WO2018129888A1

WO2018129888A1 - Primary biliary cholangitis-associated interleukin 21 receptor and application thereof

Info

Publication number: WO2018129888A1
Application number: PCT/CN2017/092505
Authority: WO
Inventors: 刘向东; 马雄; 陈卫昌; 史兴娟
Original assignee: 东南大学
Priority date: 2017-01-10
Filing date: 2017-07-11
Publication date: 2018-07-19
Also published as: CN106834449A; CN106834449B

Abstract

Provided is an application of interleukin 21 receptor (IL21R) in preparing a product for detecting or assisting in detecting, screening or predicting primary Biliary Cholangitis (PBC). Mononucleotide polymorphic sites of interleukin 21 receptor which are significantly correlated with the susceptibility of primary biliary cholangitis are: rs1859308, rs201883233, rs10852316, rs2189521, and rs58579343. The gene polymorphic sites of the IL21R have significant correlation with the occurrence of PBC and can be used as an indicator for PBC attack risk prediction.

Description

Interleukin 21 receptor associated with primary biliary cholangitis and its application

Technical field

The present invention belongs to the field of immunology, and specifically relates to an interleukin 21 receptor (IL21R) associated with primary biliary cholangitis and its use.

Background technique

Primary biliary cholangitis (PBC), formerly known as primary biliary cirrhosis, is a chronic progressive autoimmune disease involving the intrahepatic biliary system, mainly characterized by liver Progressive destruction of the inner bile duct with inflammatory changes of the portal vein eventually leads to fibrosis and cirrhosis. The disease mainly occurs in middle-aged women, and male cases account for only 10%. With the increasing awareness of PBC disease and the establishment of diagnostic methods, the incidence and prevalence of PBC are on the rise globally. In 2003, 501 healthy subjects (26-85 years old) were screened for PBC-specific anti-mitochondrial antibodies (AMA) (PDC-E2) in Shanghai. The positive rate of AMA was found to be higher than 0.16% in middle-aged women. Medium is above 0.3% [5]. In 2006, a positive rate of AMA (PDC-E2) was found to be higher than 0.05% in 8126 adults (18-83 years old) in Guangdong, and higher than 0.15% in middle-aged women. A recent AMA screening of 19,012 residents in Shanghai found that 0.40% of men and 0.94% of women were positive for AMA, and 25 of them (0.13%) had PBC. With the aging of China's population, PBC will rapidly develop into a more common disease in China. It may reach 200,000 to 300,000 patients in 2025 and 35 to 500,000 patients by 2050.

Early diagnosis and treatment are the most effective means of controlling the development of PBC disease. There is currently no effective way to treat PBC. Ursodeoxycholic acid is the only drug that effectively controls early PBC patients (especially those with no jaundice), but there is no cure, and the only way to save patients with advanced PBC is Liver transplantation is performed. China is a country with high incidence of viral hepatitis. The clinical symptoms of PBC are similar to viral hepatitis. PBC patients are often misdiagnosed as viral hepatitis or drug-induced hepatitis in the early stage, which seriously affects the diagnosis and treatment of patients with PBC. Therefore, early diagnosis and treatment of PBC patients has important social significance.

PBC has a strong genetic susceptibility, and the first-generation relatives of patients have a 100-fold higher incidence of PBC than the general population. According to reports from North America, Europe and Japan, the family incidence of PBC is 3.8-9%. In 2005, a large-scale survey in North America showed that the relative odds ratio of immediate family members of PBC patients was as high as 10.7. Analysis of identical twins in patients with PBC found a common incidence of 63%. In the past four years, our team has found three pairs of identical twin PBC patients in the survey of domestic PBC patients. The sister symptoms and onset time of the three pairs of patients are very close. Combined with international data, the identical pairs of PBC patients The common incidence rate of children 72.7%.

Since 2009, a series of results for genome-wide association analysis (GWAS) of white PBC patients have shown that PBC has a strong genetic susceptibility. The North American PBC Cooperative Group, which is a core member of the applicant, used GWAS and specific site high-density gene polymorphism analysis to conduct a cohort analysis of PBC patients and control populations in North America, confirming the genetic susceptibility of PBC and HLA-II antigens. IL12A, IL12RB2, STAT4, IRF5, ch17q12-21, MMEL1 and SPIB are closely related, and it is revealed that abnormalities in IL12R signaling pathway and Toll-like receptor (TLR)/TNF signaling pathway may lead to PBC . A small-scale GWAS study by Japanese scholars also found that the TNFSF15 locus is closely related to PBC. There is a certain foundation for the genetic research of PBC in China. Domestic scholars have carried out preliminary research on the genetic loci of HLA and CTLA4 and the genetic susceptibility of Han Chinese PBC.

