^TM -ACF Attachment Substrat, record P1 generation;

5.8 The P1 generation cells that have just been transferred to the 6-well plate can grow to full size the next day. Passage to the wells of the 6-well plate pre-coated with MesenCult ^TM -ACF Attachment Substrat according to 1:2, and continue to culture with complete MesenCult ^TM -ACF Medium Base and cultured with Y-27632 at a final concentration of 10 μM, record the P2 generation;

5.9 P2 generation cells are replaced with fresh complete MesenCult ^TM -ACF Medium medium every day, and Y-27632 with a final concentration of 10 μM is added, and cultured for 2-3 days (the cell culture time must be reached, otherwise the cells are easily aged on a 10cm dish) Passage according to 1:2 again, record P3 generation;

5.10 After the confluence of the P3 generation cells reaches 90%, digest the cells with TrypLE Express at room temperature for 3 minutes (absorb and discard the TrypLE ^TM Express and resuspend the cells with the culture medium. At this time, the cells will be difficult to blow down. Repeat 3 times, each time Aspirate the fresh medium to wash the cells, most of the cells can be blown up), subculture the cells in a 6-well plate to a 6cm dish pre-coated with MesenCult ^TM -ACF Attachment Substrate, record P4 generation (at this time , the cells in one well of a 12-well plate have passed out to four 6cm dishes);

5.11 P4 generation cells will proliferate slowly in a 6cm dish. At this time, just change the medium every other day, and replace it with complete MesenCult ^TM -ACF Medium containing Y-27632 with a final concentration of 10μM. Wait for about 5-6 days. Cells can reach 90% confluence;

5.12 When the P4 generation cells reach 90% confluence, they can continue to be subcultured and expanded. At this time, they can be transferred to one 10cm dish or two 6cm dishes as needed; all culture dishes should be pre-coated with MesenCult ^TM - Replace ACF Attachment Substrate with complete MesenCult ^TM -ACF Medium containing Y-27632 at a final concentration of 10 μM, record P5 generation;

5.13 After the P5 generation, the cell proliferation speed increases, and can be frozen or expanded according to the needs; in the future, the cells can be replaced with fresh complete MesenCult ^TM -ACF Medium every other day, without adding Y-27632;

Cells after passage P6 can be used for subsequent identification and experiments.

(6) Identification of TRAIL-iMSCs

6.1 Morphological identification of TRAIL-iMSCs

Select cells with a confluence of about 80-90%, put them under an inverted microscope after changing to fresh medium, and observe the cell morphology with a low-power lens and a high-power lens in turn.

As shown in Figure 11, TRAIL-iMSCs have the typical morphology of MSCs, grow in a fingerprint spiral shape, and can be continuously passaged in vitro.

6.2 Identification of surface markers of iMSCs

6.2.1 Discard the medium of iMSCs, wash twice with DPBS, digest the cells with TrypLE ^TM Express at room temperature for 3 minutes, resuspend with an appropriate amount of complete medium, transfer to a 15mL centrifuge tube, and centrifuge at 175g for 5 minutes;

6.2.2 After discarding the supernatant, wash the cells once with DPBS, and centrifuge again at 175g for 5min;

6.2.3 Discard the supernatant after centrifugation, add 100 μL 5% FBS-DPBS to resuspend the cells, and then add BV421-CD45, BV421-HLA-DR, APC-CD105, BV421-CD34, PE-Cy7-CD90, BB515 respectively -CD44, 5 μL of Precp-Cy5.5-CD73 each, add 0.1 μL of dead-life dye APC-Cy7 at the same time, incubate at room temperature in the dark for 20 minutes;

6.2.4 After the incubation is completed, add 2 times the volume of 5% FBS-DPBS to terminate the incubation, centrifuge at 175g for 5 minutes, discard the supernatant, add 150 μL 5% FBS-DPBS to each tube to resuspend the cells, and detect by flow cytometry within 1 hour.

The identification of TRAIL-iMSCs surface markers showed CD44+, CD73+, CD90+, CD105+, CD34-/CD45-/HLA-DR-, which were consistent with the characteristics of human bone marrow-derived MSCs and met the identification criteria of ISCT. The result is shown in Figure 12.

6.3 Identification of multi-lineage differentiation potential of iMSCs

6.3.1 Osteoblast differentiation

The MesenCult Osteogenic Diff Kit (Human) used in this experiment is from Stem Cell Technologies, which can induce MSCs to differentiate into osteoblasts.

