CN116411068A - TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof - Google Patents

TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof Download PDF

Info

Publication number
CN116411068A
CN116411068A CN202310461505.7A CN202310461505A CN116411068A CN 116411068 A CN116411068 A CN 116411068A CN 202310461505 A CN202310461505 A CN 202310461505A CN 116411068 A CN116411068 A CN 116411068A
Authority
CN
China
Prior art keywords
primer
seq
mutation
tbx1
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310461505.7A
Other languages
Chinese (zh)
Inventor
沈洪兵
胡志斌
靳光付
戴俊程
蒋涛
江玥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Medical University
Original Assignee
Nanjing Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Medical University filed Critical Nanjing Medical University
Priority to CN202310461505.7A priority Critical patent/CN116411068A/en
Publication of CN116411068A publication Critical patent/CN116411068A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the field of genetic engineering medicine, and discloses TBX1 gene non-coding mutation related to simple Fallotetraia and application thereof. The TBX1 gene mutant sequence is SEQ ID NO.2, which has a g.19737694C > T, or g.19737957A > C, or g.19738665G > C mutation compared with the normal gene sequence (GRCh37.p13). The primer pair for detecting the mutation site can be used for preparing a simple Fallotetrad disease auxiliary diagnosis kit.

Description

TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof
Technical Field
The invention belongs to the field of genetic engineering medicine, and relates to TBX1 gene non-coding region mutation and application thereof in auxiliary diagnosis of simple Fallotetrad.
Background
Congenital Heart Disease (CHD) is a congenital structural abnormality due to an obstruction of the heart or large vessels in the chest during embryonic development. The congenital heart disease is the most common congenital disease, accounting for about 28 percent of all birth defects, and is one of the main causes of death or disability of infants. In China, according to the birth defect prevention and treatment report statistics of 2012 years of the Ministry of health, about 24 ten thousand of heart-first infants born in 2011 account for 26.7% of all the monitored birth defects, and the heart-first infants become the first high-grade birth defects of perinatal infants in China. The blue-violet type congenital heart disease is the most serious type of the congenital heart disease, while the FallotetranyofFallot (TOF) is the most common subtype, and the natural prognosis of the sick children is poor, most of the sick children die before adulthood if not diagnosed in time, even if the operation treatment still has partial postoperative complications or sequelae such as arrhythmia, ventricular dysfunction and the like, the survival and life quality of the infants are seriously endangered, and the potential life span is reduced and the huge socioeconomic burden is caused.
Currently, by a new generation of sequencing technology, the whole exome or genome is directly sequenced, and more heart-related genes are found, such as heart development-related transcription factor genes (NKX 2-5, GATA4, TBX1, IRX4, etc.), development-related signal pathway genes (ZIC 3, NODAL, LEFTY2, etc.), and heart structural protein-related genes (MYH 6, MYH7, etc.). In the past, family studies and epidemiological studies have found some genetic causative factors of Fallotetrad, such as copy number variation in the 1q21.1 region, dominant mutation in the transcription factor gene, and the like. Recent studies have shown that known or new congenital heart disease mutations are to some extent incompletely dominant, with a chromosome 22q11.2 region (TBX 1) copy number deletion being considered one of the causative factors of farnesoid disease, but with a frequency of about 1/4000 in normal populations, and that asymptomatic members in family samples carry this copy number variation. Individuals carrying mutations in the non-coding region of the TBX1 gene are highly likely to develop Fallotetrad patients, especially those with a family history of congenital heart disease. A series of precautions are taken against the mutation carrier, such as early entry into a congenital heart disease screen, and increased screening frequency, and the implementation of preventative surgery will result in better intervention and treatment with early detection of Fallotetraia. If the mutation sites related to the onset of the Fallotetrad disease can be screened out and used as biomarkers, and corresponding diagnostic kits are developed, the screening and early diagnosis of the Chinese congenital heart disease are forced to be promoted once.
Disclosure of Invention
In the research, the inventor screens out new mutation related to occurrence of the TBX1 enhancer region and the simple Fallotetrad in the population, and the invention aims to disclose a TBX1 gene enhancer region mutation sequence.
The second purpose of the invention is to provide the mutation site which can be used as a molecular marker for auxiliary diagnosis of a high-risk group for prenatal screening of the occurrence of the simple Fallotetraia.
The aim of the invention is realized by the following technical scheme:
a TBX1 gene mutant sequence associated with tetrad of farprofound alone, the sequence after mutation being SEQ ID No.2, said TBX1 mutant sequence having a g.19737694c > T, or g.19737957a > C, or g.19738665g > C mutation compared to the normal gene sequence (grch 37.p13).
The primer combination for detecting the TBX1 gene mutation sequence is as follows:
primer for detecting g.19737694c > T: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer for detection g.19737957a > C: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer to detect g.19738665g > C: the upstream primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.6.
A detection method for detecting the TBX1 gene mutation sequence: mutation detection was performed on the TBX1 gene enhancer region using the Sanger sequencing method using PCR amplification primers.
The detection method is characterized in that the PCR amplification primer is a nucleotide sequence shown as SEQ ID NO.3-SEQ ID NO.6.
Application of primer combination in preparing auxiliary diagnostic kit for simple Fallotetrad disease
The kit comprises a primer combination for detecting the TBX1 gene mutation sequence. The primer combination contained in the kit is one or more of the following primer pairs:
primer for detecting g.19737694c > T: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer for detection g.19737957a > C: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer to detect g.19738665g > C: the upstream primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.6.
Using Sanger sequencing technique, we found that 9 patients had the enhancer region g.19737694C upstream of the TBX1 gene in 302 patients with Fallotetrad alone and 1000 control populations without family history of cardiac defects>T，g.19737957A>C，g.19738665G>Repeated mutations in C and a significant correlation with the occurrence of Fallotetrad (g.19737694C)>T，OR＝6.66，P＝3.67×10 -03 ；g.19737957A>C，OR＝6.66，P＝3.67×10 -03 ；g.19738665G>C，OR＝3.34，P＝7.96×10 -03 ). These 3 mutations were then confirmed by functional experiments to result in a significant decrease in TBX1 gene expression, and animal experiments also confirmed that this region knockout resulted in congenital heart defects. Verification was then performed in a further 516 cases of simple tetrad and 2276 normal control samples. Verification results show that g.19737694C>T was absent in both cases and controls. And g.19737957A>C(OR＝4.42，P＝2.22×10 -02 ) And g.19738665G>C(OR＝2.95，P＝3.18×10 -02 ) Each significantly correlated with a single TOF event.
The mutation sites related to auxiliary diagnosis of simple Fallotetraia are g.19737694C > T, g.19737957A > C and g.19738665G > C, which are found by the above study, the mutation occurs in chromosome 22 (NCBI reference sequence GRCh37.p13), the 3 mutation sites in the database and the base sequences of the regions thereof are shown as SEQ ID NO. 1 (GRCh37.p13), and the sequences corresponding to the mutation sequences are shown as SEQ ID NO. 2.
SEQ ID NO:1
CCTAGAGGATCCAGGGATGGCCCAGGTGCTCCTGCCCCACCTGTTCCAGGCCAGCTGTGTCAGGGGTACTGCCTCCGTTTCTCCAGGCTGGGACCTCCACTGCAGTGGGTACATTGGACACTCAGACCAGCCCCAGGGCCTGGCAGTTCCTGGTGAAGACTGAGACAGCCCGACACCCGTCCACACCCCCGCCCAGGATGGGGTGGCTGCTGGGTCACTCGGTCCTGGCAAACACGCTGGAGGGAGGGGCTGGATTGACTTTAGGGCACTGGTAAAAGCTCACATCCATCTGTCCACCCAGAACAGCTGGTGCCAAGCACCCACTTAGCAGGACAGGGCAGCCCGCGCCTCCACACTGCCCATGCCCCCTCCCGTCTCCCAGGACGTCCACACAGGAGCCACATGTGTCCTGGACCCACGCCACCCCCCGCTCTGTCCCTCTGTTCCCTGAGCTGGGCTGGCAGGGGAAGCTGAGGTGTACAGGGATGGCCAAGGCCTCCTCCCTCCCCCCTGCACCCCCTAGCCCCATTGGCATTACCTCAGAGCAGACAACAGCTTAGTGGGGACCCAAGTGAGGGGGTGTCAGTGGCCCAGGCCCTGCCCTGCCCAGTCACTCAGGCAGCTAAGAGAGCAGGAAGGGCCCAGACGACACCCCCACAGACATATGCCAGCCCCTCCGGGTGACCAAAATCATCTCAGTAAAGGCAGATGAGGCCAAGCGAAAAGGGGTGGGTGGAAGAACCGGCTCTGAGTCTCAGCCCACAGACACTCGGACACTCGTCGGCCCGGTAGGCAGGGGTTCCTGGTGGCCTCAGGCTGTCAGGCCCGGCCCCCTCCCGCAGCTGTCTCCAGCTCCCACCTCCCCCGCCCACCCCCCAGGACTCCTATTTCACTGAGGAGATTAAGACCACCTGGCGAGAACCCCTCCCACCCCTCCCCTCTCCCCAGCCCTCCCTCCTAACCCTGTCGGCCCCTTGAGGTGCCCTCCCGGCCCCGGCCCTCCTCTCCCATCCCCACGTTCCTCCACGGCAGCCTCCACGCCCTGCCCTGCCCTGCCCTGCCATGGGCCTGAGGATGTCCCCACCCGCTCTGATGGCCACCTCGGGTCACTTCTCCTCAGCCCATACCCTGGCCTAACCCCCACCCTGAGCCTCCAGTCCCTCCAATCCTCACCCTTTATGTCCCCCAGCCCTGCATAGATACAGGCATCGTCACCAGCCACGGCAATGGATCCCGTCCACCTCCCACCCGGCCACTCCAGACCCAAATTCAGCACTGGCTTCAGCCTCCTGCCATTCTTGCTGGGTCTCAGGAGGGAACCGGGCCAGCCAGGTGCTGTCTGGGACTGTAGGCTCTGAGCCTGGTCCCTGCTCAGTTCCAGCAGCCAGTGGGCCAGGGGTGCTCAGCTGAGGACCCCCACTCCATCCAGCCTGCCGTGGGGCAGCCGGCCTGGCCTGATGCTGGCTCAGACAGACTCATGAGGAATCTGAGCTCTGAAAACCGCAGCTCCGAGCTTGCCTGTTTGTTTGCTT
SEQ ID NO.2 (three mutations occur singly)
CCTAGAGGATCCAGGGATGGCCCAGGTGCTCCTGCCCCACCTGTTCCAGGCCAGCTGTGTCAGGGGTACTGCCTCCGTTTCTCCAGGCTGGGACCTCCACTGCAGTGGGTACATTGGACACTCAGACCAGCCCCAGGGCCTGGCAGTTCCTGGTGAAGACTGAGACAGCCCGACACCCGTCCACACCCCCGCCCAGGATGGGGTGGCTGCTGGGTCACTCGGTCCTGGCAAACACGCTGGAGGGAGGGGCTGGATTGACTTTAGGGCACTGGTAAAAGCTCACATCCATCTGTCCACCCAGAACAGCTGGTGCCAAGCACCCACTTAGCAGGACAGGGCAGCCCGTGCCTCCACACTGCCCATGCCCCCTCCCGTCTCCCAGGACGTCCACACAGGAGCCACATGTGTCCTGGACCCACGCCACCCCCCGCTCTGTCCCTCTGTTCCCTGAGCTGGGCTGGCAGGGGAAGCTGAGGTGTACAGGGATGGCCAAGGCCTCCTCCCTCCCCCCTGCACCCCCTAGCCCCATTGGCATTACCTCAGAGCAGACAACAGCTTAGTGGGGACCCAAGTGAGGGGGTGTCAGTGGCCCAGGCCCTGCCCTGCCCCGTCACTCAGGCAGCTAAGAGAGCAGGAAGGGCCCAGACGACACCCCCACAGACATATGCCAGCCCCTCCGGGTGACCAAAATCATCTCAGTAAAGGCAGATGAGGCCAAGCGAAAAGGGGTGGGTGGAAGAACCGGCTCTGAGTCTCAGCCCACAGACACTCGGACACTCGTCGGCCCGGTAGGCAGGGGTTCCTGGTGGCCTCAGGCTGTCAGGCCCGGCCCCCTCCCGCAGCTGTCTCCAGCTCCCACCTCCCCCGCCCACCCCCCAGGACTCCTATTTCACTGAGGAGATTAAGACCACCTGGCGAGAACCCCTCCCACCCCTCCCCTCTCCCCAGCCCTCCCTCCTAACCCTGTCGGCCCCTTGAGGTGCCCTCCCGGCCCCGGCCCTCCTCTCCCATCCCCACGTTCCTCCACGGCAGCCTCCACGCCCTGCCCTGCCCTGCCCTGCCATGGGCCTGAGGATGTCCCCACCCGCTCTGATGGCCACCTCGGGTCACTTCTCCTCAGCCCATACCCTGGCCTAACCCCCACCCTGAGCCTCCAGTCCCTCCAATCCTCACCCTTTATGTCCCCCAGCCCTGCATAGATACAGGCATCGTCACCAGCCACGGCAATGGATCCCGTCCACCTCCCACCCGGCCACTCCAGACCCAAATTCAGCACTGGCTTCAGCCTCCTGCCATTCTTGCTGGGTCTCAGGAGGCAACCGGGCCAGCCAGGTGCTGTCTGGGACTGTAGGCTCTGAGCCTGGTCCCTGCTCAGTTCCAGCAGCCAGTGGGCCAGGGGTGCTCAGCTGAGGACCCCCACTCCATCCAGCCTGCCGTGGGGCAGCCGGCCTGGCCTGATGCTGGCTCAGACAGACTCATGAGGAATCTGAGCTCTGAAAACCGCAGCTCCGAGCTTGCCTGTTTGTTTGCTT
The specific sequencing primer of the mutation site comprises the following components:
the primer sequences of g.19737694C > T and g.19737957A > C are SEQ ID No.3 and SEQ ID No.4;
the primer sequences of g.19738665G > C are SEQ ID No.5 and SEQ ID No.6.
The diagnosis kit can also comprise enzymes and reagents commonly used in PCR reaction, such as Taq enzyme, dNTP mixed solution, mgCl2 solution, deionized water and the like; can also contain standard substance and/or reference substance.
Specifically, the technical scheme for solving the problems of the invention comprises the following steps: (1) Screening out new mutation related to the incidence risk of the Fallo tetrad disease of Chinese Han population, and providing a post-mutation base sequence of the site; (2) Establishing unified specimen library and dataLibrary: collecting standard-compliant blood samples with standard procedures (SOP), the system collecting complete demographic and clinical data; (3) mutation screening and validation of its effect: using Sanger sequencing technique, we found that 9 patients had the enhancer region g.19737694C upstream of the TBX1 gene in 302 patients with Fallotetrad alone and 1000 control populations without family history of cardiac defects>T，g.19737957A>C，g.19738665G>Repeated mutations in C and a significant correlation with the occurrence of Fallotetrad (g.19737694C)>T，OR＝6.66，p＝3.67×10 -03 ；g.19737957A>C，OR＝6.66，p＝3.67×10 -03 ；g.19738665G>C，OR＝3.34，p＝7.96×10 -03 ). These 3 mutations were then confirmed by functional experiments to result in a significant decrease in the expression of the TBX1 gene, and animal experiments also confirmed that this region knockout (Sscofa 11.A/susScr11 (Feb.2017), chr14: 51281844-51283216) resulted in congenital heart defects. And validated in the other 516 cases of simple valonefour cases and 2276 normal control samples. Verification results show that g.19737694C>T was absent in both cases and controls. And g.19737957A>C(OR＝4.42，P＝2.22×10 -02 ) And g.19738665G>C(OR＝2.95，P＝3.18×10 -02 ) Each significantly correlated with a single TOF event.