We initiated and completed the Illumina Chinese chip scanning of 1122 Han Chinese PBC samples, combined with 4046 control data, and conducted a large-scale cohort analysis. It was first discovered and confirmed in the world that the IL21R gene locus reached GWAS significance. It was found for the first time that IL21R is abnormally highly expressed in the blood of patients with PBC, and its expression level is directly proportional to the degree of liver fibrosis.

At present, there is no patent literature in the world that mentions the relationship between IL21R gene locus and IL21R and PBC.

Summary of the invention

OBJECT OF THE INVENTION The first technical problem to be solved by the present invention is to provide an application of IL21R in the preparation of a product for detecting or assisting detection, screening or predicting primary biliary cholangitis.

The second technical problem to be solved by the present invention is to provide a series of single nucleotide polymorphism sites (SNPs) which are significantly associated with primary biliary cholangitis, and to find out which is associated with primary biliary cholangitis. Susceptibility correlates with the most prominent representative sites, thereby providing the use of said single nucleotide polymorphic sites (SNPs) for assessing susceptibility to primary biliary cholangitis.

A third technical problem to be solved by the present invention is to provide an application of IL21R in the preparation of an animal model of PBC.

A fourth technical problem to be solved by the present invention is to provide an application of IL21R in the preparation of a therapeutic drug for PBC.

Technical Solution: In order to solve the above technical problem, the technical solution adopted by the present invention is: In the first aspect, the application of IL21R in preparing a product for detecting or assisting detection, screening or predicting primary biliary cholangitis is provided. We initiated and completed the Illumina Chinese chip scanning of 1122 Han Chinese PBC samples, combined with 4,036 cases of control data, conducted a large-scale cohort analysis, and found for the first time in the world that the IL21R gene locus reached GWAS significance. And for the first time, the expression level of IL21R in the liver tissue of patients with PBC is directly proportional to the degree of liver fibrosis; specific gene polymorphism of IL21R and PBC were found by genome-wide association analysis. The disease is closely related.

The second aspect provides a series of single nucleotide polymorphisms of IL21R that are significantly associated with susceptibility to primary biliary cholangitis. The study was performed on 1122 Chinese Han PBC patients and 4036 normal subjects. The HumanOmniZhongHua-8 (v1.1) scan was used to analyze the genome-wide association data, and the gene polymorphism (SNP) was classified. Using the data obtained by the chip, PLINK software was used to compare all the polymorphic loci. The frequency of multiple SNPs of the IL21R gene was significantly different between PBC and normal population. The single nucleotide polymorphism site with IL21R is: rs1859308, the allele is C/T; rs201883233, the allele is A/C; rs10852316, the allele is C/A; rs2189521, the allele is A. /G; rs58579343, the allele is A/G.

In a third aspect, the present invention finds a linkage relationship between a plurality of SNPs and rs10852316 and rs2189521 by performing linkage disequilibrium analysis on SNPs at the IL21R site. Sequenom's iPlex method was used to verify the rs10852316 and rs2189521 polymorphism sites; and the Impute2 and PLINK software were used to perform the logistic regression principle. The sex was used as the covariate and analyzed by the additive effect model; similarly, significant differences were found. All of the SNPs in Table 1 are genetic polymorphic sites that are significantly different between PBC and control and can be used for risk prediction of PBC.

In a fourth aspect, the present invention analyzes and evaluates the relationship between each SNP locus and primary biliary cholangitis by using PLINK software, logistic regression principle, and calculates the relative risk (ORd ratio, OR) of the dangerous allele and 95 The % confidence interval yields a dangerous allele for this series of SNP loci. The risk alleles of the SNP locus of IL21R are: rs1859308 polymorphism site is C; rs201883233 polymorphism site is A; rs10852316 polymorphism site is C; rs2189521 polymorphism site is A; rs58579343 The polymorphic locus is A.

In a fifth aspect, the present invention specifically analyzes 30 patients with PBC, 30 patients with autoimmune hepatitis (AIH), 25 patients with chronic hepatitis B (CHB), and 6 normal controls (HC) by histochemical analysis of IL21R. The expression of IL21R protein was measured in liver tissue sections. It was found that IL21R was significantly increased in the liver tissue of PBC patients (P<0.01). The expression level of IL21R was positively correlated with the degree of inflammation and fibrosis of liver tissue in PBC patients.

