CN116509888A

CN116509888A - Application of garlic polysaccharide in preparation of medicine for treating intestinal flora disorder caused by acute lung injury

Info

Publication number: CN116509888A
Application number: CN202310481900.1A
Authority: CN
Inventors: 李新莉; 曹雪姣
Original assignee: Dalian Medical University
Current assignee: Dalian Medical University
Priority date: 2023-04-28
Filing date: 2023-04-28
Publication date: 2023-08-01

Abstract

The invention belongs to the technical field of medicines, and particularly relates to a novel application of garlic polysaccharide. The invention verifies the effect of garlic polysaccharide in treating acute lung injury, can inhibit the expression of TNF-alpha by inhibiting NF- κB activity, promote the secretion of IL-10 to exert the anti-inflammatory effect thereof to protect the acute lung injury caused by LPS; meanwhile, on the influence of intestinal flora of mice with acute lung injury, the garlic polysaccharide increases the types and the amounts of beneficial bacteria in intestinal tracts, especially lactobacillus and Prevotella, and increases the diversity and uniformity index of flora structures. The invention provides an experimental basis for treating intestinal flora imbalance accompanied by acute lung injury by garlic polysaccharide, lays a foundation for deeply researching the effect of the intestinal flora in the occurrence and development of lung diseases, and provides a new idea for taking the intestinal flora as a combined drug for clinically screening and treating the lung diseases.

Description

Application of garlic polysaccharide in preparation of medicine for treating intestinal flora disorder caused by acute lung injury

Technical Field

The invention belongs to the technical field of medicines, relates to a new application of garlic polysaccharide, and in particular relates to an application of garlic polysaccharide in preparing a medicine for treating intestinal flora disorder caused by acute lung injury.

Background

Acute Lung Injury (ALI) is a common clinical critical condition. The clinical manifestations are progressive hypoxia, reduced lung compliance, inflammation of lung tissue and intense direct or indirect injury of lung, and can rapidly develop into Acute Respiratory Distress Syndrome (ARDS), with extremely high fatality rate, and seriously threaten the quality of life or even life of serious patients. ALI is statistically at 59/10 to 79/10 ten thousand per year, rising with age, and reaching 306/10 ten thousand in patients of ages 75 to 84 years of age. Globally, ALI has a mortality rate of up to 40-60%. ALI pathogenesis is intricate and complex, the pathogenic links are numerous, and the therapeutic intervention method is mainly limited to lung protection strategies. Currently, adrenocortical hormone drugs, non-steroidal anti-inflammatory drugs, free radical scavengers, antioxidant drugs, vasodilators, anti-cytokine drugs, immunosuppressive drugs are used for treatment. Although clinical medicines are various, the quality of life of patients cannot be obviously improved, the death rate of the patients cannot be reduced, and urgent demands of the patient's mind cannot be truly met, so that searching for medicines for treating ALI more safely and effectively becomes one of the key points and difficulties in critical medicine.

Disclosure of Invention

The invention aims to provide application of garlic polysaccharide in preparing medicines for treating intestinal flora disorder caused by acute lung injury.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

the invention provides application of garlic polysaccharide in preparing a medicament for treating acute lung injury.

In the technical scheme, further, the application of the garlic polysaccharide in preparing the medicine for treating the intestinal flora disorder caused by the acute lung injury is provided.

In the technical scheme, further, the garlic polysaccharide promotes the in-vivo growth of the lactobacillus animalis and the Prevotella.

In the technical scheme, the effective content of the garlic polysaccharide is 150-250 mg/kg/d.

The invention provides a pharmaceutical composition for treating acute lung injury, which takes garlic polysaccharide as an active ingredient.

In the above technical scheme, the medicine is further used for treating intestinal flora disorder caused by acute lung injury.

In the above technical scheme, further, the pharmaceutical composition uses garlic polysaccharide as the only active ingredient.

In the above technical scheme, further, the pharmaceutical composition comprises pharmaceutically acceptable auxiliary materials.