The inventors collected standard-compliant blood samples using standard procedures (SOP), collected complete demographic, clinical data, etc., and scanned the enhancer region upstream of the TBX1 gene using Sanger sequencing techniques.
In particular, the experimental method studied mainly comprises the following parts:
1. selection of study objects
(1) Case: 302 cases of Fallotetraia simplex are clearly diagnosed by cardiac ultrasound or surgery. Exclusion criteria: other deformities, chromosomal abnormalities, maternal pregnancy, diabetes, phenylketonuria, measles, or exposure to teratogens were combined.
(2) Control: 1000 healthy controls without family history of heart defects.
The study was performed using 1302 samples meeting the standard.
2. Extracting peripheral blood genome DNA by phenol-chloroform method, and operating according to conventional method. Generally, 20-50 ng/. Mu.l DNA can be obtained with a purity (ratio of UV 260OD to 280 OD) of 1.6-2.0.
Sanger sequencing technique to screen for mutation sites
(1) Taking a whole genome DNA sample of a subject;
(2) Primer3 software is adopted to design primers on line;
(3) Scanning the upstream enhancer region of the TBX1 gene using Sanger sequencing;
(4) Differences in the distribution of each genotype in the case of Fallotetrad alone versus the healthy controls were detected and compared.
4. Luciferase reporter gene experiment proves mutation site regulation function
(1) Synthesizing a target fragment carrying mutation and constructing a plasmid;
(2) Competent cell transformation and recombinant plasmid validation were performed;
(3) Cell transfection and culture are completed;
(4) And (5) carrying out luciferase reporter gene detection.
5. Mutation site region (grch 37.p13, chr22: 19737651-19738734) knockout confirm the region regulatory function
(1) Designing a CRISPR/Cas9 gene editing system primer;
(2) Editing the region where the mutation is located by using a CRISPR/Cas9 system;
(3) Screening and verifying to obtain target cells, and detecting gene expression.
6. Genotyping of single mutation sites using Sanger sequencing platform
(1) Taking a subject DNA sample;
(2) Primer3 software is adopted to design primers on line;
(3) Scanning the upstream enhancer region of the TBX1 gene using Sanger sequencing;
(4) The differences in the distribution of different genotypes in the case of Fallotetrad alone versus the healthy controls were detected and compared.
7. Diagnostic kit preparation method
And (3) scanning an upstream enhancer region of the TBX1 gene by Sanger sequencing and detecting a single mutation site, and determining mutation sites with genotype distribution difference in the simple Fallotetrad disease case and the healthy control as indexes for diagnosing the simple Fallotetrad disease. Finally, the detection primer of the mutation site which is screened and is related to the incidence of the simple Fallotetraia is formed into an auxiliary diagnosis kit (g.19737694C > T, g.19737957A > C, g.19738665G > C). The diagnostic reagent may include one or more pairs of specific primers for the mutation site, such as Taq enzyme, dNTP, etc.
8. Statistical analysis method
Differences in distribution among groups of study subjects are compared using chi-square test (for classification variables) or t-test (for continuity variables) for demographics and the like.
Statistical analysis was done by specialized statistical analysis software (R3.0.3). The P-value for the statistical significance level was set to 0.05, and all statistical tests were double-sided.
The invention is further illustrated below:
in the 302 qualified cases of Fallotetrad alone, we used Sanger sequencing to scan the non-coding region upstream of the TBX1 gene.
Based on Sanger sequencing detection results, the inventors detected that 2, 2 and 5 patients in the "Fallo quadruple disease case" group had g.19737694C > T, g.19737957A > C, and g.19738665G > C mutations, respectively.
These 3 mutations were then confirmed by functional experiments to result in a significant decrease in TBX1 gene expression, and animal experiments also confirmed that this region knockout resulted in congenital heart defects.
And validated in the other 516 cases of simple valonefour cases and 2276 normal control samples. Verification results show that g.19737694C>T was absent in both cases and controls. And g.19737957A>C(OR＝4.42，P＝2.22×10 -02 ) And g.19738665G>C(OR＝2.95，P＝3.18×10 -02 ) Are all significantly related to simple TOF.
Based on the above experimental results, the present inventors found three mutation sites that can be used for the auxiliary diagnosis of Fallotetraia simplex.
Specifically, the change of the base sequences of the three mutation sites is helpful for the auxiliary diagnosis of the simple Fallotetrad disease, and provides support for clinicians to quickly and accurately grasp the disease state and the disease severity of patients and to timely take more personalized control schemes.
The invention has the beneficial effects that:
the mutation site sequence change provided by the invention is used as a marker for auxiliary judgment of simple Fallotetrad disease, and has the advantages that:
(1) The mutation site is a novel gene biomarker, is different from the traditional biomarker, is stable, minimally invasive and easy to detect, and the successful development of the biomarker can provide a reference for the development of biomarkers of other diseases in a brand new situation for the auxiliary diagnosis and treatment of the simple Fallotetraia.
(2) By adopting a strict verification and evaluation system, the inventor initially adopts Sanger sequencing to scan a non-coding region of the TBX1 gene to obtain a mutation site spectrum related to diseases, and adopts a Sanger sequencing method to verify in a large-sample single-Fallo tetrad patient; the application of the method and the strategy accelerates and ensures the clinical application of the mutation site biomarker and the diagnostic kit, and provides a reference for the development of other disease biomarkers.