In a sixth aspect, an animal model established in the present invention introduces IL21R expression or activates a PBC animal model, and the model is used for screening of a PBC therapeutic drug.

Advantageous Effects: The present invention has the following features and advantages:

1) The present invention found for the first time that multiple polymorphisms of IL21R are significantly associated with the occurrence of PBC, and can be used as one of the indicators for predicting the risk of PBC.

2) The present inventors have found that IL21R is significantly elevated in the liver tissue of PBC patients and is a target for PBC targeted therapy.

3) Discovery of the Invention It is possible to prepare a PBC animal model by introducing IL21R expression or activation into an animal model, and use this model for screening of PBC therapeutic drugs.

DRAWINGS

1 is a correlation diagram of a single nucleotide polymorphism site of the IL21R gene region and PBC determined in Example 1. In FIG. 1, the abscissa "Position on chr" is a position on a chromosome (unit: Mb); The coordinates are the P value of the single nucleotide polymorphism site associated with PBC (-log10 (p-value)), the right Recombination rate is the recombination rate, the unit (CM/Mb); the representative locus rs2189521 to ◆ Said.

Figure 2 is a histochemical analysis of IL21R in Example 3 in 30 patients with PBC, 30 patients with autoimmune hepatitis (AIH), 25 patients with chronic hepatitis B (CHB), and 6 normal controls (HC) in liver tissue sections. expression. 2A is the expression of IL21R in a liver tissue section of a patient with PBC in Example 3. 2B is the expression of IL21R in the liver tissue section of a patient with AIH in Example 3. 2C is the expression of IL21R in the liver tissue section of a patient with CHB in Example 3. 2D is the expression of IL21R in a liver tissue section of an HC tissue in Example 3. 2E is a statistical analysis of the expression of IL21R in 30 patients with PBC, 30 patients with AIH, 25 patients with chronic hepatitis B (CHB), and 6 normal (HC) liver tissue sections in Example 3 (** * is P < 0.001, ** is P < 0.01). Fig. 2F is a result of analysis of the correlation between the expression of IL21R in liver tissue sections of 30 patients with PBC and the degree of inflammation of liver tissue in PBC patients in Example 3. 2G is a result of analysis of the correlation between the expression of IL21R in liver tissue sections of 30 PBC patients and the degree of liver tissue fibrosis in PBC patients in Example 3.

detailed description

The invention is further illustrated by the following specific examples and the accompanying drawings.

The experimental materials, main reagents and formulations used in the examples of the present invention are as follows:

Main experimental materials and main reagents:

1. DNA samples and serum of patients with primary biliary cholangitis and normal controls;

2. Whole genome association analysis chip analysis kit: The HumanOmniZhongHua-8 (v1.1) analysis kit manufactured by Illumina Co., Ltd. includes a chip and a reagent.

Main solution preparation:

1. Phosphate buffer (PBS, 1 L): 8 g NaCl, 0.2 g KCl, 0.24 g KH ₂ PO ₄ , 3.628 g Na ₂ HPO ₄ · 12H ₂ O, double distilled water to 1 L;

2, saturated sodium chloride solution (5M NaCl, 1L): 292.5g NaCl, double distilled water dissolved to a volume of 1L;

3, 1M Tris-HCl buffer (pH 8.0): 30.3g Tris base dissolved in 200ml double distilled water, hydrochloric acid to adjust pH Value to 8.0, constant volume to 250ml;

4, 0.5M EDTA (pH 8.0): 36.5g EDTA dissolved in NaOH solution, adjust the pH to 8.0, to a volume of 250ml;

5, nuclear lysis buffer (Nuclei Lysis Buffer, 500ml): 40ml 5M NaCl, 2ml 0.5M EDTA (pH 8.0), 5ml 1M Tris-HCl (pH 8.0), 453ml double distilled water;

6, Proteinase K buffer (Proteinase K buffer, 100ml): 50ml glycerol, 100ul 1M Tris-HCl (pH 7.5), 200μl 1M CaCl ₂ , 47ml double distilled water;

7, Proteinase K (Proteinase K Solution, 10mg / ml): 100mg proteinase K powder dissolved in 10ml proteinase K buffer;

8. Digestive solution (Nuclei-SDS-Proteinase K-Master Mix Lysis buffer, 504 ml): 420 ml Nuclei Lysis Buffer, 3.5 ml Proteinase K (10 mg/ml), 17.5 ml 10% SDS, 0.35 ml 0.5 M EDTA (pH 8.0) , 62.65ml double distilled water;