In the above technical scheme, further, the pharmaceutical composition is an oral preparation or an injection preparation.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides application of garlic polysaccharide in treating acute lung injury, which can inhibit TNF-alpha expression by inhibiting NF- κB activity, promote IL-10 secretion to exert anti-inflammatory effect to protect acute lung injury caused by LPS; meanwhile, the invention starts from adjusting the 'intestinal-lung' axis, takes intestinal flora as a target point, discovers the influence of garlic polysaccharide on the intestinal flora of mice with acute lung injury, increases the types and the quantity of beneficial bacteria in intestinal tracts, especially lactobacillus and Prevotella, and increases the diversity and the uniformity index of flora structures.

The invention provides an experimental basis for treating intestinal flora imbalance accompanied by acute lung injury by garlic polysaccharide, lays a foundation for deeply researching the effect of the intestinal flora in the occurrence and development of lung diseases, and provides a new idea for taking the intestinal flora as a combined drug for clinically screening and treating the lung diseases.

Drawings

FIG. 1 is a DEAE-52 cellulose column chromatography elution profile of garlic polysaccharide (AM);

FIG. 2 results of H & E staining of lung tissue (x 100) of mice of each group;

FIG. 3 wet/dry mass ratio of lung tissue for each group of mice; comparison with the Normal group ^** P<0.01， ^* P<0.05; comparison with LPS-induced lung injury group ^## P<0.01；

FIG. 4 mRNA expression levels of TNF- α, IL-10, NF- κB in lung tissue of mice of each group; and is right opposite toConstant group comparison ^** P<0.01, ^* P<0.05; comparison with LPS-induced lung injury group ^## P<0.01， ^# P<0.05；

FIG. 5 intestinal flora profile analysis; a. DGGE profile of intestinal flora of mice, and UPGMA similarity cluster analysis.

Detailed Description

The invention is further illustrated below in connection with specific examples, but is not limited in any way.

Example 1

Preparation of garlic polysaccharide extract

Extraction of garlic polysaccharide: 200g of fresh garlic is made into mashed garlic by a tissue masher according to the feed liquid ratio of 1:4 (g/mL) adding 800mL of water, filtering with double-layer gauze, concentrating the filtrate under reduced pressure to 300mL by using a rotary evaporator, adding absolute ethanol to make the final concentration 70%, standing overnight at 4 ℃, centrifuging at 5000rpm for 15min to obtain white precipitate, and freeze-drying to obtain the garlic crude polysaccharide.

Refining garlic polysaccharide: the garlic crude polysaccharide is dissolved in distilled water and separated and purified by using DEAE-52 cellulose. The polysaccharide was monitored by phenol-sulfuric acid method followed by elution with distilled water, 0.1mol/LNaCl, 0.5mol/LNaCl solution, and partial collection (flow rate 1.54mL/min, 5mL per tube). The elution curve of garlic polysaccharide is obtained by plotting the number of test tubes on the abscissa and the absorbance on the ordinate, as shown in FIG. 1. Wherein neutral polysaccharide is eluted firstly, acidic polysaccharide is eluted later, and the acidic polysaccharide is concentrated and freeze-dried to obtain garlic polysaccharide AM.

Example 2

1. Experimental materials

1.1 laboratory animals

SPF-grade KM mice, male and magnetic, each half, have a body weight of 18-22 g, and are provided by university laboratory animal center of Dalian medical university, and have animal qualification number: SCXK (Liao) 2018-0003, the experiment was agreed by the university of Dalian medical university ethical committee.

1.2 drugs and Agents

Garlic polysaccharide (prepared in example 1); lipopolysaccharide (LPS): sigma Co., USA;

taq PCR supermix, one-Step gDNA removal and cDNA synthesis supermix, tip Green qPCR supermix kit (Dalian Wanze trade Co., ltd.);

fecal bacterial DNA extraction kit: chengdu Fuji Biotechnology Co., ltd;