The invention expounds the influence of the mutation site on the progress of the simple Fallotetrad by researching the application prospect of the mutation site in the auxiliary diagnosis of the simple Fallotetrad, and reveals the diagnostic value of the simple Fallotetrad. Therefore, the invention obtains the mutation site spectrum related to the onset of the simple Fallotetrad disease; the development and application of the related auxiliary diagnosis kit are carried out through the change of the mutation site sequence, so that the diagnosis of the simple Fallo tetrad disease is more convenient and feasible, a foundation is laid for a clinician to quickly and accurately grasp the disease condition of a patient, and the development of a novel small molecular medicine target with potential treatment value is provided.
Drawings
Fig. 1: luciferase reporter gene results.
Fig. 2: target region knockout and TBX1 expression results
Detailed Description
The invention is further illustrated by the following examples, wherein the procedures not described in detail in the course of the experiment are related procedures known to those skilled in the art, and the reagents used are kit reagents provided by the manufacturer of the apparatus compatible with the detection method and conventional reagents, which are commercially available, and are not specifically described.
Example 1 sample collection and sample data arrangement
The inventor collects a large number of blood specimens of patients with simple Fallotetrad disease and normal people from a first affiliated hospital, a second affiliated hospital, an affiliated children hospital and normal people of a community of Nanjing medical university in 2008 to 2014, and selects a sample Sanger sequencing scanning typing experimental sample meeting the following standards from the blood specimens by arranging sample data:
1. heart ultrasound or surgery was clearly diagnosed as 302 cases of simple valprofour.
2. Without incorporation of other deformities, chromosomal abnormalities, maternal pregnancy without diabetes, phenylketonuria, measles, or prior exposure to teratogens;
3. samples 1000 in community-sourced whole population queues.
And the system collects the demographics and clinical data of the samples.
EXAMPLE 2 sequencing scanning of mutation sites in peripheral blood DNA
In the above-mentioned patients with the condition of simple Fallotetrad and healthy controls, the relevant results were obtained by Sanger sequencing, the sequencing process followed the standard operation of Sanger sequencing, and the Sanger sequencing primers were designed manually, the primer sequences were the upstream primer I,5'-CCTAGAGGATCCAGGGATGG-3', the upstream primer II,5'-AGATGAGGCCAAGCGAAAA-3', the downstream primer I,5'-CACAGACACTCGGACACTCG-3', the downstream primer II,5'-GCTTGCCTGTTTGTTTGCTT-3', and the primer sequences were synthesized by Nanjin Style company.
The method comprises the following specific steps:
1. hemolysis reagent (109.86 g sucrose per 1000ml MgCl) was added to the white blood cells stored in a 2ml cryopreservation tube 2 1.01g, triston X-100 10ml,0.1M Tris-HCl (pH 8.0) solution to 1000ml, the same applies below), and the mixture is completely transferred after being inverted and mixed.
2. Removing red blood cells: the 5ml centrifuge tube was filled to 4ml with hemolysis reagent, mixed upside down, centrifuged at 4000rpm for 10 minutes and the supernatant discarded. To the pellet was added 4ml of hemolysis reagent, again inverted and washed once again, centrifuged at 4000rpm for 10 minutes, and the supernatant was discarded.
3. Extracting DNA: to the precipitate, 1ml of an extract (122.5 ml of 0.2M sodium chloride, 14.4ml of 0.5M ethylenediamine tetraacetic acid, 15ml of 10% sodium dodecyl sulfate, 148.1ml of double distilled water, the same applies hereinafter) and 8. Mu.l of proteinase K were added, and the mixture was thoroughly mixed by shaking on a shaker, and water-bath was carried out at 37℃overnight.
4. Protein removal: 1ml of saturated phenol was added and thoroughly mixed (hand-shake 15 min), centrifuged at 4000rpm for 10min, and the supernatant was transferred to a new 5ml centrifuge tube. An equal volume of a mixture of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol=24:1, v/v, the same applies below) was added to the supernatant, and after thorough mixing (15 minutes by hand shaking), the mixture was centrifuged at 4000rpm for 10 minutes, and the supernatant was taken (split into two 1.5ml centrifuge tubes).
5. DNA precipitation: 60 μl of 3M sodium acetate was added to the supernatant, and then ice absolute ethanol was added in an equal volume to the supernatant, and the supernatant was gently shaken up and down to give a white flocculent precipitate, which was centrifuged at 12000rpm for 10min.
6. DNA washing: adding ice absolute ethanol into the precipitate, centrifuging at 12000rpm for 10min, removing supernatant, and vacuum-pumping or evaporating in clean and dry environment.
7. Measuring the concentration: generally, 20-50 ng/. Mu.l of DNA can be obtained with a purity (ratio of UV 260OD to 280 OD) of 1.6-2.0.
8. A PCR reaction system of 30 microliters, comprising: template 50ng; primer F:1 μl and primer R:1 microliter; 2×MIX15 microliters; h 2 O was made up to 30 microliters. (detection of different mutation sites and addition of related primers, respectively)
9. PCR reaction procedure: 95 ℃ for 5min; (95 ℃ C. 30s; tm ℃ C. 30s;72 ℃ C. 30 s). Times.40 cycles; 72 ℃ for 6min; maintained at 4 ℃.
10. Sanger sequencing was performed using the ABI3730 platform;
11. sequence comparison and analysis was performed using Chromas2 software.
12. Analysis and processing of Sanger sequencing results: in the group of "simple Fallotetrad cases", 2 and 5 patients were found to have g.19737694C > T, g.19737957A > C, and g.19738665G > C mutations, respectively.
Example 3 functional experiments of the mutant site of the luciferase reporter Gene
And (3) detecting the influence of mutation on the function of the non-coding region element by adopting a luciferase reporter gene experiment. According to the working principle of pGL4.26 vector, target region fragments carrying or not carrying mutation are respectively designed and synthesized, and cloned into pGL4.26 plasmid respectively to construct two recombinant vector plasmids of wild type and mutant type, then the two recombinant vector plasmids are transfected into H293T cells, luciferase substrate is added, and the influence of mutation on the function of the target fragment is judged by detecting the intensity of fluorescence value.