9, TE buffer (pH 8.0): 1ml 1M Tris-HCl buffer (pH 8.0), 0.2ml 0.5M EDTA (pH 8.0), double distilled water to 100ml;

10, 6 × DNA spotting buffer (10ml): 88mg EDTA, 5mg bromophenol blue, 5mg xylene blue, dissolved in 4ml double distilled water, then add 3.6ml glycerol, then adjust to pH7.0 with NaOH, dilute to 10ml;

11, 50 × TAE buffer: 242g Tris-base, 57.1ml glacial acetic acid, 200ml 0.5M EDTA (pH 8.0), double distilled water to 1L.

Example 1 genome-wide association analysis

The present invention finds the association of the IL21R gene locus with primary biliary cholangitis by the following methods and procedures.

First, the method

Firstly, 1122 Chinese Han nationality PBC patients and 4036 normal human samples were selected from the Chinese Han population. HumanOmniZhongHua-8 (v1.1) scan was performed to carry out genetic polymorphism (SNP) typing, using PLINK. A comparative analysis of all polymorphic loci by the software revealed that the frequency of multiple SNPs of the IL21R gene was significantly different between the PBC and the normal population.

Second, the case and control sample inclusion criteria

All PBC patients included in the study met the following criteria: 1) All patients were Han; 2) AMA-M2 serologically positive; 3) Biochemical indicators showed evidence of cholestasis, mainly ALP, elevated GGT ; 5), all kinds of hepatitis virus infection and human immunodeficiency virus infection index negative (hepatitis B virus surface antigen negative, serum Hepatitis B virus DNA is less than 200 copies/ml, serum hepatitis C virus RNA is less than 500 copies/ml, hepatitis E antigen is negative, human immunodeficiency virus antibody is negative; 6), no history of schistosomiasis infection; 7) patient complains about alcohol consumption Less than 100ml / day.

The whole genome scan of the control population samples from the normal physical examination population in Anhui, Jiangsu, Shandong, biochemical indicators were normal, no clinical disease characterization, self-reported health. The cases were screened between 22 and 85 years old, with an average age of 54.7 years; the controls were screened between 15 and 96 years, with an average age of 34.8 years.

Third, the basic characteristics of the test population

The basic characteristics of the test population for the chip test sample are as follows:

Table 1

4. Preparation of genomic DNA samples from patients with primary biliary cholangitis (PBC) and normal controls

1. Non-anticoagulant therapy of patients and normal subjects was collected by non-anticoagulative collection tubes from various hospitals. The collection tube was centrifuged to separate serum and blood clots. The serum of the upper layer of the thawed blood sample was gently mixed with a pipette in a clean bench, and each was placed in four 1.5 ml screw cap storage tubes and stored at -80 °C.

2. Use a ladle to remove the separation gel, pour the blood clot into the weighing boat, use the scissors to fully cut the blood clot, and transfer the broken clot to a 50 ml centrifuge tube with a plastic pipette.

3. Rinse the weighing boat and blood collection tube with PBS buffer, recover the cleaning solution to a 50 ml centrifuge tube, mix the liquid with a plastic pipette, centrifuge, 2500 rpm, 15 min, 4 ° C, discard the supernatant.

4, add 5ml of digestive juice, mix, put into a water bath thermostat, 50 ° C, 200rpm, overnight digestion.

5. After digestion, add 1.5 ml of 5 M NaCl and mix; stand at room temperature for 10 min, mix it by inversion several times, centrifuge, 3800 rpm, 30 min, room temperature.

6. Transfer the supernatant to a 50 ml centrifuge tube, add 2 volumes of absolute ethanol, and mix well.

7. Pipette the visible flocculent DNA pellet to a 2 ml EP tube containing 500 μl of 70% ethanol for washing.

8. Centrifuge, 13000 rpm, 5 min, room temperature, discard the supernatant; centrifuge again, 13000 rpm, 1 min, room temperature, discard the residue with a pipette, dry, and dissolve with double distilled water.

Five, HumanOmniZhongHua-8 (v1.1) chip scanning typing and genome-wide association data analysis

The HumanOmniZhongHua-8 (v1.1) chip was purchased from ILLUMINA, and the classification was carried out in accordance with the requirements of the product method. The exact steps are based on the experimental steps of the Illumina HumanOmniZhongHua-8 (v1.1) chip. The relevant description can be found in the published literature [Adler, AJ, Wiley, GB, Gaffney, PM Infinium Assay for Large-scale SNP Genotyping Applications .J.Vis.Exp. (81), e50683, doi: 10.3791/50683 (2013).]. Each DNA sample was treated at 200 nanograms (ng) in strict accordance with the experimental procedure described in the Illumina HumanOmniZhongHua-8 (v1.1) chip.