GC-341f(5′-CGCCCGGGGCGCGCCCCGGG

CGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG)、518r

(5 ' -ATTACCGCGGCTGCTGG), TNF- α -F (5 ' -AGTCCCCAAACAACCTCCAT), TNF- α -R (5 ' -TTGACCGCTGAAGAGAACCT), IL-10-F (5 ' -AACATACTGCTAACCGACTC), IL-10-R (5 ' -TGG CCT TGT AGACAC CTT), NF- κB-F (5 ' -ATGTGCATCGGCAAGTGG), NF- κB-R (5 ' -CAGAAGTTGAGTTTCGGGTAG), β -actin-F (5 ' -GAGACCTTCAACACCCCAGC), β -actin-R (5 ' -ATGTCACGCACGATTTCCC): weijieshishanhai trade Inc.;

PCR-Mix: dalianyou lovely trade company;

acrylamide, methylene bisacrylamide, urea, deionized formamide, agarose, ethidium Bromide (EB): large Lian Yu Ming's biotechnology Co., ltd;

RNA extraction kit (Dalianbao bioengineering Co., ltd.).

2. The experimental method comprises the following steps:

2.1 model creation and grouping

The mice were randomly divided into a normal Control group (Control), a garlic polysaccharide Control group (250 mg/kg/d, AM), an acute lung injury group (LPS), a garlic polysaccharide high concentration treatment group (250 mg/kg/d, LPS+AM-H) and a garlic polysaccharide low concentration treatment group (150 mg/kg/d, LPS+AM-L), 6 each. Except for Control and AM groups, the other groups induced acute lung injury model by LPS inhalation method, and the specific operation is as follows: the mice were anesthetized by intraperitoneal injection of chloral hydrate (100 g/L,4mL/kg body weight), the tongues of the mice were gently pulled out after anesthesia, and 50uL of LPS (1 g/L) was sucked by a pipette and dropped onto the back wall of the throat of the mice, the noses of the mice were immediately pinched, loosened after 20 seconds, and returned to the cages until they spontaneously wake up. The normal control and the garlic polysaccharide control were subjected to the above procedure, and LPS was replaced with an equivalent amount of PBS at pH 7.4, 10 mmol/L. After 10 days of administration of the corresponding drug, mice were sacrificed 12 hours after the last administration, and one leaf of the left lung of each mouse was fixed to 10% cold formaldehyde, the other leaf of the left lung was stored at-20 ℃, and the right lung and feces were stored at-80 ℃.

2.2 histopathological examination of the lungs

After fixing one leaf of the left lung of the mice with 10% cold formaldehyde, paraffin sections were prepared, H & E stained, and the histopathological changes of the lungs of each group of mice were observed under a high power microscope.

2.3 determination of the wet/Dry Mass ratio of Lung tissue

The other She Zuofei of the mice is moderately washed by ice physiological saline, the filter paper is put on an electronic balance after being dried, the wet mass of the lung tissue is weighed and recorded, then the mice are baked in a vacuum drying oven at 80 ℃ for 72 hours, the dry mass of the mice is weighed, and the wet/dry mass ratio of the lung tissue is calculated.

2.4qRT-PCR detection of expression of mRNA of TNF- α, IL-10, NF- κB in mouse lung tissue

Taking 50mg of right lung tissue of a mouse, putting the right lung tissue into a homogenizer, grinding the right lung tissue on ice for 5min, adding 1mL of Trizol reagent, fully grinding the right lung tissue for 1min, adding 200mL of chloroform for extraction, separating an aqueous phase and an organic phase after centrifugation, and precipitating RNA in the aqueous phase by using 5mL of cold isopropanol. Reverse transcription and Real-Time Quantitative PCR amplification were performed as described by One-Step gDNA removal and cDNA synthesis supermix and Tip Green qPCR supermix. PCR reaction System 10. Mu.L, PCR procedure: 95℃for 10min,95℃for 30s,60℃for 40s,72℃for 40 cycles, and 72℃for 5min. Beta-actin is taken as an internal reference, 2 is adopted ^-ΔΔCt The method performs relative gene expression analysis.