6.3.1.1 Prepare the complete osteogenic differentiation medium according to the instructions, mix well and store at 4°C;

6.3.1.2 Inoculate iMSCs into a six-well plate coated with MesenCult ^TM -ACF Attachment Substrate one day in advance. Inoculate about 3×105 cells in each well, add fresh complete MesenCult ^TM -ACF Medium and place in a 37°C, 5% CO ₂ , incubator for 24 hours;

6.3.1.3 The next day the cells can grow confluent, discard the old medium, wash the wells twice with DPBS, and then replace with 2mL MSC osteogenic differentiation medium for differentiation culture.

6.3.1.4 Change the medium every 2 days. After 2 weeks of differentiation culture, the cells were stained with Alizarin Red for identification. The identification results are shown in Figure 13.

6.3.2 Differentiation into adipocytes

In this study, the MesenCult ^TM Adipogenic Differentiation Kit from Stem Cell Technologies was used to differentiate MSCs into adipocytes.

6.3.2.1 First prepare MSC adipose differentiation medium according to the instructions, mix well and store at 4°C;

6.3.2.2 Inoculate iMSCs into a six-well plate coated with MesenCult ^TM -ACF Attachment Substrate one day in advance. Inoculate about 3×105 cells in each well, add fresh complete MesenCult ^TM -ACF Medium and place in a 37°C, 5% CO ₂ , incubator for 24 hours;

6.3.2.3 The next day, the cells can grow confluent, discard the old medium, wash the wells twice with DPBS, and then replace the MSC adipogenic differentiation medium for culture.

6.3.2.4 Change the medium every 2 days. After 3 weeks of differentiation culture, the cells were stained with Oil Red O for identification. The identification results are shown in Figure 13.

6.3.3 Differentiation into chondrocytes

In this study, the MesenCult ^TM -ACF Chondrogenic Differentiation Kit from Stem Cell Technologies was used to differentiate MSCs into chondrogenic cells.

6.3.3.1 First prepare MSC adipose differentiation medium according to the instructions, mix well and store at 4°C;

6.3.3.2 The 3D culture system is used for the differentiation of chondrocytes: when iMSCs grow to confluence, digest with TrypLE ^TM Express for 3 minutes at room temperature, resuspend and count the cells, and take 5×105 cells and centrifuge at 175g for 5 minutes at room temperature;

6.3.3.3 Discard the supernatant, resuspend the cells with 150 μL MSC chondrogenic differentiation medium, inoculate drop by drop in a 6-well plate at a volume of 20-30 μL per drop, and place carefully at 37°C in 5% CO ₂ saturated humidity Incubate overnight in a constant temperature incubator.

6.3.3.4 On the second day, there are cell microspheres visible to the naked eye in the area where there are liquid droplets at the bottom of the well. Each well was supplemented with 2 mL of fresh MSC chondrogenic differentiation medium for differentiation culture. Replace with fresh differentiation medium every 2 days.

6.3.3.5 After 2 weeks of differentiation culture, the cells were stained with Alicin blue to detect the differentiation of MSCs into cartilage. The identification results are shown in Figure 13.

6.3.4 Staining identification of differentiated cells

6.3.4.1 Discard the medium, wash the cells twice with DPBS, add an appropriate amount of 4% paraformaldehyde to fix the cells, and fix at room temperature for 30 minutes;

6.3.4.2 After fixation, wash the cells twice with DPBS, then add appropriate amount of oil red O, alizarin red, and alicin blue staining solutions to the differentiated adipocytes, osteoblasts, and chondrocytes, and stain at room temperature for 20 minutes in the dark;

6.3.4.3 Aspirate and discard the dye solution, rinse the cells with DPBS several times, and be careful not to blow the cells;

6.3.4.4 Finally, add an appropriate amount of DPBS to keep it moist, observe the staining of the cells under the microscope, and choose a suitable magnification to take pictures. The identification results are shown in Figure 13.