The HumanOmniZhongHua-8 (v1.1) chip typing data was processed and output by the BeamadStudio software of ILLUMINA, and the associated data analysis was performed according to the published literature [Zuo, X. et al. Whole-exome SNP array identification 15new susceptibility loci for psoriasis .Nat Commun 6,6793,2015]. The classification data output by BeadStudio is analyzed by PLINK, and the duplicate and affinity samples are excluded according to the pairwise identity-by-state. Using smartpca software, the heterogeneous samples were excluded according to the principle component analysis. The results of 1,122 PBC patients and 4,036 normal controls were used for statistical analysis. Exclude SNPs with a success rate of less than 98%, exclude SNPs with a minimum allele frequency (MAF) of less than 0.01 in the analysis sample, and exclude Hardy–Weinberg equilibrium values of P<1×10 ^-4 in normal control samples. SNP. After exclusion, a total of 776,516 autosomal SNPs were used for comparison. Using PLINK software, SNP correlation analysis uses the principle of linear regression, using gender as the covariate, using the additive allelic effect, assessing the significance of each SNP locus associated with PBC, and calculating the dangerous alleles. The relative risk of the gene (Odds ratio, OR) and the 95% confidence interval, the OR value, confidence interval and P value were obtained directly in the analysis, thereby obtaining the dangerous allele of the site. The significance level (P value) associated with each PBC in the SNP chip was calculated by genome-wide association (GWAS) analysis, and the chromosomal region with potential association with PBC was found according to the significance level (P value less than 0.0001). And obtain a single nucleotide polymorphism site and its allele that are significantly associated with PBC susceptibility. The SNP calculation (Imputation) is based on the results of the Han people in the thousand human genome project (Reference), using IMPUTE2 software, combined with the results of 1,122PBC patients and 4,036 normal controls.

The results of the analysis are shown in Table 2 and Figure 1. The results show that in the IL21R gene region, there are five single nucleotide polymorphism sites (rs1859308, rs201883233, rs10852316, rs2189521, rs58579343). The disease-related haploid frequency is significant in PBC. Above the control population, the p value was 9.88 × 10 ^{-7 -} 5.40 × 10 ^-9 . There were 15 SNPs and rs1859308, rs201883233, rs10852316, rs2189521, rs58579343 linkage disequilibrium (r2=0.9-1) to calculate the corresponding p value, which was significantly higher in PBC than the control population (p=9.63×10 ^-7 -6.41) ×10 ^-8 ). Linkage disequilibrium (LD) between single nucleotide polymorphisms in a chromosomal region refers to a non-random combination between different single nucleotide polymorphism sites, represented by r2 (0 -1). The series of single nucleotide polymorphisms and their alleles are: rs6498017, allele is G/A; rs757374, allele is G/A; rs722516, allele is A/G; rs722517 The allele is C/T; rs1107788, the allele is T/C; rs11074854, the allele is C/G; rs1859309, the allele is T/C; rs1859308, the allele is C/T; rs1859307 The allele is A/G; rs201883233, the allele is A/C; rs1859306, the allele is G/A; rs11074855, the allele is T/C; rs10852316, the allele is G/T; rs7199163 The allele is G/T; rs982204, the allele is A/G; rs72535012, the allele is CTT/C; rs1116973, the allele is T/A; rs2382582, the allele is A/C; rs2189521 The allele is A/G; rs58579343, and the allele is T/C. The risk alleles were: rs6498017 polymorphism site G; rs757374 polymorphism site G; rs722516 polymorphism site A; rs722517 polymorphism site C; rs1107788 polymorphism site T; rs11074854 polymorphism site is C; rs1859309 polymorphism site is T; rs1859308 polymorphism site is C; rs1859307 polymorphism site is A; rs201883233 polymorphism site is A; rs1859306 The morphological locus is G; the rs11074855 polymorphism is T; the rs10852316 polymorphism is G; the rs7199163 polymorphism is G; the rs982204 polymorphism is A; the rs72535012 polymorphism is CTT; rs1116973 polymorphism site is T; rs2382582 polymorphism site is A; rs2189521 polymorphism site is A; rs58579343 polymorphism site is T. (See Table 2). Individuals carrying these dangerous alleles had a relative risk of developing PBC of 1.32-1.41 times that of carriers.