2.5PCR-DGGE electrophoresis

The mouse fecal bacterial genomic DNA of each experimental group was extracted as required by the kit instructions. The PCR amplification system is as follows: 2X Easy Taq PCR SuperMix 12.5.5. Mu.L of 10. Mu. Mol/L of the upstream primer GC-341f, the downstream primer 518r, 0.5. Mu.L each, 2. Mu.L of the bacterial DNA template, and 25. Mu.L of deionized water were supplemented. PCR procedure: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 54℃for 30s, extension at 72℃for 30s,30 cycles; fully extending for 7min at 72 ℃. Preparing 30% -60% DGGE denaturing gradient gel by 8% acrylamide gel, wherein 100% denaturing gradient gel contains 40% (V/V) deionized formamide and 7mol/L urea, performing DGGE electrophoresis on 10 mu L PCR product at 60 ℃ for 5h by 70V electrophoresis, and dyeing gel EB. Cutting dominant bands in the PCR-DGGE spectrum, adding 20 mu L of sterile water, mashing, soaking at 95 ℃ for 10min, standing overnight at 37 ℃, taking supernatant as a template, and carrying out PCR amplification by taking 341f and 518r as primers, wherein a PCR reaction system and a PCR reaction program are consistent with the above. PCR products were sequenced by Shanghai and Blast comparison analysis was performed in GenBank database.

3 results

3.1 pathological changes of pulmonary tissue in each experimental group

As can be seen from the H & E staining results of the lung tissue of the mice, the alveolar septum structure of the mice in the normal group is complete, the alveolar morphology is good, and the alveolar cavity is free from serous exudates. The lung tissue lesion of the mice in the lung injury model group is serious, the alveolar septum telangiectasia is carried out, and serous exudation exists in the alveolar space, and the serous exudation contains a large amount of inflammatory cells and erythrocytes. Compared with the lung injury model group, the change of the color and structure of the lung tissue of the mice after the treatment of the garlic polysaccharide tends to be mild, inflammatory cell infiltration is reduced, serous exudation in alveoli is obviously reduced, and the effect of the high-dose group is more obvious, and the result is shown in figure 2. The research shows that the LPS can activate inflammatory cells and release a large amount of inflammatory cytokines, so that the injury of capillary membranes in alveoli, dysfunction of pulmonary alveoli surface active substances and pulmonary edema are caused, and the garlic polysaccharide can effectively relieve the lung injury induced by the LPS.

3.2 determination of the wet/Dry Mass ratio of Lung tissue

Compared with the normal group, the wet/dry mass ratio of the lung tissue of the lung injury model group is obviously increased (P < 0.01), which indicates that pulmonary edema appears and the lung injury model is successfully established. The lung tissue wet/dry mass ratio was significantly reduced in the garlic polysaccharide group compared to the lung injury model group, wherein the garlic polysaccharide high dose group was more effective (P < 0.01), and the results are shown in fig. 3.

3.3 mRNA expression of TNF- α, IL-10, NF- κB in lung tissue

Compared with the normal group, the TNF-alpha mRNA of the lung tissue of the mice in the LPS group is significantly increased. Compared with the lung injury model group, the garlic polysaccharide group mice lung tissues TNF-alpha and NF-kappa B mRNA are obviously reduced, IL-10mRNA is obviously increased, and the effect of the high dose is superior to that of the low dose, as shown in figure 4.