(7) Detection of TRAIL expression in TRAIL-iPSCs and TRAIL-iMSCs

7.1 Western Blot detection of TRAIL protein expression level in cell lysate

7.1.1 When the confluence of the cells reaches 90%, discard the medium and wash the cells twice with 1×DPBS;

7.1.2 Add 100 μL RIPA and 1 μL PMSF to each well of a 12-well plate/add 200 μL RIPA and 2 μL PMSF to each well of a 6-well plate, gently scrape the cells with Tip, and lyse on ice for 30 minutes;

7.1.3 After lysing, transfer the cell lysate to an EP tube (the whole operation should be performed on ice as much as possible). Ultrasonic lysis on ice, 2-3s/time, with an interval of 5s between each time, a total of 7-8 times;

7.1.4 Centrifuge at 12000g for 10min at 4°C (turn on the centrifuge in advance to pre-cool);

7.1.5 Transfer the centrifuged supernatant to a new EP tube, and then use the Pierce ^TM BCA Protein Assay Kit from Thermo for BCA protein quantification;

7.1.6 Preparation of SDS-PAGE glue: wash the glass plate, wash the glued glass plate with detergent, then rinse with water, then rinse with ddH2O, and finally dry it with a hair dryer to prepare 12% separating gel and 4% stacking gel SDS-PAGE glue;

7.1.7 Sample loading: Put the prepared SDS-PAGE gel in the electrophoresis tank (with the small glass plate facing inward and the large glass plate facing outward), and prepare fresh 1×running buffer and add it to the electrophoresis tank. The protein samples were added to the wells in order, and the loading amount of each well was 10 μg protein;

7.1.8 Select an appropriate voltage for constant voltage electrophoresis until all the loading in the sample runs out of the PAGE gel;

7.1.9 Transfer membrane: Pre-prepared 1× transfer buffer and put it in -20°C refrigerator to pre-cool, cut off the stacking gel, measure the length and width of the separating gel, cut out a suitable size PVDF membrane with a ruler, and soak it in methanol Activated, and then equilibrated in transfer solution. Then follow: "sandwich sequence" black slot end: sponge pad + filter paper + separation gel + membrane + filter paper + sponge pad red slot end, the whole operation process is carried out in the membrane transfer solution, and the air bubbles are continuously removed;

7.1.10 Transfer the film at constant flow for 90 minutes, and pay attention to the cooling of the system during this process;

7.1.11 Sealing: After the membrane transfer is completed, infiltrate the membrane with TBST from top to bottom, then transfer to 5% skimmed milk and seal at room temperature for 1 hour (this step is placed on a horizontal shaker);

7.1.12 Antibody incubation: Dilute the primary antibody to an appropriate concentration with the primary antibody diluent, pour it into a suitable incubation box, and incubate the membrane overnight on a horizontal shaker at 4°C.

7.1.13 Discard the primary antibody, wash 3 times with TBST, 10 minutes each time;

7.1.14 Add the corresponding 1:10000 diluted secondary antibody to the antibody box, incubate on a shaker for 1 hour, wash 3 times with TBST, 10 minutes each time;

7.1.15 Protein band development.

The results are shown in Figures 14-15. It can be seen that the TRAIL expression level of the integrated clone TRAIL-iPSCs is significantly high, and the TRAIL expression level of the TRAIL-iMSCs is not affected by the number of passages in vitro, which further reveals that TRAIL-iMSCs is an ideal stable expression Cell Therapeutics for TRAIL.

7.2 ELISA detection of TRAIL content in cell culture supernatant:

After cell counting, culture in the corresponding medium for 24 hours, collect the medium supernatant, and pay attention to remove dead cells and cell debris

7.2.1 Dilute Capture antibody with coating buffer at 1:100, add 100 μL to each well of a 96-well ELISA plate, and incubate at room temperature for 12 hours.

7.2.2 Dilute the standard substance according to the concentration of 12.5, 25, 50, 100, 200ng/L.

7.2.3 Set blank wells, standard wells, and sample wells to be tested respectively, and do not add samples and enzyme-labeled reagents to the blank wells. First add 40 μl of sample diluent to the sample well to be tested, then add 10 μL to mix the sample to be tested gently, and add 50 μL of standard to the standard well. During the loading process of the enzyme-labeled plate, the sample is directly added to the bottom of the plate well without touching the well wall.

7.2.4 After sealing the plate with the plate sealing film, incubate at 37°C for 2 hours.

7.2.5 After peeling off the sealing film, suck up the liquid. Add 100 μL of 1×washing buffer to each well, let it stand for 30 seconds, then aspirate and discard, and wash the well plate 5 times repeatedly.

7.2.6 Add 50μL detecting antibody to each well, except for blank wells. After sealing the plate with a sealing film, incubate at 37°C for 2 h.

7.2.7 Same as step 5) Wash the orifice plate 5 times again.

7.2.8 Add 50 μL of chromogenic reagents A and B to each sample well successively at a ratio of 1:1, shake and mix gently, and then incubate at 37°C in the dark for 20 minutes to develop color.