The specific experimental steps are as follows:
(1) Synthesis of the target fragment: the present study synthesized the sequence (WT) of the potential regulatory region directly and produced sequences containing the mutation sites, respectively, by site-directed mutagenesis (g.19737694c > T, g.19737957a > C, g.19738665g > C). The synthesis and directed mutation of the target sequence were performed by the biological technology company of Nanjing New Keyuan.
(2) Construction of pGL 4.26-target fragment vector:
a) The target fragment and pGL4.26 empty vector are subjected to double enzyme digestion reaction, wherein the system is respectively 40 mu l and 20 mu l, and enzyme digestion is carried out at 37 ℃ overnight; the specific system is as follows:
Figure BDA0004200873190000111
b) And (3) enzyme cutting, product gel cutting and purification: performing gel electrophoresis on the target fragment and the empty vector enzyme digestion product by using 1% agarose, then rapidly cutting out a gel block containing DNA under an ultraviolet lamp, recovering the target fragment DNA by using a TaKaRa gel purification kit, and measuring the concentration and purity for later use;
c) Ligation of cleavage products: mixing the empty carrier with the target fragment (1:6) by adopting a TaKaRa DNA ligation kit, adding an equal volume of Solution I into the mixture to prepare a total volume of 10 mu l, and incubating the mixture at 16 ℃ for 2 hours after uniformly mixing the mixture;
(3) Competent cell transformation:
a) Adding the connection product in the previous step into competent cells, uniformly mixing, and incubating on ice for 30 minutes;
b) Immediately after incubation at 42 ℃ for 90 seconds, the mixture was placed on ice for incubation for 3 minutes;
c) 900. Mu.l of LB medium without antibiotics was added, incubated at 37℃for 10min, then incubated at 37℃for 45 min with shaking, 150 revolutions per minute;
d) 2,500g is centrifugated for 5 minutes, 900 mu l of supernatant is removed and resuspended, and the mixture is evenly coated on LB culture medium containing ampicillin (60 mu g/ml), and the mixture is placed right up for 10 minutes at room temperature, and after bacterial liquid is dried, the mixture is cultivated for 12-16 hours at 37 ℃ in an inverted way;
(4) And (3) verifying recombinant plasmids:
a) Randomly picking 8-10 monoclonal colonies per dish, placing the colonies in a 15ml EP tube filled with 5ml LB liquid medium (containing Amp), and culturing overnight at 37 ℃ in a shaking way;
b) Extracting plasmids by using a plasmid small-amount extraction kit after 16 hours;
c) Double enzyme digestion is carried out on the extracted plasmid by Mlu I enzyme and HindIII enzyme, agarose gel electrophoresis is carried out on enzyme digestion products, positive clone is determined, then the corresponding plasmid is sent to Nanjing Jinsi Biotechnology company for sequencing, only the base at the target mutation is selected to be different, and the recombinant plasmid with the rest positions consistent with the reference sequence is extracted and then used for subsequent research;
(5) Cell transfection:
a) Preparation before transfection: the cells are digested by pancreatin one day before transfection, resuspended by complete culture solution, and evenly spread into 24-hole cell culture plates with the density of about 70-80%;
b) Preparing a transfection mixed solution: the method comprises the steps of selecting plasmid dosage with fluorescence value between 1000 and 99999 according to a pre-experiment, wherein the mass ratio of the Lipofectamine 2000 dosage to the target plasmid is 2:1, the final volume of the plasmid to the pRL-SV40 plasmid to the Lipofectamine 2000 transfection reagent is 25 mu l/hole, supplementing the plasmid to the pRL-SV40 plasmid with a culture solution without antibiotics and serum, and incubating the plasmid to the Lipofectamine 2000 transfection reagent for 5 minutes at room temperature after uniformly mixing the plasmid to the Lipofectamine 2000 dosage;
c) Taking out the 24-hole culture plate in the step a), changing the liquid, adding 425 mu l of complete culture liquid into each hole, adding 75 mu l of transfection mixed liquid into each hole, and culturing for 24 hours;
(6) Reporter gene detection (using Promega reporter gene detection kit):
a) The 24-well plate was removed, the medium was discarded, the cells were washed 2 times with PBS, and 120. Mu.l of 1 XPLB was added to each well;
b) Oscillating for 15 minutes, 60 revolutions per minute;
c) Mixing Luciferase Assay Substrate with Luciferase Assay buffer II, packaging, and packaging to give 50 μl +.
A hole for standby;
d) Diluting 50 XSTOP & GLD substrate to 1×, dispensing 50 μl/well;
e) Gently blow the cells and transfer the cell lysate into a new 1.5ml EP tube;
f) Samples were taken at 20 μl/well and assayed for firefly luciferase and Renilla luciferase activity using an LB960 Centro XS3 chemiluminescent instrument.
Experiments and statistics show that luciferase activity of plasmids carrying 3 mutations is significantly lower than that of wild type, and that all 3 mutations can lead to reduced TBX1 expression, which is probably caused by disruption of enhancer structure, preventing transcription factor from binding to it, and reducing TBX1 expression
(FIG. 1).
Example 4 Gene regulatory function experiments in the region of the mutation site were verified
The CRISPR/Cas9 system consists of two parts, endonuclease Cas9 and single guide RNA (sgRNA). The sgrnas are capable of binding to Cas9 proteins, recognizing the target region sequences through complementary pairing, thereby mediating Cas9 protein cleavage of target DNA, introducing DNA double-strand breaks (DSBs). And the non-homologous end joining (non-homologous end joining, NHEJ) mode restores that DSBs are prone to gene mutation so as to realize knockout of specific genes or target sequences. The specific experimental process and the steps are as follows:
(1) The sgRNA was designed using Vector NTI 11.5.1 software and the PCR Primer was designed using Primer3 (v 0.4.0) on-line Primer design software for verification of the edit results of the CRISPR/Cas9 system.