3.4PCR-DGGE profiling

The DGGE spectrum of the intestinal flora is shown in FIG. 5a, and the sequencing result of the dominant band of the DGGE spectrum is shown in Table 1. The same band represents the same dominant bacterium, and the brightness of the band reflects the relative content of this bacterium. Lactobacillus gasseri (Lactobacillus gasseri, lane a) and lactobacillus animalis (Lactobacillus animalis, lane C) were present in each experimental group, which represent dominant bacteria in the mouse intestinal tract, but both had reduced band strength and a lower content in the acute lung injury model group (LPS). Prevotella dentalis (lane E) and Prevotella buchneri (Prevotella buccae, lane F) were significantly weaker until disappeared in the lung injury model group and were higher in the other experimental groups, indicating that lactic acid bacteria and Prevotella are different populations in the intestinal tract of the mice in the acute lung injury model group and the other groups. The intensity of Lactobacillus animalis, prevotella dentalis and Prevotella buccina in the garlic polysaccharide administration groups (AM, LPS+AM-H and LPS+AM-L) was significantly higher than that of the normal control group, indicating that the garlic polysaccharide can promote the in vivo growth of Lactobacillus animalis and Prevotella. The similarity of the DGGE images of UPGMA analysis is shown in fig. 5b, and the result shows that the intestinal flora structure of each group of mice is clustered into two large clusters, the acute lung injury group (LPS) is clustered into one cluster independently, the other groups are clustered into the other cluster, the similarity between the two large clusters is lower, namely, the similarity is only 0.60, which indicates that the LPS induces the acute lung injury of the mice and destroys the intestinal flora structure of the mice, and the garlic polysaccharide has obvious influence on the intestinal flora structure of the mice with the acute lung injury. In the second cluster, the normal control group, the garlic polysaccharide control group and the garlic polysaccharide high and low concentration treatment group are respectively clustered, and the similarity of the two groups is 0.64, which further indicates that the intestinal flora structure of the mice with acute lung injury inflammation is greatly different from that of the normal mice. The similarity of the structures of the intestinal flora of the mice in the normal control group and the garlic polysaccharide control group is higher and is 0.70, which shows that the garlic polysaccharide has no adverse effect on the intestinal flora of the mice.

TABLE 1 dominant band sequencing and reference sequence control results in DGGE maps

3.5 analysis of intestinal flora diversity in mice of different administration groups

Shannon-Weaver index (H') and uniformity index Evenness (E) compare the diversity differences in intestinal flora structure in mice of different dosing groups. H '= Σ (pi) (lnpi), e=h'/lnS, pi=ni/Σni, ni is a band gray value, S is a band number, representing a richness index. The number of dominant bands was significantly reduced in the acute lung injury group compared to the normal control group (< P < 0.01), presumably the mice had some bacterial reduction in the gut following LPS-induced acute lung injury. The structural diversity index H' and the uniformity index E of the intestinal flora of the mice in the acute lung injury group are obviously reduced (P is less than 0.01), which indicates that the structure of the intestinal flora of the mice in the acute lung injury group is obviously changed, the flora diversity is reduced, and the flora is deregulated. Compared with the acute pneumonia group, S, H 'and E of the intestinal flora structures of mice in the garlic polysaccharide control group and the garlic polysaccharide high-concentration and low-concentration treatment group are both obviously increased (P is less than 0.01), wherein H' and E of the garlic polysaccharide high-concentration treatment group are higher and are close to the values of the normal control group, which indicates that the garlic polysaccharide can improve the structural disorder of the intestinal flora of the mice with acute lung injury and lead the structural composition of the flora to be normal.

TABLE 2 analysis of intestinal flora diversity in mice of different drug administration groupsn＝6)

Note that: compared with the intestinal flora structure of mice in the group with acute lung injury, ^** P<0.01。

many possible variations and modifications of the disclosed technology can be made by anyone skilled in the art without departing from the scope of the technology, or the technology can be modified to be equivalent. Therefore, any simple modification, equivalent variation and modification of the above embodiments according to the technical substance of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. Application of Bulbus Allii polysaccharide in preparing medicine for treating acute lung injury is provided.

2. The use according to claim 1, characterized in that the use of garlic polysaccharide for the preparation of a medicament for the treatment of intestinal flora disorders caused by acute lung injury.

3. Use according to claim 2, characterized in that the garlic polysaccharide promotes the in vivo growth of lactobacillus animalis and prasuvorexant bacteria.

4. The use according to claim 1, wherein the effective content of garlic polysaccharide is 150-250 mg/kg/d.

5. A pharmaceutical composition for treating acute lung injury is characterized in that the pharmaceutical composition takes garlic polysaccharide as an active ingredient.

6. The pharmaceutical composition of claim 5, wherein the drug is a drug for treating a disorder of intestinal flora caused by acute lung injury.

7. The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition comprises garlic polysaccharide as the only active ingredient.

8. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition comprises a pharmaceutically acceptable adjuvant.

9. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition is an oral formulation or an injectable formulation.