7.2.9 Add 50μl stopping solution to each well to terminate the color reaction.

7.2.10 Measure the OD value of each sample well in a microplate reader at a wavelength of 490nm within 15 minutes after the color development is terminated, draw a standard curve and calculate the TRAIL protein content in the sample.

The results are shown in Figure 16: Compared with hiPSCs, BMSCs, and iMSCs, the high expression of TRAIL in the culture supernatant of TRAIL-iMSCs was observed, revealing that TRAIL-iMSCs can be used as a therapeutic cell to exert long-distance tumor suppression by secreting therapeutic factors active potential.

(8) Detection of pro-apoptotic effect of TRAIL-iMSCs

After the integrated TRAIL-iMSCs and unintegrated iMSCs were labeled with a fluorescent dye (CFSE), they were mixed with tumor cells and co-cultured for 48 hours, and then the apoptotic ratio of tumor cells was detected. The apoptosis detection kit used in this study is Annexin V-PE/7-AAD Apoptosis Detection Kit. The high affinity between Annexin V and phosphatidylserine (PS) is one of the sensitive indicators for detecting early cell apoptosis. 7-Aminoactinomycin D (7-AAD) is a nucleic acid dye. 7-AAD cannot penetrate the complete cell membrane of normal cells or early apoptotic cells, but can penetrate membrane damaged cells such as late apoptotic cells or necrosis The cell membrane and the DNA in it can be used to distinguish early apoptotic cells from late apoptotic or necrotic cells. Therefore, co-staining Annexin V-PE and 7-AAD can distinguish cells in different apoptotic stages. Normal tumor cells were used as standard group (7-AAD, Annexin V, double standard, blank) and control group (sTRAIL-iMSCs and iMSCs).

8.1 Inoculate 300,000 CFSE-labeled TRAIL-iMSCs or iMSCs with 100,000 tumor cells in a six-well plate, set up a blank control (only tumor cells), and change to MSC medium for continuous culture for 72 hours;

8.2 After 72 hours, collect the medium in the culture dish into a 15mL centrifuge tube, wash the cells once with 1×DPBS, and then digest the cells with an appropriate amount of TrypLE Express for 2 minutes. 15mL centrifuge tube, then centrifuge at 175g for 5min at room temperature;

8.3 Discard the supernatant, and wash the cells once more with 1×DPBS; after centrifuging again to discard the supernatant, add 100 μL 1×Binding Buffer to each sample, and blow gently to obtain a single-cell suspension;

8.4 Cell staining: Add 5 μL 7-AAD Staining Solution and 5 μL Annexin V-PE, blow gently, incubate at room temperature for 10 minutes in the dark, add 200-400 μL 1×Binding Buffer, and mix gently;

8.5 After staining, the samples should be detected by flow cytometry as soon as possible.

Results As shown in Figure 17, TRAIL-iMSCs significantly increased the apoptosis rate of A375, A549, MCF-7 and HepG2 cells.

The above-mentioned embodiments should be understood that these embodiments are only used to illustrate the present invention more clearly, and are not intended to limit the scope of the present invention. After reading the present invention, those skilled in the art will understand the various equivalent forms of the present invention All modifications fall within the scope defined by the appended claims of this application.

references:

[1] A.Hmadcha1, A.Martin-Montalvo1, B.R.Gauthier, et al.Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy[J].Front Bioeng Biotechnol,2020,8:43.PMID:32117924

[2] J.Q.Yin, J.Zhu, J.A.Ankrum, Manufacturing of primed mesenchymal stromal cells for therapy[J].Nature Biomedical Engineering,2019,3(2):90-104.PMID:30944433

[3] I.ChristodoμLou, M.Goulielmaki, M.Devetzi, et al.Mesenchymal stem cells in preclinical cancer cytotherapy: a systematic review[J].Stem Cell Research&Therapy,2018,9(1):336.PMID:30526687

[4]A.Ashkenazi,R.C.Pai R,S.Fong,et al.Safety and antitumor activity of recombinant soluble Apo2ligand[J].The Journal of clinical investigation.1999,104(2):155-162.PMID:10411544

[5] H.Walczak, R.E.Miller, A.Kiley, et al.Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo[J].Nature medicine,1999,5(2):157-163.PMID :9930862

[6] M.R.Loebinger, A.Eddaoudi, D.Davies, et al.Mesenchymal stem cell delivery of TRAIL can eliminate metastatic cancer[J].Cancer research.2009,69(10):4134-42.PMID:19435900

[7]S.F.Kamal,G.Nadiah,L.Moon,et al.Mesenchymal Stem Cell Expressing TRAIL as Targeted Therapy against Sensitised Tumor[J].International Journal of Molecular Sciences,2018,19(8):2188.PMID:30060445

[8] Jung, Y., G.Bauer and J.A.Nolta, Concise Review: Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells: Progress Toward Safe Clinical Products. STEM CELLS, 2012.30(1): 42-47. PMID: 21898694

[9][Q.Lian, Y.Zhang, X.Liang, et al.Directed Differentiation of Human-Induced Pluripotent Stem Cells to Mesenchymal Stem Cells[M].Methods Mol Biol,2016,1416:289-298.PMID: 27236679

[10]V.Sabapathy,S.Kumar.hiPSC-derived iMSCs:NextGen MSCs as an advanced therapeutically active cell resource for regenerative medicine[J].Journal of Cellular&Molecular Medicine,2016,20(8):1571-1588.PMID: 27097531

[11] Bloor, A.J.C., et al., Production, safety and efficacy of iPSC-derived mesenchymal stromal cells in acute steroid-resistant graft versus host disease: a phase I, multicenter, open-label, dose-escalation study. Nature Medicine ,2020.26(11):1720-1725.PMID:32929265.

[12]Wu,Y.,et al.,TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.Biochem Biophys Res Commun,2014.446(1):p.261-6.PMID:24589733

[13] Lynch, D.H., et al., Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nature Medicine, 1999.5(2):157-163.

[14]Goto, M., Owaki, K., Hirata, A., Yanai, T. and Sakai, H.Tumour necrosis factor-related apoptosis-inducing ligand induces apoptosis in canine hemangiosarcoma cells in vitro.Vet.Comp.Oncol , 2019.17:285–297.

[15]Goto M, Hirata A, Murakami M, et al.Trimer form of tumor necrosis factor-related apoptosis inducing ligand induces apoptosis in canine cell lines derived from mammary tumors[J].The Journal of Veterinary Medical0 19 Science,812 (12).

[16]M.H.Tuthill, A.Montinaro, J.Zinngrebe, et al.TRAIL-R2-specific antibodies and recombinant TRAIL can synergise to kill cancer cells[J].Oncogene,2015,34(16):2138-2144.

[17] Ru, Q., et al., Preclinical study of rAAV2-sTRAIL: pharmaceutical efficacy, biodistribution and safety in animals. Cancer Gene Ther, 2017.24(6): p.251-258.

[18]Kim, C., et al., Cancer gene therapy using a novel secretable trimeric TRAIL. Gene Therapy, 2006.13(4):330-338.

[19]Yoo, J., et al., Adeno-associated virus-mediated gene transfer of a secreted form of TRAIL inhibits tumor growth and occurrence in an experimental tumor model. The Journal of Gene Medicine, 2006.8(2): p. 163-174.

[20]CN107287224A

[21]Fan D M, Zhang X L, Zhang Q, et al. Human umbilical cord-driven mesenchymal stem cells as vehicles of CD20 specific-TRAIL fusion protein against non-Hodgkin's lymphoma. Chinese Journal of Immunology, 2016

[22]Yuan, Z., et al., Mesenchymal stromal cell delivery of full-length tumor necrosis factor–related apoptosis-inducing ligand is superior to soluble type for cancer therapy. Cytotherapy, 2015.17(7):885-896.

Claims (22)

1. A method for constructing induced pluripotent stem cells (iPSCs) stably expressing TRAIL protein or its variants, comprising integrating the polynucleotide encoding TRAIL protein or its variants into the ribosomal RNA transcription region of the genome of induced pluripotent stem cells.
2. The method according to claim 1, wherein the integration is performed by gene editing, preferably Cre-lox system, Zinc Finger Nucleases (ZFN), CRISPR or TALEN, more preferably TALEN/TALENickase-mediated gene editing.
3. The method according to claim 1 or 2, wherein the ribosomal RNA transcribed region is selected from the transcribed region of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcribed region of 18S rRNA.
4. The method according to claim 3, wherein said integration occurs at a specific site, and said specific site is located at position 5468 of the 18S rRNA transcribed region.
5. The method according to any one of claims 1-4, wherein the TRAIL protein or variant thereof is selected from ILZ-TRAIL, FLAG-TRAIL, His-TRAIL, Leucine Zipper TRAIL (IZ-TRAIL), TNC-TRAIL, ScFv :TRAIL (such as CD19:TRAIL, EGFR:TRAIL) and TRAIL mutants (such as D269H mutant and S159R mutant), preferably ILZ-TRAIL (SEQ ID NO:8).
6. The method according to any one of claims 1-5, comprising:

   1) inserting the polynucleotide encoding the TRAIL protein or its variant into a vector targeting the ribosomal RNA transcription region, preferably a mini-pHrneo vector;

   2) introducing the vector obtained in step 1) into iPSCs; and

   3) Screening the iPSCs obtained in step 2) to obtain a stable cell line carrying the polynucleotide encoding the TRAIL protein or a variant thereof in the ribosomal RNA transcription region.
7. An iPSCs stably expressing TRAIL protein or a variant thereof, which is produced by the method of any one of claims 1-6.
8. An iPSCs stably expressing the TRAIL protein or its variants, wherein the ribosomal RNA transcription region of the iPSCs genome is integrated with the polynucleotide encoding the TRAIL protein or its variants.
9. The iPSCs according to claim 8, wherein the ribosomal RNA transcription region is selected from the transcription region of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcription region of 18S rRNA.
10. The iPSCs according to claim 8 or 9, wherein the integration is at a specific site, and the specific site is located at site 5468 of the 18S rRNA transcription region.
11. The iPSCs according to any one of claims 8-10, wherein the TRAIL protein or its variants are selected from ILZ-TRAIL, FLAG-TRAIL, His-TRAIL, Leucine Zipper TRAIL (IZ-TRAIL), TNC-TRAIL, ScFv :TRAIL (such as CD19:TRAIL, EGFR:TRAIL) and TRAIL mutants (such as D269H mutant and S159R mutant), preferably ILZ-TRAIL (SEQ ID NO:8).
12. The iPSCs according to any one of claims 8-11, wherein the iPSCs were deposited in the China Center for Type Culture Collection on May 12, 2021 with the accession number CCTCC NO: C2021120.
13. The use of iPSCs according to any one of claims 7-12 in preparing differentiated cells stably expressing TRAIL protein or its variants, such as differentiated NK cells, T cells or mesenchymal stem cells, preferably mesenchymal stem cells.
14. A differentiated cell stably expressing TRAIL protein or its variant, such as NK cell, T cell or mesenchymal stem cell, which is differentiated from the iPSCs according to any one of claims 7-12.
15. A mesenchymal stem cell stably expressing a TRAIL protein or a variant thereof, wherein the ribosomal RNA transcription region of the genome of the mesenchymal stem cell is integrated with a polynucleotide encoding the TRAIL protein or a variant thereof.
16. The mesenchymal stem cell according to claim 15, wherein the ribosomal RNA transcribed region is selected from the transcribed regions of 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, preferably the transcribed region of 18S rRNA.
17. The mesenchymal stem cell according to claim 15 or 16, wherein the integration is located at a specific site, and the specific site is located at site 5468 of the 18S rRNA transcription region.
18. The mesenchymal stem cell according to any one of claims 15-17, wherein the TRAIL protein or its variant is selected from ILZ-TRAIL, FLAG-TRAIL, His-TRAIL, Leucine Zipper TRAIL (IZ-TRAIL), TNC-TRAIL TRAIL, ScFv:TRAIL (such as CD19:TRAIL, EGFR:TRAIL) and TRAIL mutants (such as D269H mutant and S159R mutant), preferably ILZ-TRAIL (SEQ ID NO:8).
19. The mesenchymal stem cell according to any one of claims 15-18, wherein the mesenchymal stem cell was deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: C2021121 on May 12, 2021.
20. A composition comprising the iPSCs according to any one of claims 7-12, the differentiated cells according to claim 14 or the mesenchymal stem cells according to any one of claims 15-19, and a pharmaceutically acceptable carrier .
21. The iPSCs according to any one of claims 7-12, the differentiated cells according to claim 14, the mesenchymal stem cells according to any one of claims 15-19, or the composition according to claim 20 are used in the preparation for treatment Use in medicine for tumor or cancer.
22. A method for treating tumor or cancer, comprising administering the iPSCs according to any one of claims 7-12, the differentiated cells according to claim 14, and the mesenchymal cells according to any one of claims 15-19 to a subject in need thereof. Mesenchymal stem cells or the composition of claim 20.

Images