(2) The FOR/REV sgRNA is diluted and then is subjected to PCR by high-fidelity enzyme, wherein a template is pUC57-U6-gRNA (Kana resistance) plasmid, and specific reaction conditions are as follows:
Figure BDA0004200873190000131
(3) Agarose gel electrophoresis is carried out on the obtained PCR product, and the singleness of the band is detected;
(4) Purifying and recovering the PCR product, and determining the concentration of the recovered product;
(5) Preparing a cutting connection system, constructing an sgRNA vector based on pGL3-ccdb-EF1a-puroeM+83 (Amp resistance), wherein the specific reaction system and conditions are as follows:
Figure BDA0004200873190000132
Figure BDA0004200873190000141
reaction conditions:
Figure BDA0004200873190000142
(6) Taking 2 μl of the product obtained in the previous step, and uniformly mixing with 20 μl of competent cells to perform competent cell transformation;
(7) PCR (2U 6 universal primer) method to identify recombinant sgRNA vector clone;
(8) And (3) medicine screening and cutting result verification: about 60% of cells in each hole are transfected, 0.8 mug of Cas9 plasmid and sgRNA plasmid are added, 1.5 mug of Lipofectamine (TM) 2000 is added, different gradient medicines Puromycin and Blasticidin are added after 12 hours of transfection, cell DNA is collected after 48 hours, the sequence of the knocked-out region is amplified by using primers in the following table, and the knocked-out result is verified by gel electrophoresis and Sanger sequencing, and part of the results are shown in FIG. 2;
table: CRISPR/Cas9 knockout verification primer
Figure BDA0004200873190000143
(9) And (3) knocking out a target region of the HEK293T cell line and carrying out expression detection.
Experiments and statistics show that cell clones with knockouts of potential enhancer regions have significantly lower TBX1 expression than wild type, suggesting that this potential regulatory region functions as a TBX1 enhancer and that TBX1 expression is significantly reduced when the functionally active region is disrupted (fig. 2).
Example 5 Sanger sequencing genotyping of mutation sites in an extended population cohort sample
The mutation sites found in Sanger sequencing scans to be associated with the onset of Fallotetrad disease were detected in another 516 cases of Fallotetrad disease and 2276 normal control samples. The method comprises the following specific steps:
1. the hemolysis reagent was added to the white blood cells stored in the 2ml cryopreservation tube, and the mixture was inverted and completely transferred.
2. Removing red blood cells: the 5ml centrifuge tube was filled to 4ml with hemolysis reagent, mixed upside down, centrifuged at 4000rpm for 10 minutes and the supernatant discarded. To the pellet was added 4ml of hemolysis reagent, again inverted and washed once again, centrifuged at 4000rpm for 10 minutes, and the supernatant was discarded.
3. Extracting DNA: 1ml of extract and 8. Mu.l of proteinase K were added to the precipitate, and mixed well on a shaker with sufficient shaking, in a water bath at 37℃overnight.
4. Protein removal: 1ml of saturated phenol was added and thoroughly mixed (hand-shake 15 min), centrifuged at 4000rpm for 10min, and the supernatant was transferred to a new 5ml centrifuge tube. An equal volume of a mixture of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol=24:1) was added to the supernatant, and after thorough mixing (15 minutes by hand shaking), the supernatant was centrifuged at 4000rpm for 10 minutes and the supernatant was taken (split into two 1.5ml centrifuge tubes).
5. DNA precipitation: 60 μl of 3M sodium acetate was added to the supernatant, and then ice absolute ethanol was added in an equal volume to the supernatant, and the supernatant was gently shaken up and down to give a white flocculent precipitate, which was centrifuged at 12000rpm for 10min.
6. DNA washing: adding ice absolute ethanol into the precipitate, centrifuging at 12000rpm for 10min, removing supernatant, and vacuum-pumping or evaporating in clean and dry environment.
7. Measuring the concentration: generally, 20-50 ng/. Mu.l of DNA can be obtained with a purity (ratio of UV 260OD to 280 OD) of 1.6-2.0.
8. Genotyping was performed on the regulatory region upstream of the TBX1 gene using the Sanger sequencing platform.
9. A PCR reaction system of 30 microliters, comprising: template 50ng; primer F:1 μl and primer R:1 microliter; 2×MIX15 microliters; h 2 O was made up to 30 microliters.
10. PCR reaction procedure: 95 ℃ for 5min; (95 ℃ C. 30s; tm ℃ C. 30s;72 ℃ C. 30 s). Times.40 cycles; 72 ℃ for 6min; maintained at 4 ℃.
11. Sanger sequencing was performed using the ABI3730 platform;
12. sequence comparison and analysis was performed using Chromas2 software and validated in another 516 cases of simple valoner quadruple and 2276 normal control samples. Verification results show that g.19737694C>T was absent in both cases and controls. And g.19737957A>C(OR＝4.42，P＝2.22×10 -02 ) And g.19738665G>C(OR＝2.95，P＝3.18×10 -02 ) Are all significantly related to simple TOF.
Example 6 preparation of kit for auxiliary diagnosis of mutation site for Fallotetrad simple disease
The preparation and operation flow of the mutation site kit is based on Sanger sequencing scanning detection typing technology. The kit contains a batch of mutation site-specific primers (including the following primers: g.19737957A)>C，g.19737694C>The primer sequences of the T mutation site are SEQ ID No.3 and SEQ ID No:4；g.19738665G>The primer sequences of the C mutation site are SEQ ID No.5 and SEQ ID No. 6), and common reagents required by the corresponding PCR technology can be added, such as: dNTPs, mgCl 2 Double distilled water, etc., which are well known to those skilled in the art, and standards and controls (e.g., genotyping standards and blank controls, etc.) may be used. The kit has the value that only peripheral blood is needed without other tissue samples, mutation sites are detected through the most simplified and specific primer pairs, and simple Fallotetraia is judged through the assistance of mutation site spectra, so that the kit is stable, convenient to detect and accurate, and the sensitivity and the specificity of disease diagnosis are greatly improved, and therefore, the kit is put into practice, and can help to guide diagnosis and more effective individuation treatment.
TABLE 1 relevant mutation site primer and Probe information
Figure BDA0004200873190000161