IL21R gene region single nucleotide polymorphism site sequence:

As shown in SEQ ID NO. 1 in the sequence listing:

Rs6498017

As shown in SEQ ID NO. 2 in the sequence listing

Rs757374

As shown in SEQ ID NO. 3 in the sequence listing

Rs722516

As shown in SEQ ID NO. 4 in the sequence listing

Rs722517

As shown in SEQ ID NO. 5 in the sequence listing

Rs1107788

As shown in SEQ ID NO. 6 in the sequence listing

Rs11074854

As shown in SEQ ID NO. 7 in the sequence listing

Rs1859309

As shown in SEQ ID NO. 8 in the sequence listing

Rs1859308

As shown in SEQ ID NO. 9 in the sequence listing

Rs1859307

As shown in SEQ ID NO. 10 in the sequence listing

Rs 201883233

As shown in SEQ ID NO. 11 in the sequence listing

Rs1859306

As shown in SEQ ID NO. 12 in the sequence listing

Rs11074855

As shown in SEQ ID NO. 13 in the sequence listing.

Rs10852316

As shown in SEQ ID NO. 14 in the sequence listing

Rs7199163

As shown in SEQ ID NO. 15 in the sequence listing

Rs982204

As shown in SEQ ID NO. 16 in the sequence listing;

Rs72535012

As shown in SEQ ID NO. 17 in the sequence listing;

Rs1116973

As shown in SEQ ID NO. 18 in the sequence listing

Rs2382582

As shown in SEQ ID NO. 19 in the sequence listing.

Rs2189521

As shown in SEQ ID NO. 20 in the sequence listing

Rs58579343

Table 2 IL21R gene region single nucleotide polymorphism locus significantly associated with primary biliary cholangitis

Wherein "OR (95% CI)" indicates the relative risk of developing PBC in individuals carrying disease-related haploids compared to individuals carrying normal haploids. The chromosomal location is referred to Human Genome GRCh37/hg19.

Example 2 rs10852316, rs2189521 verification experiment

A significant difference was also found by verification of rs10852316, rs2189521 in 907 PBC patients and 2027 normal controls. The PBC patient verification sample was the same as the standard in Example 1; the normal control sample was analyzed from the Southeast University teacher's physical examination, the biochemical indicators were normal, the B-ultrasound was free of liver and spleen abnormalities, no clinical disease was characterized, and the self-reported health was reported. The materials and time in the validation experiment were provided by Sequenom unless otherwise stated.

1. Verify the sequence of single nucleotide polymorphisms in the IL21R gene region

Rs10852316 sequence

Rs2189521

2, primer design

PCR amplification primers and single base extension primers for the SNP site to be tested were designed using Sequenom Genothyping Tools and MassARRAY Assay Design software and synthesized by Integrated DNA Technologies.

Design using DNA primers and probes as follows:

Rs10852316:

Primer 1 sequence, ACGTTGGATGGGTTATTTTTCCCAGATTCC;

Primer 2 sequence, ACGTTGGATGCTGGGTGGTGGGAATTTTTA;

Probe sequence, aggggTCCCAGATTCCAGAAGTAAGA

Rs2189521:

Primer 1 sequence, ACGTTGGATGTGTCAGCCACACTCAGGGA;

Primer 2 sequence, ACGTTGGATGAGACCCACTGGCGTCTCTCT;

Probe sequence, tctttCCAGACGCCGAGCTTAC

3. PCR amplification

PCR amplification was performed using a multiplex PCR technique in a 384-well plate with a total volume of 5 μl per reaction system. A PCR master mix solution was prepared in a new 1.5 ml EP tube.

Prepare the PCR master mix:

PCR Mix for each reaction, μL

10×PCR Buffer 0.5μL

MgCl ₂ (25mM) 0.4μL

dNTP mix (25mM) 0.1μL

HotStar Taq (5U/μL) 0.1μL

Water 1.9μL

PCR primer mix (

primer

1 and 2 0.5pmol each) 1μL

Total Volume4μL

Using a 24-channel pipettor, adjust the loading volume to 4 μL and add PCR master mix to each well of the 384-well plate. The 384-well plate is a PCR reaction plate. Take out the prepared DNA sample 384-well plate, adjust the sample volume to 1 μL using a 24-channel sampler, and each template solution contains 20-50 ng of template DNA, Hotstar Taq 0.5U, 0.5 pmol of each amplification primer. , 0.1 μl of 25 mM dNTPs. The PCR reaction conditions were set on a 384-well compatible PCR machine: 94 ° C for 4 minutes; 94 ° C for 20 seconds, 56 ° C for 30 seconds, 72 ° C for 1 minute, 45 cycles; 72 ° C for 3 minutes; 4 ° C retention. A 384-well PCR reaction plate was placed on a PCR machine to initiate a PCR reaction.

4. PCR product alkaline phosphatase treatment

After the end of the PCR reaction, the PCR product was treated with SAP (shrimp alkaline phosphatase) to remove free dNTPs from the system.

(1) Prepare an alkaline phosphatase treatment reaction solution, SAP Mix.

SAP Mix for each reaction, μL

H ₂ O1.53

SAP Buffer(10x)0.17

SAP Enzyme (1.7U/μL) 0.3

Total Volume 2

(2) Using a 24-channel pipettor, adjust the loading volume to 2 μL, and add SAP Mix to a 384-well PCR reaction plate. For each alkaline phosphatase treatment well, the total volume of the reaction system was 7 μl, of which 5 μl of PCR product and 2 μl of SAP Mix.

(3) Place the 384-well plate on a 384-well plate-compatible PCR instrument, and set the PCR reaction conditions: 37 ° C for 40 minutes; 85 ° C for 5 minutes; 4 ° C to maintain, start the PCR instrument for alkaline phosphatase treatment.

5, single base extension

(1) After the alkaline phosphatase treatment was completed, a single base extension reaction was carried out, and the total volume of the reaction system was 9 μl.

(2) Prepare a single base extension reaction solution, EXTEND Mix.

(3) Using a 24-channel pipettor, adjust the loading volume to 2 μL, and add the EXTEND Mix to the 384-well reaction plate. For each well, the single base extension reaction system contained 7 μl of the SAP-treated PCR product and 2 μl of the EXTEND Mix solution (wherein each of the extension reaction primer mixtures was 0.94 μl, the iPLEX enzyme was 0.041 μl, and the extension mixture was 0.2 μl).

(4) Place the 384-well plate on a 384-well plate compatible PCR instrument and set the PCR reaction conditions:

I.94°C for 30seconds;

II.94 ° C for 5 seconds;

III.52 ° C for 5 seconds;

IV.80°C for 5seconds;

V.GOTO III, 4more times;

VI.GOTO II, 39more times;

VII.72 ° C for 3minutes;

VIII.4°C forever;

The PCR machine was started to perform a single base extension reaction.

6, resin purification

(1) Spreading the Clean Resin resin into a 6 mg resin plate;

(2) adding 16 μl of water to the corresponding well of the extension product;

(3) Pour the dried resin into the extension product plate, seal the film, and rotate it at a low speed for 30 minutes to make the resin sufficiently contact with the reactant;

(4) Centrifuging to sink the resin into the bottom of the well.

7, chip spotting

The MassARRAY Nanodispenser RS1000 spotter was started and the resin extended extension was transferred to a 384 well SpectroCHIP chip.

8, mass spectrometry

The spotted SpectroCHIP chip was analyzed using MALDI-TOF (matrix-assisted laser desorption/ionization–time of fligh), and the results were classified using TYPER 4.0 software (sequenom) and the results were output. . A total of 907 PBC samples and 2127 control samples gave valid results.

Using PLINK software and logistic regression principle, the results of 907 PBC samples and 2127 control samples were statistically analyzed by gender as the common variable. The disease-related haploid (G) frequency of rs10852316 was significantly higher in the PBC (0.626) than in the control population (0.556), with a p-value of 5.59 × 10 ^-7 . The disease-related haploid (A) frequency of rs2189521 was significantly higher in the PBC (0.754) than in the control population (0.680), and the p value was 9.87 × 10 ^-9 . The GWAS results of 1,122 PBC patients and 4,036 normal controls were superimposed with the results of 907 PBC samples and 2127 control samples. The principle of fixed-effect model (I2<25%) was used. The statistical analysis included 2029 PBCs. Sample and 6163 control samples. The results showed that the disease-related haploid (G) frequency of rs10852316 was significantly higher in PBC than in the control group, with a p-value of 2.76×10 ^-13 and a relative risk value (96% CI) of 1.32 (1.22-1.41); rs2189521 The disease-related haploid (A) frequency was significantly higher in the PBC than in the control population, with a p-value of 4.00 × 10 ^-16 and a relative risk value (96% CI) of 1.41 (1.28-1.52) (see Table 3).

Table 3: Results of IL21R polymorphism locus rs10852316, rs2189521 in genome-wide association analysis and validation findings

Example 3 Analysis of IL21R expression in liver tissue of patients with primary biliary cholangitis

All liver tissues, including 30 patients with PBC, 30 patients with autoimmune hepatitis (AIH), and 25 patients with chronic hepatitis B (CHB) were ultrasound-guided liver biopsy at Shanghai Renji Hospital. The liver tissue of 6 healthy controls (HC) was from a liver transplant donor. Liver tissues were preserved in formalin and embedded in paraffin. The degree of inflammation and fibrosis of liver tissue was assessed according to the "Scheuer" scoring system.

1. Liver tissue sections were soaked in sodium citrate buffer for 20 minutes;

2. Add 1:150 diluted anti-IL21R antibody (ab13268, Abcam, Cambridge, USA) and keep at room temperature for 20 minutes;

3. Wash the slide with sodium phosphate buffer;

4. Add a 1:2000 dilution of horseradish peroxidase-labeled goat anti-rabbit antibody (automated immunohistochemistry secondary antibody combination, 47101, Leica), using Leica automatic immunohistochemistry machine for immunohistochemical staining;

5. Analysis of the stained slides, 5 submicroscopic areas were selected under a 40*10 magnified microscope, and the number of stained positive cells was recorded. The final result was expressed by the mean plus standard deviation. The Mann–Whitney U analysis principle (Mann–Whitney U-test) was used for statistical analysis of the data, and a P value of less than 0.05 was considered statistically significant. All analyses were performed using the Prism software system (Prism software Version 6.0, Graphpad Software, La Jolla, CA, USA).

The results showed that IL21R was significantly increased in liver tissue of patients with PBC compared with hepatitis B, autoimmune hepatitis and normal liver tissue. In patients with PBC, cells expressed by IL21R are usually clustered in the inflammatory portal area of the liver, especially around the lobular bile duct. The experimental results show that the number of IL21R positive cells is proportional to the degree of inflammation in the liver and the degree of fibrosis in the liver. Statistical analysis showed that the number of IL21R positive cells was positively correlated with the degree of inflammation in the liver (r=0.43, p<0.05); it was positively correlated with the degree of fibrosis in the liver (r=0.60, p<0.01). The relevant results are shown in Fig. 2.

The above is only a preferred embodiment of the present invention, and other variations or modifications of the various forms may be made by those skilled in the art without departing from the principles of the invention. range.

Claims

The use of IL21R in the preparation of products for detecting or assisting detection, screening or predicting primary biliary cholangitis.
The reagent of the IL21R gene polymorphism site rs1859308 is used for preparing a product for detecting or assisting detection, screening or predicting primary biliary cholangitis, and the rs1859308 sequence is shown as SEQ ID NO. 8 in the sequence listing, wherein Carriers with a single nucleotide n of C have a higher risk of primary biliary cholangitis than allele T.
The reagent of the IL21R gene polymorphism site rs201883233 is used for preparing a product for detecting or assisting detection, screening or predicting primary biliary cholangitis, and the sequence of rs201883233 is shown as SEQ ID NO. 10 in the sequence listing, wherein Carriers with a single nucleotide n of A are at a higher risk of primary biliary cholangitis than allele C.
The reagent of the IL21R gene polymorphism site rs10852316 is used for preparing a product for detecting or assisting detection, screening or predicting primary biliary cholangitis, and the rs10852316 sequence is shown as SEQ ID NO. 13 in the sequence listing, wherein Carriers with a single nucleotide n of C have a higher risk of primary biliary cholangitis than allele A.
The reagent of the IL21R gene polymorphism site rs2189521 is used for preparing a product for detecting or assisting detection, screening or predicting primary biliary cholangitis, and the rs2189521 sequence is shown as SEQ ID NO. 19 in the sequence listing, wherein Carriers with a single nucleotide n of A are at a higher risk of primary biliary cholangitis than allele G.
The application of the reagent of the IL21R gene polymorphism site rs58579343 in the preparation of a product for detecting or assisting detection, screening or predicting primary biliary cholangitis, the sequence of rs58579343 is shown as SEQ ID NO. 20 in the sequence listing, wherein Carriers with a single nucleotide n of A are at a higher risk of primary biliary cholangitis than allele G.
The use of IL21R in the preparation of animal models of PBC.
The application of IL21R in the preparation of PBC therapeutic drugs.