Claims (7)

1.A TBX1 gene mutant sequence associated with a simple tetrad, characterized in that: the mutated sequence is SEQ ID NO.2, and the TBX1 mutated sequence has a mutation of g.19737694C > T, or g.19737957A > C, or g.19738665G > C compared with the normal gene sequence (GRCh37.p13).
2. A primer combination for detecting a mutant sequence of TBX1 gene according to claim 1, characterized in that:
primer for detecting g.19737694c > T: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer for detection g.19737957a > C: the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4;
primer to detect g.19738665g > C: the upstream primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.6.
3. A method for detecting the TBX1 gene mutant sequence according to claim 1, characterized in that: mutation detection was performed on the TBX1 gene enhancer region using the Sanger sequencing method using PCR amplification primers.
4. A detection method according to claim 3, wherein: the PCR amplification primer is a nucleotide sequence shown as SEQ ID NO.3-SEQ ID NO.6.
5. The use of the primer combination of claim 2 for preparing a secondary diagnostic kit for simple valproud's disease.
6. A kit for assisting diagnosis of simple Fallotetraia, which is characterized by comprising a primer combination for detecting the TBX1 gene mutation sequence of claim 1.
7. The kit according to claim 6, wherein the kit comprises one or more pairs of the primer combinations according to claim 2.
CN202310461505.7A 2023-04-26 2023-04-26 TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof Pending CN116411068A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310461505.7A CN116411068A (en) 2023-04-26 2023-04-26 TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310461505.7A CN116411068A (en) 2023-04-26 2023-04-26 TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof

Publications (1)

Publication Number Publication Date
CN116411068A true CN116411068A (en) 2023-07-11

Family

ID=87057814

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310461505.7A Pending CN116411068A (en) 2023-04-26 2023-04-26 TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof

Country Status (1)

Country Link
CN (1) CN116411068A (en)

Similar Documents

Publication Publication Date Title
CN111647654B (en) Primer composition, kit and method for detecting hemochromatosis and hepatolenticular degeneration susceptibility gene mutation
CN111676283B (en) Application of mitochondrial DNA single nucleotide polymorphism related to occurrence of high altitude pulmonary edema
CN110527719B (en) Method for establishing early screening scale for gestational diabetes risk assessment
CN109055532B (en) Primer composition for genetic deafness gene detection before embryo implantation, kit and application
CN107557461B (en) Detection method of nucleic acid mass spectrum for early screening of liver cancer susceptibility genes
CN115948532A (en) SMA detection kit based on digital PCR technology
CN116042678A (en) Fusion protein for detecting nerve syphilis and kit thereof
CN109234396B (en) A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application
Ramezanzadeh et al. Detection of paternally inherited fetal point mutations for β-thalassemia in maternal plasma using simple fetal DNA enrichment protocol with or without whole genome amplification: an accuracy assessment
CN109576799B (en) Construction method of FH (sequencing by Happy (FH) sequencing library, primer group and kit
CN110846409A (en) Primer combination for detecting TNNI3K gene mutation and application thereof
CN108715893B (en) SNP markers related to radioactive brain injury caused by radiotherapy and application thereof
CN109457031B (en) BRCA2 gene g.32338309A & gtG mutant and application thereof in breast cancer auxiliary diagnosis
CN116769895A (en) CYP51A1 gene low-frequency missense mutation related to congenital heart disease and application thereof
CN107557468B (en) Cancer-testis gene genetic marker related to auxiliary diagnosis of primary lung cancer and application thereof
CN116926185A (en) Detection of mutation of pathogenic gene of autosomal dominant polycystic kidney disease
CN116376918A (en) SCN5A mutant gene, primer, kit, detection method and application
WO2018129888A1 (en) Primary biliary cholangitis-associated interleukin 21 receptor and application thereof
CN116411068A (en) TBX1 gene non-coding mutation related to simple Fallotetrad disease and application thereof
CN112980949B (en) SNP marker for identifying nasopharyngeal carcinoma high-risk group, kit and application thereof
WO2018129887A1 (en) Primary biliary cholangitis-associated interleukin 21 and application thereof
CN110055258B (en) Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof
CN109355379B (en) Kit for detecting autosomal dominant hereditary deafness family-induced deafness gene mutation
CN108486230B (en) Kit for noninvasive detection of MITF gene mutation and preparation method thereof
CN111218505A (en) TBX5 gene polymorphism detection kit and detection method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination