CN104204230A - Methods related to treatment of inflammatory diseases and disorders - Google Patents

Abstract

The present invention relates to gene markers associated with a method for predicting the clinical response in a patient suffering from an inflammatory diseases or disorders to an anti-inflammatory treatment.

Description

The methods involving for the treatment of inflammatory diseases and illness

Technical background

The present invention relates to the method in diagnosis, prognosis and the treatment optimization field of inflammatory diseases and illness, object is by providing prediction to improve treatment option and the treatment plan to patient to reactive method of curative.

Background

For a large amount of patients, inflammatory diseases and illness and especially autoimmune disease have a strong impact on patient health and treatment option is unsatisfactory.

Rheumatoid arthritis (RA) is important clinically, and chronic systemic autoimmunization RA is the autoimmune disease of unknown etiology.Most of RA patients have chronic disease process, even use current available treatment, still can cause progressive destruction of joint, distortion, anergy and dead even too early.The diagnosis of RA depends on the clinical and laboratory evaluation to patient sign and symptom conventionally.Conventionally, the laboratory evaluation of the patient to the doubtful RA of suffering from can comprise some antibody that is considered to Rheumatoid factors, polyclonal (RF) of measuring in serum and the level of ring-type citrulline peptide antibody (anti-CCP).Although these antibody conventionally exist in RA patients serum, are not that all RA patients have.Also can use the extra blood test that is called as erythrocyte sedimentation rate (ESR).The ESR raising shows inflammatory process ubiquity, although RA not necessarily.Further blood test can be used for evaluating the level of other factors, and the described factor is the known C reactive protein relevant to RA (CRP) for example.In addition, can carry out radiograph analysis to the joint of getting involved.In a word, the laboratory inspection of so current available diagnosis RA is out of true and incomplete.

Americanism diseases caused by dampness association (The American College of Rheumatology, ACR) standard common is in diagnosis and judge severity (http://www.rheumatology.org).

Carry out attempting to improve diagnosis and prognosis (referring to the people such as such as Rioja, Arthritis and Rheum. 58 (8): 2257-2267 (2008) according to biomarker; The people such as Pyrpasopoulou, Mol. Diagn. Ther. 14 (l): 43-48 (2010); WO 2004/0009479; WO 2007/0105133; WO 2007/038501; WO 2007/135568; WO 2008/104608; WO 2008/056198; WO 2008/132176; With WO 2008/154423).At present, provide the method that RA patient is divided into subgroup and qualification patient group, its more hyperergy (WO2011028945) based on the bright antagonism of specific molecular stave CD20 treatment.But, do not identify the pathologic, physiologic aspect that can allow clinician or other people accurately define rheumatoid arthritis, clinical activity, reaction, prognosis to treatment or develop the diagnosis through clinical confirmation or the prognostic markers of the risk of described disease.

Therefore,, along with RA patient seeks treatment, there are important test and error to relate to the exploration to the effective curative of particular patient.In order to find the most effectively treatment, such test and error generally include sizable risk and make patient's discomfort.Therefore, need more effective means will which treatment to be responded and for such judgement being joined to the more effective treatment plan to RA patient for determining which patient.

Therefore highly advantageously there is extra method, for identify objectively the existence of disease patient, limit the pathologic, physiologic aspect, clinical activity of rheumatoid arthritis, reaction to treatment, comprise reaction, the prognosis to the treatment with different RA curatives and/or develop the risk of rheumatoid arthritis.

Therefore, all need new molecular diagnosis or the prognostic markers that qualification is relevant to rheumatoid arthritis and other autoimmune disease always.

General introduction

As described herein, the inventor is provided for improving the several different methods of the treatment of inflammatory diseases or illness, autoimmune disease and especially RA.

One aspect of the present invention relates to the method for the reaction of prediction patient to antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described patient, wherein the expression of the one or more described genes compared with the reference level of described gene changes, and predicts the reaction of described patient to described antiphlogiston.

The present invention relates to the method for the reaction of prediction patient to antiphlogiston on the other hand, comprising:

A) in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1, and

B) by the reference level comparison of described level and described gene,

Wherein the expression of the one or more described genes compared with described reference level changes, and predicts the reaction of described patient to described antiphlogiston.

The present invention has further described the method reaction of antiphlogiston to the experimenter of the possibility of increase of identifying, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression of the one or more described genes compared with the reference level of described gene changes, and shows to have identified the experimenter reaction of antiphlogiston to the possibility of increase.

The present invention relates on the one hand qualification has the patient of the possibility of increase method to the reaction of antiphlogiston, comprising:

A. in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1

B. by the reference level comparison of described level and described gene,

Wherein the expression of the one or more described genes compared with the reference level of described gene changes, and shows to have identified the patient reaction of antiphlogiston to the possibility of increase.

Method of the present invention can relate to such situation: wherein expressing change is the expression increase of the gene of Figure 1A compared with reference level; And/or wherein expression change is the expression minimizing of the gene of Figure 1B compared with reference level.

Described method has further described and can use qRT-PCR or use micro-array chip, based on mRNA, detects described expression level in blood sample.In specific embodiment of the present invention, to measure the expression level of Complement Factor D (CFD) and found that described level is higher than reference level, described reference level can have different definition according to the method for detection of described transcript.

One aspect of the present invention relates to the antiphlogiston that is used for the treatment of autoimmune disease or illness, and wherein, compared with the reference level of one or more genes of Fig. 1, the expression that patient has one or more genes of Fig. 1 changes.

Further aspect of the present invention relates to treating suffers from inflammatory diseases or the reformed experimenter's of expression level of one or more genes of Fig. 1 method compared with reference level wherein, comprises and gives described experimenter by the antiphlogiston of therapeutic dose.

Described method can comprise further step, comprising: consider that the expression level of one or more genes of Fig. 1 is changed in described patient compared with reference level.

One aspect of the present invention relates to the method for the treatment of inflammatory diseases or illness in patient, comprising:

A. in the biological sample from described patient, measure the expression level of one or more genes of Fig. 1

B. by the reference level comparison of described level and described gene,

C. measure compared with described reference level, whether the expression level of one or more genes of Fig. 1 is changed

D. give described patient by the antiphlogiston of therapeutic dose.

In some cases, the information that can use genetic expression is to determine patient and whether in fact give antiphlogiston and therefore aforesaid method can comprise the evaluation to expression data, for example conclusion is, compared with described reference level, in described biological sample, the expression level of one or more genes of Fig. 1 is changed.Consider with due regard to compared with reference level, whether the expression level of one or more genes of table 1A increases and/or compared with reference level, whether the expression level of one or more genes of table 1B reduces.

On the other hand, the present invention relates to goods, comprise pharmaceutical composition packaging together and label, described pharmaceutical composition comprises antiphlogiston and pharmaceutically acceptable carrier, and described label illustrates that described pharmaceutical composition can be used for the patient that treatment suffers from autoimmune disease or illness and has the expression change of one or more genes of Fig. 1.

One aspect of the present invention relates to test kit, comprising:

A) comprise one or more compositions of at least one detection reagent, described detection reagent is for measuring the expression level of one or more genes of table 1A and/or table 1B, and

B) how that expression level is associated with experimenter's reaction possibility the working instructions of described test kit, comprise.

Based on available data, can advise the treatment improving and can make impact and the error minimize tested to patient.Technician it is evident that, except specific embodiment herein, can also carry out some change to the present invention.

Sequence table

The application comprises sequence table, comprises following sequence:

SEQ ID NO 1:CFD mRNA probe: CCTGCTGCTACAGCTGTCGGAGAAG

SEQ ID NO 2:18S rRNA contrasts probe: TGGAGGGCAAGTCTGGTGCCAGCAG

SEQ ID NO 3: rs1683565:

AGAGCCCAAAGCTCATGGAAAAGAG XATATAAAGGAGTCCCTGCAGTAGA

Wherein the X of position 26 is A or G

SEQ ID NO 4: rs1683591:

TCTGTCCACAGGCGGGGGTGGAGGG XATGGCCGGCCTCACACCATCTGCCA

Wherein the X of position 26 is A or G

SEQ ID NO 5: rs1683590:

AATATCTGAAATTTTCCCAGTTTAC XAGCCTCTGACGTAACCGTCCTCTCT

Wherein the X of position 26 is A or G

SEQ ID NO 6:ACTB probe:

CCTTTGCCGATCCGCCGCCCGTCCA

Accompanying drawing summary

fig. 1be presented in anti-IL20 RA test, with disease activity Ping Fen – C reactive protein (DAS28-CRP) variation (at the 8th week) the positively related transcript list (table 1a) in 28 joints and the transcript list (table 1b) of negative correlation.The transcript that shows obvious dependency (False discovery rate (FDR)=5%) in patient's (not comprising placebo) of administration is included in (top that rank order is every table has the most significant dependency) in list.The gene of listing in table 1A has been accredited as to using and be correlated with in the method for the invention, and wherein relatively high expression level has impact.

The gene of listing in table 1B has been accredited as to using and be correlated with in the method for the invention, and wherein relatively low expression level has impact.

fig. 2indicator gauge 2 comprises Select gene from table 1A and 1B, and described gene is considered to using and be correlated with in the method for method of the present invention and especially using multivariate analysis.For for multivariable DAS28-CRP prediction, selected transcript/gene is correlated with.

fig. 3be presented in anti-IL20 test the distribution of the transcriptional level of CFD (Complement Factor D) transcript in the PaxGene whole blood sample from RA-patient.Average (Robust Multichip Average, the RMA) standardized value of strong multi-chip is shown in (log2 scale (scale)) in Y-axis.Present with single patient by arbitrary number as 1-82 taking alternative colors (black or white) from the sample of single patient.

fig. 4be presented at recipient's operating characteristics (ROC) curve and Americanism diseases caused by dampness association 50% comprehensive standard (ACR50) reaction of the CFD mRNA in the anti-IL20 test of 2a phase.X on ROC curve shows threshold value 10.32 (the standardized expression values of RMA).

fig. 5be presented at ROC curve and 70 % comprehensive standard (ACR70) reactions of Americanism diseases caused by dampness association of the CFD mRNA in the anti-IL20 test of 2a phase.

fig. 6be presented at before administration in (the 1st day) sample, the quantitative RT-PCR (qRT-PCR) of CFD mRNA detects and the data based on microarray detection associated that carrys out comfortable more time point.By the microarray signal in linear scale (the RMA data (Y-axis) of reversionization) and the standardized CFD level of the 18S comparison of analyzing from qRT-PCR.

fig. 7the 2a phase that is presented at the anti-IL20 of two alternative threshold values (alternative treshold) with the stratification based on CFD is tested ACR20, ACR50 and the ACR70 reactivity in (clinical trial government identification NCT01282255).For example, if use patient's stratification (the threshold value >10.32 (the standardized expression values of RMA) using) of the CFD mRNA level of the ROC curve based on from Fig. 4, obtain the patient colony (bottom of graph A) of high reaction.If only comprise the individuality of CFD level lower than threshold value, reaction is shown on the top of graph A.In the time using the alternative threshold value (measuring based on the absolute quantitation of CFD and β Actin muscle (ACTB)) of CFD, the patient's that obtains responding similar enrichment (lower part of chart B).

fig. 8be presented at the Bb level in RA patient's synovia, be presented at CFD expression level high or low in PaxGene sample, as evaluated by qPCR.

Describe

The present invention relates to the method for the result for the treatment of of predicting anti-inflammatory compound.Just as described in the background section, current available treatment has low success rate at least to a certain extent, and treatment generally includes test and error to a certain degree.The method that the invention provides qualification patient subgroup, it has high treatment success ratio, thereby makes a large amount of patients can avoid the uncomfortable risk relevant to the difficulty of finding effective treatment.

Definition

In order to explain the application's object, less other explanation is so that in order to give a definition in this article.

As being used interchangeably herein, term " polynucleotide " or " nucleic acid " refer to the nucleotide polymer of any length, and comprise DNA and RNA.Nucleotide can be Nucleotide or base and/or its analogue of deoxyribonucleotide, ribonucleotide, modification or can mix any substrate in polymkeric substance by DNA or RNA polymerase.Polynucleotide can comprise the Nucleotide of modification, for example methylated nucleotide and analogue thereof.If present, can before or after polymkeric substance assembling, give the modification of nucleotide structure so.The sequence of Nucleotide can be interrupted by non-nucleotide component.Polynucleotide can, for example, by puting together with marker components or other type known in the art is modified, after polymerization, further modify.

As used herein, " oligonucleotide " refers to short strand polynucleotide, and its length is at least about 7 Nucleotide and is less than approximately 250 Nucleotide.Oligonucleotide can synthesize.Term " oligonucleotide " and " polynucleotide " are not mutually to repel.Description above about polynucleotide is applicable to oligonucleotide comparably and fully.

Term " primer " refers to can be with nucleic acid hybridization and generally by providing free 3'-OH group to allow the strand polynucleotide of complementary nucleic acid polymerization.

Term " array " or " microarray " refer to can be in matrix the hybridized array element of ordered arrangement, preferred polynucleotide probe (for example oligonucleotide).Matrix can be for example glass slide of solid substrate or such as nitrocellulose filter of semisolid matrix.

Term " amplification " refers to the process of the one or more copies that produce reference nucleic acid sequence or its complement.Amplification can be linearity or index (for example PCR)." copy " not necessarily meaned with respect to sufficient sequence complementarity or the identity of template sequence.For example, copy can comprise the sequence errors that nucleotide analog for example Hypoxanthine deoxyriboside, deliberate sequence change (sequence of for example introducing by primer changes, and described primer comprises can hybridize with template but the sequence of complete complementary not) and/or occur in amplification procedure.

Term " multiplex PCR " refers to use and exceedes the single PCR reaction that a primer sets for example, carries out on the nucleic acid that derives from single sample (patient), for the object of increase in single reaction 2 or more DNA sequence dnas.

" severity " of hybridization can easily be determined by those of ordinary skill in the art, and be generally the empirical Calculation that depends on probe length, wash temperature and salt concn.Generally speaking, longer probe needs higher temperature for appropriate annealing, and the temperature that shorter probe need to be lower.In complementary strand is present in lower than the environment of its melting temperature(Tm) time, the ability that denatured DNA is annealed again is generally depended in hybridization.Probe and can hybridization sequences between required homology degree higher, operable relative temperature is higher.Thus, higher relative temperature will be tending towards making reaction conditions stricter, and lower temperature is tending towards making reaction conditions not stricter.About other details and the explanation of the severity of hybridization, referring to people such as Ausubel, Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

As defined herein, " stringent condition " or " high stringent condition " can define by following: (1) adopts low ionic strength and high temperature for washing, for example 0.015 M sodium-chlor/0.0015 M Trisodium Citrate/0.1% sodium lauryl sulphate, at 50 DEG C; (2) in crossover process, adopt denaturing agent, for example methane amide, for example, 50% (v/v) methane amide and 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer, at pH6.5 and 750mM sodium-chlor, 75mM Trisodium Citrate, at 42 DEG C; Or (3) are adopting 50% methane amide, 5 x SSC (0.75M NaCl at 42 DEG C, 0.075M Trisodium Citrate), the hybridization of spending the night in the solution of salmon sperm DNA (50 micrograms/ml), 0.1% SDS and 10% T 500 of 50mM sodium phosphate (pH6.8), 0.1% trisodium phosphate, 5 x Denhardt solution, supersound process, in 42 DEG C of washings in 10 minutes in 0.2 x SSC (sodium chloride/sodium citrate), the high strict washings in 10 minutes that formed by the 0.1 x SSC that contains EDTA at 55 DEG C subsequently.

" medium stringent condition " can be as people such as Sambrook, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, described in 1989, define, comprise and for example using, than above-mentioned more undemanding washing soln and hybridization conditions (temperature, ionic strength and %SDS).The example of medium stringent condition is the incubation that spends the night in comprising following solution at 37 DEG C: salmon sperm DNA is sheared in 20% methane amide, 5 x SSC (150mM NaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5 x Denhardt solution, 10% T 500 and 20mg/ml sex change, washs filter membrane subsequently at about 37-50 DEG C in 1 x SSC.Technician knows and regulates how as required temperature, ionic strength etc., to adapt to the factors such as such as probe length.

Term " detection " comprises any detection means, comprises directly and indirect detection.

Term " level of expression " or " expression level " are generally speaking used interchangeably, and refer to the amount of polynucleotide in biological sample or amino acid product or protein.The information that " expression " refers generally to genes encoding is converted into and in cell, exists and the process of the structure of running.Therefore, as used herein, " expression " of gene can refer to be transcribed into polynucleotide, translate into protein or the even posttranslational modification of protein.The fragment of the protein of the polynucleotide of transcribing, the protein of translation or posttranslational modification also should be considered as expressing, no matter they are to come from the transcript that generates by alternative splicing or the transcript of degraded, still come from the such as proteolysis of translation post-treatment of protein." gene of expression " comprise and be transcribed into as the polynucleotide of mRNA and translate into subsequently those of protein, and be transcribed into RNA but do not translate into protein those (for example transfer RNA (tRNA) and ribosome-RNA(rRNA)s).

Term " express spectra " can be used for defining the expression level of one group of gene, the more complicated image of the transcriptional activity in sampling.

As used herein, term " biomarker " refers to the indicator of patient's states, because such biomarker can be used for the morbid state (being included in the reaction of diagnosing and evaluate treatment in individuality) of evaluate patient.Biomarker is molecular entity, can in the biological sample from patient, detect it.Biomarker includes but not limited to DNA, RNA, protein, carbohydrate and other biochemical entities or part, comprises its combination, for example molecule marker based on glycolipid or glycoprotein." diagnostic flag " and " prognostic markers " is that " biomarker " describes in detail, and it shows the existence of molecular entity or do not exist or level can provide diagnosis and/or the information of prognosis, comprises for example reaction to one or more treatment types.Some biomarker may be suitable for diagnosis, and some is suitable for follow-up disease progression and therapeutic response, and other is suitable for the clinical response of prediction to treatment.

" amount " or " level " that increase relevant " prognostic markers " to patient's clinical benefit is can detection level in the biological sample from described patient.Can by well known by persons skilled in the art and also in this article disclosed method detect expression level.The expression level of the biomarker of evaluating or amount can be used for the reaction of judgement or predicted treatment.

Term " is expressed change " and refer to gene expression dose increase or that reduce conventionally detecting on mRNA or protein level.Think that expression level changes with respect to reference level, for example expression level " higher than " or " lower than " relevant predeterminated level.Gene expression dose change can represent its express " higher than " or " lower than " gene of other gene and/or other individual expression level.

Term " expression of increase " or " level of increase " refer to gene expression dose rising or that increase conventionally detecting on mRNA or protein level.Think that expression level increases with respect to reference level, for example expression level " higher than " relevant predeterminated level.The gene expression dose increasing can represent compared with other gene and/or other individual expression level, in individuality with the gene of " height " horizontal expression.

Term " expression of minimizing " or " level of minimizing " refer to gene expression dose reduction or that reduce conventionally detecting on mRNA or protein level.Think that expression level reduces with respect to reference level, for example expression level " lower than " relevant predeterminated level.The gene expression dose reducing can represent compared with other gene and/or other individual expression level, in individuality with the gene of " low " horizontal expression.

Term " Rheumatoid factors, polyclonal " or " RF " refer to, in patients serum, detect and for IgM, IgG or the IgA isotype antibody of independent or any combination of the antigenic determinant existing on humans and animals IgG.

Term " the RF positive " refers to for the mensuration of the RF result that for example ELISA measures, and wherein said result exceedes threshold value or the cutoff of the mensuration of the sample for being considered to contain RF that can detection level with reappearing.

Term " RF feminine gender " refers to for the mensuration of the RF result that for example ELISA measures, and wherein said result is equal to or less than threshold value or the cutoff of the mensuration of the sample for being considered to contain RF that can not detection level with reappearing.

As used herein, term " sample " or " biological sample " refer to derive from or be derived from the composition of target subject, and it comprises one or more molecular entities to be detected, that measure or identify.For example, phrase " patient's sample ", " experimenter's sample " and variant thereof refer to derive from any sample of target patient or experimenter, it is expected and contains or known cell and/or molecular entity containing needing to be characterized, includes but not limited to tissue sample, cell sample or blood sample.

Term " tissue sample " or " cell sample " or " blood sample " mean to comprise the sample of one or more cells that derive from experimenter.Tissue or the source of cell sample can be solid tissues as from organ or tissue's sample or biopsy or aspirate fresh, freezing and/or that preserve; Body fluid for example celiolymph, amniotic fluid, peritoneal fluid, interstitial fluid or blood or any blood constitutent.Tissue sample or cell sample can also be primary or cultured cells or clone.Optionally, tissue or cell sample derive from diseased tissue/organ (for example showing pathological characters).Tissue sample can contain occurring in nature not with organize the compound mixing natively, such as sanitas, antithrombotics, buffer reagent, fixing agent, nutrient substance, microbiotic etc.

Term " serum sample " refers to and derives from individual any serum sample.The method that obtains serum from Mammals is well-known in the art.

As used herein, " control sample ", " control cells " or " control tissue ", refer to and derive from known or be considered to not suffer from biological sample, the cell or tissue in stand-by method of the present invention or the disease of composition qualification or the source of illness.In one embodiment, control sample, control cells or control tissue derive from unaffected part on the surface of composition of the present invention to be used or method qualification disease or the same experimenter of illness or patient's health.In one embodiment, control sample, control cells or control tissue derive from the part of the health of following individuality, and described individuality is not experimenter or the patient of composition of the present invention to be used or method qualification disease or illness.

Term " diagnosis " is used in reference to qualification or the classification of molecule or pathologic state, disease or illness in this article.For example, " diagnosis " can refer to the inflammatory diseases of particular type or the qualification of illness or for example RA of specific autoimmune disease.

Term " prediction " or its variant are used in reference to patient medicine or medicine group will be had to the possibility of favourable or adverse effect.In one embodiment, prediction relates to the degree of described reaction.In one embodiment, prediction relates to such possibility: patient will improve successive treatment, for example, use the treatment of particular treatment medicine, and in regular hour Duan Zhongwu palindromia.Prediction procedure of the present invention can use clinically, by selecting to make treatment decision-making for the suitable treatment pattern of any particular patient.For example give given medicine or curative or its combination for judging that patient's possibility advantageously responds for example given treatment plan for the treatment of plan, comprising, Forecasting Methodology of the present invention is valuable instrument.

Term " instruction (indication) ", " (indicative) of instruction " or its variant are used in reference to the guidance of gained; Because " instruction " based on gene expression dose changes as described herein provides following information: experimenter or patient may respond to anti-inflammatory treatment.Based on such guidance, method of the present invention can be used clinically, by selecting to make treatment decision-making for the suitable treatment pattern of any particular patient.

As used herein, " treatment " refers to attempt change the clinical intervention of the individual natural process of receiving treatment, can be before clinical pathology process or during carry out.The result for the treatment of of expecting comprises the appearance or the recurrence that stop disease or its patient's condition or symptom, the patient's condition palliating a disease or symptom, any direct or indirect pathology consequence of minimizing disease, reduces progression of disease speed, improve or relax morbid state, and/or realizing the prognosis of alleviating or improving.In certain embodiments, method and composition of the present invention is useful in the trial that postpones disease or illness development.

" significant quantity " refers to required dosage and within the required time period, effectively reaches the treatment of expectation or the amount of prevention result." the treatment significant quantity " of curative can change according to following factor: for example morbid state, and individual age, sex and weight, and antibody causes required ability of replying in individuality.Treatment significant quantity still wherein the treatment favourable effect of curative surpass the amount of its any toxicity or deleterious effect." prevention significant quantity " refers to required dosage and within the required time period, effectively reaches the amount of the prevention result of expectation.Typically but not necessarily, because preventive dose uses before the commitment of disease or in the time of the commitment of disease in experimenter, so prevention significant quantity will be less than treatment significant quantity.

Term " individuality ", " experimenter " or " patient ", can exchange use as used herein, typically refers to vertebrates.In certain embodiments, described vertebrates is Mammals.Mammals includes but not limited to primate (comprising people and non-human primate) and rodent (for example Mouse and rat).In certain embodiments, described Mammals is people.Term " patient " further represents not health volunteer's experimenter.In one embodiment, " patient " is after diagnosing or suffers from the individuality of the S or S relevant to inflammatory diseases or illness.In one embodiment, " patient " suffers from autoimmune disease or illness, for example RA.

" contrast experimenter " refers to do not diagnosed and/or do not suffer from experimenter healthy on the surface of any S or S relevant to inflammatory diseases or illness.

" associated (correlate or correlating) " means by any way performance and/or the result of the performance of the first analysis or scheme and/or result and the second analysis or scheme to be contrasted.For example, the result of the first analysis or scheme can be used for carrying out alternative plan, and/or can use the result of the first analysis or scheme to determine whether carrying out the second analysis or scheme.With regard to the embodiment of gene expression analysis or scheme, can use the result of gene expression analysis or scheme to determine whether carrying out specific treatment plan.

Any terminal that term " patient's reaction " or " reaction " can be used instruction patient to be benefited is assessed, and includes but not limited to, a) inhibition to progression of disease; B) minimizing of seizure of disease number of times and/or symptom; C) dwindling of lesion size; D) disease cellular infiltration is arrived to contiguous peripheral organs and/or in-house inhibition; E) inhibition to pathophoresis; F) reduction of autoimmune response, this can but not necessarily cause disappearing or eliminating of disease injury; G) one or more symptoms relevant to described illness alleviation to a certain extent; H) after treatment, increase without the time of disease performance; And/or i) after treatment on preset time point mortality ratio reduce.For the object of patient's reaction, suppress to refer to and shelter, dwindle, postpone or stop completely relevant symptoms.

When relating to experimenter or patient when previously having given their reaction of one or more medicines, described experimenter or patient are described in statement " right ... reactionless ", after described medicine gives, do not demonstrate treatment sign any or enough for treated illness, or they have demonstrated for described medicine unacceptable height toxicity clinically, or they do not maintain the treatment sign of using for the first time after described medicine, the word wherein using in this background is treated as defined herein.Phrase " unresponsive " comprises describing to have resistivity and/or those intractable experimenters for one or more medicines that previously given, and comprise following situation: wherein experimenter or patient have been developed in the time accepting the medicine that he or she is just being given, wherein experimenter or patient completing after scheme in 12 months (for example, in 6 months) develop, wherein said scheme comprises the medicine that he or she no longer responds to it.Therefore be included in previous or current to continuing to have the experimenter of active disease after its treatment for the anergy of one or more medicines.For example, with patient to the about 1-3 of its unresponsive pharmacological agent month after, patient can have active disease activity.Such reactivity can be assessed by skilled clinician in the described illness for the treatment of.For the non-reacted object to medicine, in the previous or treatment at present that personal one or more medicines carry out, the experimenter of experience " unacceptable high-caliber toxicity clinically " experiences associated one or more adverse side effects or adverse events, it is important that described side effect or adverse events are considered as by experienced clinician, for example severe infections, congestive heart failure, demyelination (causing multiple sclerosis), significantly allergy, neuropathology event, height autoimmunization, cancer is carcinoma of endometrium such as, non-Hodgkin lymphoma, mammary cancer, prostate cancer, lung cancer, ovarian cancer or melanoma, pulmonary tuberculosis (TB) etc.

Term " inadequate reaction " or " insufficient reactor " are for describing the patient of the unsatisfied given result for the treatment of of experience.This can be characterized by low result for the treatment of and/or a large amount of side effect.Think that described standard is equivalent to anergy.Term " inadequate reaction " is expected or is intended to the treatment of the test based on previous for relating to wherein given reaction.If do not obtain " reaction fully " after for some time, treatment is interrupted conventionally, thinks that described patient is " insufficient reactor ".Also can be, described patient's continual cure, but with other therapeutic combination to improve therapeutic response.

Term " reaction fully " is for describing the result for the treatment of of patient in the time that the expection of therapeutic efficiency realizes.

" medicine " is the active medicine for the treatment of disease, illness and/or the patient's condition.In one embodiment, disease, illness and/or the patient's condition are RA or its symptom or side effect.

" antiphlogiston " is such compound, medicine or medicament: it can or be hopeful to reduce Inflammatory response or the symptom of inflammatory diseases or illness.

As used herein, " RA curative " or " effectively treating the curative of RA " and grammatical variants thereof refer to such medicament: in the time providing with significant quantity, its by known, confirm or in RA experimenter, provided treatment benefit by clinician expection clinically.

" antagonist " refers to can to neutralize, block, suppress, abolish, reduce or disturb specific or specifies the active molecule of protein, described activity to be included in the situation of part the combination of itself and one or more acceptor or the combination of itself and one or more part in the situation that of acceptor.Antagonist comprises antibody and Fab, protein, peptide, glycoprotein, glycopeptide, glycolipid, polysaccharide, oligosaccharides, nucleic acid, biological organic molecule, plan peptide, pharmacologically active agents and meta-bolites thereof, transcribes and translate control sequence etc.Thereby antagonist also comprises micromolecular inhibitor and the fusion rotein of protein, the antagonist variant of the acceptor molecule of the combination of isolating itself and its target and derivative, protein, fit and for the ribozyme of protein for antisense molecule, the RNA of protein of being combined with protein specific.

Detailed Description Of The Invention

The present inventor has been found that the inspection according to some gene expression profile, can identify and have the successfully patient of the high likelihood for the treatment of.The present invention be based on according to described in embodiment and obtain data.Patient of the present invention typically suffers from inflammatory diseases or illness and especially autoimmune disease or illness.Based on the data of gained, can in several different methods, use described information, because can select the reaction for the treatment of to have the patient of the possibility of increase.

One aspect of the present invention relates to the method for the reaction of prediction experimenter to antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression of the one or more described genes compared with the reference level of described gene changes, and predicts the reaction of described experimenter to described antiphlogiston.

Can carry out by different wording the situation of the genetic expression of one or more genes of interpretation and evaluation Fig. 1.This can be used for obtaining the information of expression level equally, evaluation level or expression or consideration expression level.All these methods needn't comprise acquisition blood sample, because this may previously occur, therefore described method describes in detail, for predict the object of possibility of clinical response or clinical response in given patient, use the information from the genetic expression of biological sample.This further shows that previously also the information of acquired gene expression dose can be for method of the present invention.

One aspect of the present invention relates to the method reaction of antiphlogiston to the experimenter of the possibility of increase of identifying, be included in the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression of the one or more described genes compared with the reference level of the described gene in described sample changes, and has identified the experimenter reaction of antiphlogiston to the possibility of increase.

As above alternative wording, for example can in-service evaluation expression level according to method of the present invention or consider expression level, in addition, also described above, described method not necessarily comprises and obtains blood sample and the step of evaluation expression level in described blood sample.

In other side of the present invention, described method is included in the expression level of one or more genes of measuring Fig. 1 in the biological sample from described patient and really by the step of the reference level comparison of described level and described gene.

Therefore one aspect of the present invention contains the method for the reaction of prediction experimenter to antiphlogiston, comprising:

A) in the biological sample from described experimenter, detect the expression level of one or more genes of Fig. 1, and

B) by the reference level comparison of described level and described gene,

Wherein the expression of the one or more described genes compared with described reference level changes, and has predicted the reaction of described experimenter to described antiphlogiston.

Further aspect relates to identifies the method reaction of antiphlogiston to the experimenter of the possibility of increase, comprising:

A) in the biological sample from described experimenter, detect the expression level of one or more genes of Fig. 1,

B) by the reference level comparison of described level and described gene,

Wherein the expression of the one or more described genes compared with the reference level of described gene changes, and shows to identify the experimenter reaction of antiphlogiston to the possibility of increase.

Genetic expression

The molecular background of many inflammatory diseasess or illness (comprising autoimmune disease or illness) is not understood completely, and therefore diagnosis is complicated and tends to inaccurate.At present available treatment is useful to some patient, but useless to other patient, this reason wherein is not yet illustrated.In order to increase the successful for the treatment of, attempt, to patient is divided into subgroup according to various parameters.

An option is characterize patient's gene expression profile and accordingly patient divided into groups.Conventionally, measure genetic expression at rna level or on protein level, because measured the level of given mRNA or translation product.Or, can detect or indirectly determine genetic expression, for example associated by with other gene or mark, also comprises the mark of for example SNP of polymorphism.SNP is normally diallelic and be easily verified.Therefore can on different levels, carry out gene expression detection by several different methods well known by persons skilled in the art.

Can PCR-based technology for the test that carrys out gene expression detection by mRNA level, for example multiple-PCR, wherein use more than two primer sets, for example, for separating the increase object of 2 or more DNA sequence dnas of the single reaction carried out on the nucleic acid of biological sample (patient blood sample).Described method can be two-step approach, and it also comprises the synthetic step of cDNA before amplification.Micro-array chip also can be used for analyzing the gene of large group, such micro-array chip can be through special design, to comprise relevant probe, or can collect from the information of the standard chips about target gene to evaluate the gene expression profile of the gene that is considered to relevant.

The specificity of PCR and array technique depends on the hybridization of the mRNA molecule in primer and probe and institute's analytic sample, can be by parameter adjustment severity well known by persons skilled in the art.

In the time evidence suggests that the detection of other gene or mark is associated with target gene expression level, by being associated with described other gene or described mark, can carry out the detection of genetic expression.As described in embodiment 4 herein, technician can carry out the associated or relation of expression quantative attribute locus (eQTL) analysis and identification SNP with the expression level of this gene of target gene.In further replacement scheme, can measure thus expression level by associated with other gene or mark.

Also considered to measure genetic expression on protein level, as long as translation product is the protein that can detect in the sample that derives from patient.

Can use suitable technology for detection protein, it,, normally based on antibody, because according to technology known in the art, can produce and use specifying albumen to have specific antibody.In the time using from the gene expression data of minority gene, the technology based on antibody can be used.Use Proteomic analysis, can on protein level, carry out more complicated gene expression analysis.

For some gene product, functional examination can be equally well for determining the object of expression level.Functional examination can be the mensuration of test organisms activity or enzymic activity, and this depends on the function and the knowledge of this area about this proteinoid activity of protein.

As mentioned above, one embodiment of the invention relate to identifies the method reaction of antiphlogiston to the patient of the possibility of increase, comprising:

A) in the biological sample from described patient, measure the expression level of one or more genes of Fig. 1

B) by the reference level comparison of described level and described gene,

Wherein the expression of the one or more described genes compared with the reference level of described gene changes, and has predicted the reaction of described patient to described antiphlogiston.

Same standard can be used for the patient that treats of antiphlogiston described in qualification or choice for use, this based on qualification to using the reaction for the treatment of of described antiphlogiston to there is the patient's of the possibility of increase expectation.

Visible in embodiment as disclosed herein, the expression level of one or more genes of Fig. 1 changes the clinical response of instruction to antiphlogiston.In addition magnetism concentrates on one or more genes of increase compared with reference level.Or emphasis can be one or more genes of minimizing compared with reference level.The gene that any of these features is associated with the reactivity of the improvement in patient, lists in respectively in Figure 1A and Figure 1B.In another embodiment, method as herein described relates to such situation: wherein, compared with reference level, the expression of the change of the gene of Figure 1A increases.In another embodiment, method as herein described relates to such situation: wherein, compared with reference level, the expression of the change of the gene of Figure 1B reduces.In other embodiments, can comprise more polygene, for example expression level combination lower than one or more genes of Figure 1B of reference level higher than one or more genes of Figure 1A of reference level and expression level, thus use the expressing information of multiple genes.In one embodiment, by the expression level of at least two genes and the comparison of individual reference level.Further likely by following information combination: the expression of the change of the gene of Figure 1A is the information increasing compared with reference level, and the expression of the change of the gene of Figure 1B compared with reference level is the information reducing.

Be schematically illustrated in table 2 for the assortment of genes based on multivariable method of the present invention, in such method, can use the information of the expression level of one or more for example at least 2, at least 3, at least 4 genes.

As below further described, reference level are characteristics of gene, depend on the specific purpose of described method.

Reference level

Reference level can be the expression levels in unaffected or health volunteer, and it is such gene situation most likely: wherein to change be the feature of inflammatory diseases or illness in the expression of gene, and described gene can be used as diagnostic flag.In one embodiment, reference level can be the expression levels in unaffected or healthy individuals.

According to data herein, it is evident that, compared with patient, in unaffected or healthy individuals, other biomarker not necessarily shows different expression.In one embodiment, reference level can be the mean value of the expression level measured in the colony of healthy individuals or patient or its mixture.In other cases, the gene expression dose of some gene can provide the information of forecasting of the patient's who uses antiphlogiston treatability, although express spectra and morbid state or Case definition may onrelevants.This may be because following true: the disease of diagnosis is inaccurate, because diagnostic tool does not reflect the variability of disease.Such biomarker may still have very large value, because they can use according to method herein, treatment is pointed to the individual patient more may to TA with reaction.

Based on such information, reference level can be predeterminated level, any expression level, and it is for screening the patient that anti-inflammatory medical instrument is responded.In embodiments of the invention, reference level are predeterminated levels.

Examples prove the method according to this invention herein can be used the expression level of individual gene.Therefore this predeterminated level can be the expression level of the given reaction of instruction, and described given reaction is for example by the reaction of DAS28-CRP, ACR20, ACR50 and/or ACR70 reaction assay.Reference level or predeterminated level can be thought threshold value, and can select described threshold value, are intended to a certain reaction level in patient's group.Then, selected threshold value reaches instruction the possibility of ACR20, ACR50 and/or ACR70 reaction in a part of patient.Equally, can select threshold value based on DAS28-CRP scoring, be intended to a certain scoring in patient's group.Therefore, can set level, so that for each standard, cancel and select nonresponder, or increase patient's part of the one or more standards that reach positive reaction.Therefore, the reaction of biomarker predicted treatment, and if be only intended to high reactor, even can be used for predicting level of response.

In one embodiment, predetermined reference level can be based on ROC curve, and it for example, for example, for example, for example, for example, through setting to be chosen in at least 40% patient of antiphlogiston treatment, to reach the expression level of ACR50 reaction in 45%, 50%, 55%, 60%, 65% or at least 70% patient.

In one embodiment, predetermined reference level can be based on ROC curve, and it for example, for example, for example, for example, for example, through setting to be chosen in at least 25% patient of antiphlogiston treatment, to reach the expression level of ACR70 reaction in 30%, 35%, 40%, 45%, 50% patient.

In one embodiment of the invention, the expression level of Complement Factor D (CFD, also referred to as adiposin), for selecting, identify and/or judging whether patient has higher possibility to the reaction of antiphlogiston.Described gene is listed in Figure 1A (and Fig. 2), and how the gene that examples explanation has the expression level of increase can be used for method of the present invention.In embodiment herein, use microarray technology and qRT-PCR to measure expression level, but according to the present invention its also suitable consideration for measure CFD mRNA level alternative method and for measuring protein level or the active universal method of CFD.

Therefore, method of the present invention can comprise, in the time measuring by microarray technology, the expression level of Complement Factor D (CFD) exceedes 9.5 in the log2-of normalized expression value scale (scale).ROC data based on providing herein, threshold value is for example increased to 9.8,10.0,10.2,10.3,10.4 or even 10.5 to be provided and has had more high specific but the method for lower susceptibility simultaneously.

PCR-based is measured for example RT-PCR, also can measure expression level, no matter is the qRT-PCR carrying out with internal contrast, or use can measure the multiplex PCR that exceedes a transcript simultaneously, it also generally includes internal contrast.

Therefore, method of the present invention can comprise following methods: the cycle threshold (Ct) of wherein measuring the expression level of Complement Factor D (CFD) by qRT-PCR and wherein measuring transcript is 30 (to use Assay ID:Hs00157263_m1 (the Applied Biosystems of Life technologies).In further this class embodiment, in PCR circulation 28 or even 26, can detect CFD transcript.Further preferably at same time, on identical cDNA sample, detect 18S RNA and there is cycle threshold (Ct) 12.5, confirm the quality of pcr analysis.

Also can detect the efficiency of amplified reaction, it should be higher than 95%, and wherein 100% shows that the theory of the amplicon of each circulation doubles.Or the efficiency of pcr amplification should be at least 1.9 or preferably at least 1.93, wherein 2.0 represent that the theory of the amplicon of each circulation doubles.

In further embodiment, method of the present invention comprises that its indirect detects the method for the expression level of measuring Complement Factor D (CFD) by SNP.In such method, can evaluate one or more SNP.Contrary with genetic expression, SNP detects to be provided and be/be, be/non-(=non-/be) or non-/ non-reaction, instead of the relative scale of high or low expression (relative scale), therefore described evaluation must concentrate on the genotype changing corresponding to the expression of target gene.

According to selected SNP, reference level can be " non-/ non-" and with at least one allelotrope should provide "Yes" expression change be associated.In an alternative embodiment, described reference level can be " being/be " or " be/non-" even.

In the example of CFD, the CFD of increase expresses relevant to the specificity reference level of each SNP.Therefore, these class methods will comprise that its indirect measures the method for the expression level of Complement Factor D (CFD) by detecting following one or more: rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.

Because it is or the mononucleotide of A or G that therefore described reference level will be AA, AG or GG that these SNP relate to it.

For the SNP rs1683591 describing in embodiment, described reference level will be AA genotype (low CFD express), and AG and GG genotype will show that the expression of CFD changes (high CFD expresses).

Therefore method of the present invention comprises that the AG genotype of its indirect by SNP rs1683591 or the genotypic existence of GG measure the method for CFD level.

Shown in the method for use microarray data and RT-PCR data, can increase the specificity of described method by reducing threshold value, although therefore lose some susceptibility.

As the expression of fruit gene increases relevantly to method of the present invention, for example, for CFD, increase threshold value and there is more high specific but the method for lower susceptibility of while by providing.

Vice versa, as the expression of fruit gene reduces relevantly to method of the present invention, reduces expression level threshold value and have more high specific but the method for lower susceptibility of while by providing.Also it is evident that, in order to meet the threshold criteria in this situation, expression level is lower than threshold value.

According to more than, it is evident that, other gene of qualification as described herein, can be equally alone or in combination for predict the method for clinical response possibility patient, and the high likelihood that according to selected patient, described treatment is had to reaction by this selects patient to carry out given treatment.

Biological sample

After initial diagnosis, individual patient is carried out to the starting point of any point of subgroup or sign, be the information of biological sample or the biological sample based on previously having obtained.According to the present invention, described biological sample can be use before the present invention or during derive from any sample of patient.The blood sample that described sample preferably can easily obtain by ordinary method, but the sample of other type also can use.Described sample can be also serum sample.In some cases, can for example synovia sample of using-system sample.It will be understood to those of skill in the art that before measuring given genomic expression level and how to process given sample.Can gather whole blood sample as PaxGene sample.

If target gene is expressed in particular cell types, this can reflect that sample is for expression study.Therefore, biological sample can be the peripheral blood lymphocytes sample from blood sample, also referred to as PBMC part, or or even its only comprise monocytic sub-part, for example, in CD14+, CD4+ and/or CD8+ positive cell one or more.

The in the situation that of genes encoding soluble proteins mark, expression study can carry out on serum sample, and can assess proteins but not the existence of transcript.Can use the soluble proteins in detection of specific antibody serum, for example, by ELISA known in the art.If evaluate greater protein matter, can consider to use Proteomic analysis to carry out the more complicated gene expression analysis on protein level.

Except expression level and changing, biological sample also can be used for measuring patient's Rheumatoid factors, polyclonal (RF) state.

Patient and patient's states

In one embodiment, experimenter is patient, for example after diagnosing or suffer from the individuality of the S or S relevant to inflammatory diseases as herein described or illness.In one embodiment, described patient suffers from autoimmune disease or illness.In specific embodiment, described patient is RA patient or suffers from RA symptom.

Sample can derive from the patient who never carries out inflammatory diseases or treatment for diseases, and the meaning is previously never will to give described patient for the treatment of inflammatory diseases or illness.For the patient of self inflammatory diseases who suffers from the rare generation of possibility, considering that antiphlogiston as herein described (especially for bio-pharmaceutical class) considers multiple treatment before conventionally.In some cases, gene expression information can derive from the sample of previous acquisition, and therefore described sample can be considered to never receive treatment, and patient never accepts given treatment.Described sample can derive from the patient who is accepting inflammatory diseases or treatment for diseases in some cases.Described patient can be that among the treatment in any medicine of basic use, described medicine is not limited to antiphlogiston in this paper.

Conventionally give patient by the medicine of the first-line drug as treatment inflammatory diseases or illness, then evaluate treatment of the present invention and whether there is high successful possibility.

Can comprise following one or more for treating or previously treating patient's medicine: for example Asprin of NSAID (non-steroidal anti-inflammatory drug) (NSAID), Ibuprofen etc., reflunomide, for example Plaquenil of disease-modified antirheumatic (DMARD), Azulfidine, Methotrexate etc., Copaxone (glatirimer acetate), Gilneya (FTY720), microbiotic is Flagyl such as, Cipro, local (dermal administration) medicine comprises topical corticosteroid, novel vitamin D analogues emulsifiable paste (Dovonex), local retinoids (Tazorac), wetting Agent for Printing Inks, local immunity conditioning agent (tacrolimus and pimecrolimus), coal tar, Dithranol and other, Raptiva, Ustekimumab, light is treated for example PUVA, UVB and CellCept (mycophenolate mofetil).Also comprise biological antiphlogiston, include but not limited to IFN-β, Orencia (CTLA4-Ig), Humira (anti-TNF), Cimzia (anti-TNF, PEG Fab), Tysabri (a4-integrin mAb), Simponi, Rituxan/MabThera, Actemra/RoActemra and Kineret.

If do not use the sample obtaining before treatment, can treat patient with the antiphlogiston of one or more wide regions, described antiphlogiston comprises NSAID as above, DMARD and TNF-alpha inhibitor.Conventionally, will treat patient with methotrexate (MTX).

In addition, the treatment previously having adopted does not provide sufficient reaction in patient, and therefore described patient never accepts described treatment, but is considered to insufficient reactor.For diagnosis and clinical response, for judging that whether given patient is that the standard of insufficient reactor will depend on disease to be treated or illness as described below.

Therefore, for MTX treatment and/or for TNF-alpha inhibitor, treatment can be insufficient reactor to patient, wherein the treatment of TNF-alpha inhibitor refers to one or more in the medicine that is considered to TNF-alpha inhibitor, comprises antibody drug and soluble receptors medicine.

Preferably, obtaining before described biological sample or simultaneously, select not to be subject to previously or the impact of any antiphlogiston treatment of use for the expression of the gene of authentication method as herein described simultaneously.

As mentioned above, also can relate to Rheumatoid factors, polyclonal (RF) state and antioxidant cyclic citrulline protein antibodies (anti-CCP) state of considering patient.The mensuration of determining RF and anti-CCP state is known in the art, and technician can be according to the specification sheets from manufacturers, uses without difficulty any such mensuration.In the Rheumatoid factors, polyclonal horizontal exceeding instruction sample of RF positive patient, there is a certain threshold value of RF.If negative, Rheumatoid factors, polyclonal level is lower than described threshold value, indicates and in described sample, do not have RF.

In one embodiment, patient RF state is positive or negative.In further specific embodiment, patient RF state is positive or negative.

In one embodiment, the anti-CCP state of described patient is positive or negative.In further specific embodiment, the anti-CCP state of described patient is positive or negative.

Indication

As mentioned above, the present invention relates to various diseases, especially comprise the treatment of autoimmunization and inflammatory diseases or illness.

With the described patient's condition of antiphlogiston treatment or illness be rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic, psoriasis arthropathica, ankylosing spondylitis, xerodermosteosis (Sjogren's syndrome), multiple sclerosis, for example ulcerative colitis of inflammatory bowel and Crohn's disease, systemic lupus erythematous or systemic lupus erythematosus, its any combination and the accompanying diseases with these disease-relateds, wherein cardiovascular disorder is the limiting examples of described accompanying diseases.Another aspect, other exemplary patient's condition includes but not limited to JCA, osteoarthritis, other spondyloarthropathy except ankylosing spondylitis, systemic sclerosis (scleroderma), primary inflammatory myopathy (dermatomyositis, polymyositis), vasculitis, SV, temporal arteritis, atherosclerosis, sarcoidosis, myasthenia gravis, autoimmune hemolytic anemia (immunopancytopenia, paroxysmal nocturnal hemoglobinuria), pernicious anemia, AT (primary thrombocytopenic purpura, the thrombocytopenia of immunity-mediation), thyroiditis (Graves' disease, Hashimoto thyroiditis, juvenile form lymphocytic thyroiditis, atrophic thyroiditis), diabetes, type ii diabetes, ephrosis (the glomerulonephritis of immunity-mediation, tubulointerstitial nephritis, autoimmune oophoritis), pancreatitis, autoimmunity orchitis, autoimmunity uveitis, antiphospholipid syndrome, except multiple sclerosis, maincenter beyond primary demyelination polyneuropathy or guillain-Barre syndrome and chronic inflammation demyelinating polyneuropathy and the demyelination of peripheral nervous system, liver and gall diseases is such as infectious hepatitis (first, second, third, fourth, hepatitis E and other non-close liver (hepatotropic) virus), ACAH, viral hepatitis, primary biliary cirrhosis, granulomatous hepatitis, Wei Genashi granulomatosis, behcet disease and sclerosing cholangitis, inflammatory bowel disease is such as celiac disease, gluten susceptibility enteropathy and intestinal lipodystroph, the tetter of autoimmunization or immunity-mediation comprises bullous dermatosis, erythema multiforme and contact dermatitis, atopic dermatitis, dermatitis herpetiformis, pemphigus vulgaris, vitiligo (leukodermia), allergic disorder is such as asthma, rhinallergosis, atopic dermatitis, food hypersensitivity and urticaria, sepsis, endotoxemia, the immunological disease of lung is such as eosinophilic pneumonia, primary pulmonary fibrosis and hypersensitivity pneumonitis, chronic obstructive pulmonary disease, the disease relevant with organ or bone marrow transplantation comprises transplant rejection and graft versus host disease (GVH disease).

The reason of inflammatory diseases is many-sided, relates to multiple approach and component.Inflammation is to comprise multi-component cascade of events, comprises pipe vein system system (for example endotheliocyte, perithelial cells, smooth muscle cell), immune system cell (for example T and bone-marrow-derived lymphocyte; Polymorphonuclear leukocyte or granulocyte, for example monocyte and neutrophilic granulocyte; Dendritic cell, scavenger cell and NK cell), cell-derived solubility medium (cytokine, chemokine) and the cell (for example epithelial cell, synovioblast, neuronal cell) of residing in target tissue.These elements each (comprising its instrumentality) may have effect in disease progression, and also may serve as subsequently the treatment target of above-mentioned disease and illness.Therefore inflammatory diseases also can characterize by affected approach, for example, as B or cell-mediated disease or the illness of T-, as cytokine mediated illness or receptor-mediated illness etc.

For the present invention, therefore described indication can be any illness being improved through antiphlogiston treatment, the illness for example being mediated by the downward of the signal transduction/activity of for example acceptor as described below of IL-10 family and part.

Can use the indication of the cytokine of IL-10 family and the modulators for treatment of acceptor to comprise autoimmune disease and illness, for example rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD), psoriatic or psoriasis arthropathica (PSA).

Antiphlogiston

As mentioned above, multiple approach participate in inflammation, can be in multiple levels the each approach of target.By blocking-up acceptor, by providing soluble receptor fragment or by stoping ligand binding acceptor or through acceptor transduction signal, can obtain the inhibition to receptor signal transduction, the example is the target biology curative that is used for the treatment of some autoimmune disease and/or cancer.For example, cancer patients can use the antibody (anti-CD20) for CD20 to treat; Patient with rheumatoid arthritis can be treated with anti-CD20 (a kind of TNF antagonist) (soluble TNF R or TNF alpha antibody); Psoriatic can treat with anti-CD11a; Patients with multiple sclerosis can be treated with INF-β; Patients of ulcerative colitis can be treated with cd patient and can treat with TNF alpha antibody or anti-alpha-4 integrin with TNF alpha antibody.Unfortunately, these treatments are not fully effective.

Previously described, IL-10 family member is the useful target (WO 2001/46261) for the treatment of inflammatory diseases or illness.

IL-10 family comprises IL-10, IL19, IL-20, IL-22, IL-24 and IL-26, and it is combined with following acceptor heterodimer:

IL-10: be combined with IL-10R1/IL-10R2

IL-19: be combined with IL-20R1/IL-20R2

IL-20: be combined with IL-20R1/IL-20R2 and IL-22R/IL-20R2

IL-22: be combined with IL-22R/IL-10R2

IL-24: be combined with IL-20R1/IL-20R2 and IL-22R/IL-20R2

IL-26: unknown acceptor

This receptor is overlapping to be shown, although some function is specific to each family member, also has some shared effect.Every kind of part and the accurate effect of acceptor in inflammatory diseases are not yet definite, but some diseases that has been associated with.Example comprises: IL-20, and it can carry out target by antibody or receptor fragments, is used for the treatment of some inflammatory diseases (WO 2001/45261); IL-22 and IL-19, IL-17 (WO10025369, WO2010102251), all members of Qi Shi IL-10 family cytokine.

Il-1 9 (IL-19), IL-20 and interleukin-24 (IL-24) are interleukin-10 (IL-10) cytokine family members.As above finding, these 3 kinds of interleukins and IL-20R1/IL-20R2 heterodimer receptors bind are also passed through described acceptor and transduction signal.IL-20 and IL-24 (instead of IL-19) are also the parts of receptor complex, and described receptor complex forms (people such as Parrish-Novak, J Biol Chem 2002 by IL-20R2 and IL-22R1; 277:47517-47523; The people such as Dumoutier, J Immunol 2001; 167:3545-3549).Propose, IL-19 and IL-20, and other IL-10 family member, form unique subfamily of spirrillum cytokine, and wherein at least IL-19 and IL-20 have similar three-dimensional structure (people such as Chang, J Biol Chem 2003; 278:3308-13).

Therefore described and carried out antagonism IL-20 activity by receptor fragments or monoclonal antibody, as the method likely of the multiple inflammatory patient's condition for the treatment of.The antigenic epitopes of human IL-2 0 (hlL-20) and rat or mouse monoclonal antibody (for example WO2005052000, US20060142550 and WO2007081465) in conjunction with hulL-20 have also been described.The anti-lL-20 monoclonal antibody that can reduce the IL-20R1/IL-20R2 of IL-20-mediation and the activation of IL-22R1/IL-20R2 receptor complex in one or more species (comprising people) has been described in WO 2010/000721.

Therefore antiphlogiston can be to reduce the two the IL-20 antagonist of activation of the IL-20R1/IL-20R2 of IL-20 mediation and IL-22R/IL-20 acceptor.Described antiphlogiston can be by having specificity without IL-19 or IL-24 acceptor reduction receptor activation.

Based at least shared mode of action, each part of target and acceptor can provide similar biological effect.Therefore antiphlogiston of the present invention can be the antagonist of IL-10 family member and acceptor thereof, for example, regulate the compound of the signal transduction of above-mentioned acceptor by binding partner or acceptor, has therefore reduced the biological activity of described part or acceptor.The assay method of measuring IL-10 family member's antagonistic activity is known in the art, is also described in WO 2010/000721.

Antiphlogiston of the present invention can in pharmaceutical composition, for example, comprise the pharmaceutical composition of antiphlogiston and pharmaceutically acceptable carrier and label.Described antiphlogiston or pharmaceutical composition can be to be suitable for oral, i.v. and/or s.c. administration.Described antiphlogiston or pharmaceutical composition can repeat to give, for example monthly once or once in a week.

Method herein is also considered route of administration or scheme, because described reaction may be depended on treatment plan used.In one embodiment, the prediction of described reaction or instruction are based on giving once in a week anti-IL-20 antibody.In one embodiment, described antibody gives through subcutaneous.

Clinical response

According to indication, can determine diagnosis and clinical response by the whole bag of tricks.Giving after given antiphlogiston, the patient who does not show any or enough treatment signs of treated illness is considered to unresponsive.On the contrary, giving after given antiphlogiston, by showing, patient that enough treatment signs of treated illness respond is just considered to respond.Enough treatment signs because of the difference of disease and patient's difference different, do not imply patient experience " completely " treatment, and be only the improvement of observing one or more clinical parameters.Can the different time points after giving antiphlogiston consider reactivity, and patient can be after one or many gives have reaction in the short period of time or in long-time, as long as but obtain positive findings, just think that this patient responds.

According to the present invention, can increase success ratio (for example antiphlogiston being given the patient's who responds frequency), and use the present invention can obtain to reach the frequency of high success rate not only but also strong reaction in the patient who is given.

Can measure clinical response by means known in the art.Preferably use official's disease score of being ratified by responsible departments of the government.It is said that such disease score develops in time, be considered to related to the present invention so obtain the following method of clinical score.

What consider is the relevant clinical parameter that those skilled in the art can identify given disease or illness, and what therefore comprise herein is only a small amount of crucial clinical parameter.According to different standards diagnosis autoimmune disease.

Method herein relates to instruction and the prediction of the reaction of patient to antiphlogiston, and this depends on indication and symptom, can be at different time point prediction anticipation reaction.In individual other embodiment, the reaction that described instruction and prediction relate in 12 months, obtain in 10 months, in 8 months, in 6 months, in 5 months, in 4 months, in 3 months or in 2 months.

Rheumatoid arthritis (RA)

Rheumatoid arthritis can be diagnosed according to defined standards such as Americanism diseases caused by dampness association (ACR).In the time using described standard, can mark based on degrease to the reaction for the treatment of.The prevention of radiograph damage or delay are also the targets of RA treatment.Americanism diseases caused by dampness association (ACR), if 20% comprehensively improved standard to describe and exist in touch a tender spot (tender) and swollen joint are counted in 20% improvement and in 5 other measuring (pain, body function, patient's comprehensive health assessment, doctor's comprehensive health assessment and acute phase reactant level) at least 3 and have 20% improvement, is classified as patient " improvement " so.Similarly, ACR50 and ACR70 represent that even the patient of higher degree improves.

According to the patient's quantity or the patient's part that obtain ACR20, ACR50 and/or ACR70, therefore antiphlogiston can quantize as the validity of RA curative.

Except ACR scoring, also can use the disease activity scoring (DAS28) in 28 joints to follow the trail of the development of rheumatoid arthritis.It is the aggregative indexes of the 1980's in Nijmegen exploitation, be widely used as the indicator of RA disease activity and the reaction to treatment, and European wind resistance diseases caused by dampness alliance (European League Against Rheumatism, EULAR) reaction normal based on DAS.The joint that DAS28 comprises is (bilateral): PIP (10 joint), metacarpophalangeal joint (10), wrist (2), elbow (2), shoulder (2) and knee (2).In the time considering these joints, the joint quantity of statistics tenderness (TJC28) and swelling (SJC28) simultaneously.Can comprise the mensuration of C reactive protein (CRP) level (in mg/l), and patient also carries out subjective assessment (SA) to disease activity above during 7 days in the numerical range of 0-100, wherein 0 is " non-activity ", the 100th, " high reactivity possibility ".Calculate accordingly DAS28.

Use described DAS, for high disease activity, low disease activity or even alleviation, developed some threshold values.Described scoring also can be used as reaction normal, when for example, at two time points (before treatment starts and after treatment) mensuration patient DAS, and clinical response that can evaluate patient.

The present invention relates to improve the validity of RA treatment.Although some compounds are granted and for RA treatment, treatment result is seldom optimized for all patients, and comprises test and the error (arrow) of some aspects, because do not use the method for the validity of prediction RA treatment.

Recently, the method (WO2011/028945, the people such as Owczarczyk 2011, Science translational medicine) that increases RA treatment validity for the antibody therapy (Rituximab) of CD20 that uses has been described.In WO2011/028945, the express spectra based on patient has defined the RA patient of different subgroups, and is tested and appraised RA patient's subgroup that antagonism CD20 therapy can not react and has comprised some associated with clinical response.The ARC50 that height (exceeding threshold value) the mRNA level of one or more in FcRH5 and CXCL13 has increased RA patient leads.Allow further segmentation according to the further subgroup of RF state, obtain ARC50 standard thus for about 40% patient, it can reflect the subgroup that depends on B cellular pathways, and described B cellular pathways is the mark of lymph sample subgroup and the target of Rituximab.

The present invention shows that the expression level of the gene of Fig. 1 and 2 changes, and instruction is higher than the clinical response of RA patient's average clinical response.

Systemic lupus erythematous (SLE)

For RA, SLE result for the treatment of can be the basis based on Americanism diseases caused by dampness association (ACR) criteria for classification.Set up these standards, be mainly used for scientific research and clinical trial, instead of for diagnostic purpose, so be not that all SLE patients are by whole standards.

Multiple sclerosis (MS)

Exist some subclass of described disease and observe different prognosis and progress.

State-run multiple sclerosis association of the U.S. (The United States National Multiple Sclerosis Society) defines in 4 subclass of stdn in 1996: 1) recurrence-remission form, 2) secondary Advancement Type, 3) former Advancement Type, and 4) progress recurrence type.For diagnosis and evaluation, use different standards, make the test pole the earth of the potential effective medicine of MS treatment complicated.Be autoimmune disease based on MS, immunomodulator comprises that antiphlogiston can be used for treatment or controls MS .

Psoriasis arthropathica (PSA)

Psoriasis arthropathica can be diagnosed by defined standards such as Americanism diseases caused by dampness association (ACR).In the time using described standard, can mark based on degrease to the reaction for the treatment of.The prevention of radiograph damage or delay are also the targets of PSA treatment.Americanism diseases caused by dampness association (ACR), if 20% comprehensively improved standard to describe and exist in touch a tender spot (tender) and swollen joint are counted in 20% improvement and in 5 other measuring (pain, body function, patient's comprehensive health assessment, doctor's comprehensive health assessment and acute phase reactant level) at least 3 and have 20% improvement, is classified as patient " improvement " so.Similarly, ACR50 and ACR70 represent that even the patient of higher degree improves.

According to the patient's quantity or the patient's part that obtain ACR20, ACR50 and/or ACR70, therefore antiphlogiston can quantize as the validity of PSA curative.

Except ACR scoring, also can use the disease activity scoring (DAS28) in 28 joints to follow the trail of the development of psoriasis arthropathica.It is the aggregative index of the eighties in Nijmegen exploitation, has been widely used as indicator and the EULAR reaction normal of PSA disease activity and the reaction to treatment.The joint that DAS28 comprises is (bilateral): PIP (10 joint), metacarpophalangeal joint (10), wrist (2), elbow (2), shoulder (2) and knee (2).In the time considering these joints, the joint quantity of statistics tenderness (TJC28) and swelling (SJC28) simultaneously.

Can comprise the mensuration of C reactive protein (CRP) level (in mg/l), and patient also carries out subjective assessment (SA) to disease activity above during 7 days in the numerical range of 0-100, wherein 0 is " non-activity ", the 100th, " high reactivity possibility ".Calculate accordingly DAS28.

Use described DAS, for high disease activity, low disease activity or even alleviation, developed some threshold values.Described scoring also can be used as reaction normal, in the time of for example, DAS two time points (before treatment starts and after treatment) mensuration patient, and clinical response that can evaluate patient.

Skin psoriatic is the main aspect of PsA, although the level of activity in skin is not necessarily active relevant to joint.Develop for the psoriatic multiple means of evaluating skin.A kind of widely used means are psoriatic area and severity index (PASI).PASI evaluates erythema, thickness/scleroma and the scope of Single Ag bits characteristic of disease damage, then calculates the total size of the body surface area of related skin with formula, and its scoring scope is 0-72.

Psoriasis arthropathica reaction normal (PsARC) is used for PSA clinical trial through special exploitation.PsARC is made up of 4 measurements: 1) the active comprehensive evaluation of patient disease (reaction needed is improved as 1 on 5 Likert scales (Likert scale)), 2) doctor's disease activity comprehensive evaluation (reaction needed is improved as 1 on 5 Likert scales), 3) arthralgia (reaction needed on overall score, reduce 30% or more than, evaluate or 68 or 78 joints, use 4 point scales), with 4) arthroncus (reaction needed on overall score, reduce 30% or more than, evaluate or 66 or 76 joints, use 4 marking scales).In order to become " PsARC reactor ", patient must reach 2 improvement in 4 measurements, and one of them must be arthralgia or swelling, and its nothing in any measurement worsens.

Treatment

One aspect of the present invention relates to the methods for the treatment of of the information based on from example herein.The method of the clinical success of prediction antiphlogiston provides the methods for the treatment of with the patient of described method qualification subsequently.Because can easily identify the patient's who meets a certain preassigned method, it separates (method used not necessarily comprises that definite patient meets the step of some preassigned, although it is preferred embodiment of the present invention) with patient's actual therapeutic.When using when methods for the treatment of of the present invention, expection patient will be with high degree of certainty reaction, and this is not the true situation of not understanding in advance patient and meet a certain preassigned.

One embodiment of the invention relate to the method for the treatment of inflammatory diseases or illness in patient, and wherein the expression level of one or more genes of Fig. 1 is changed compared with reference level, and described method comprises and gives described patient by the antiphlogiston of therapeutic dose.

Another embodiment relates to the method for the treatment of inflammatory diseases or illness in patient:

A. compared with reference level, in described patient, consider whether the expression level of one or more genes of Fig. 1 is changed,

B. comprise and give described patient by the antiphlogiston of therapeutic dose.

In addition, in one embodiment, the present invention relates to treat the method for inflammatory diseases or illness in patient

A. in the biological sample from described patient, measure compared with reference level, whether the expression level of one or more genes of Fig. 1 is changed,

B. comprise and give described patient by the antiphlogiston of therapeutic dose.

Even further, in one embodiment, the present invention relates to treat the method for inflammatory diseases or illness in patient, comprising:

A. in the biological sample from described patient, measure the expression level of one or more genes of Fig. 1

B. by the reference level comparison of described level and described gene,

C. judge, compared with described reference level, whether the expression level of one or more genes of Fig. 1 is changed

D. give described patient by the antiphlogiston of therapeutic dose.

In the replacement scheme of aforesaid method, described reference level can be predeterminated levels.

In other embodiments, each of described method can comprise that, compared with described reference level, the expression level of one or more genes of Fig. 1 is changed in described biological sample.

With reference to above herein description, comprise the more detailed information of Forecasting Methodology, it relates to methods for the treatment of of the present invention.

One aspect of the present invention relates to the antiphlogiston for the treatment of inflammatory diseases or illness in experimenter, and wherein said experimenter shows compared with the reference level with one or more genes of Fig. 1, and the expression of one or more genes of Fig. 1 changes.

For methods for the treatment of, with reference to above description, comprise the more details of prediction or authentication method herein, it relates to the feature and the pharmaceutical use thereof that define antiphlogiston significantly equally.

Goods

The present invention relates to goods on the other hand, comprise pharmaceutical composition packaging together and label, described pharmaceutical composition comprises antiphlogiston and pharmaceutically acceptable carrier, and described label illustrates that described pharmaceutical composition is used for the treatment of the patient of the expression change of one or more genes of suffering from autoimmune disease or illness and having Fig. 1.

With reference to above herein description, comprise the more detailed information of Forecasting Methodology, it relates to goods of the present invention.

Detection reagent and test kit

The invention further relates to composition, comprise at least one detection reagent, for measuring the expression level of one or more genes and especially CFD of one or more genes, especially Fig. 2 of Fig. 1.Described detection reagent can be that each gene is comprised to mRNA and coded albumen thereof have specific antibody, probe or primer.

The present invention relates to test kit on the other hand, and it comprises detection reagent as above or the composition that comprises described detection reagent and working instructions.In the situation that using internal contrast, test kit can further comprise with reference to genome compound.Described test kit also can comprise for expressing standardized detection reagent, and described detection reagent is for detection of globulin gene.Further part of the present invention comprises about how the expression level description associated with reaction possibility to antiphlogiston as herein described.Especially consider test kit, it is for detection of expression level and the evaluation thereof of Complement Factor D (CFD).

Treatment target

Antiphlogiston is the conditioning agent of the required approach of phenotype of inflammatory diseases or illness.According to data herein, it is evident that, selected gene can be thought of as separately the new treatment target that is used for the treatment of up to now inflammatory diseases or illness, because for autoimmune disease and especially RA, has not previously described them.

Embodiment

The present invention is summarized in but is not limited to following embodiment as described herein.

1. the method for the reaction of prediction experimenter to antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression level of the one or more described genes compared with the reference level of described gene changes, and has predicted the reaction of described experimenter to described antiphlogiston.

2. the method for the reaction of prediction patient to antiphlogiston, comprising:

A. in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1, and

B. by the reference level comparison of described level and described gene

Wherein the expression of the one or more described genes compared with described reference level changes, and has predicted the reaction of described patient to described antiphlogiston.

3. qualification has the experimenter's of the possibility of increase method to the reaction of antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression level of the one or more described genes compared with the reference level of described gene changes, and shows to have identified the experimenter reaction of antiphlogiston to the possibility of increase.

4. qualification has the patient's of the possibility of increase method to the reaction of antiphlogiston, comprising:

A. in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1

B. by the reference level comparison of described expression level and described gene,

Wherein the expression of the one or more described genes compared with the reference level of described gene changes, and shows to have identified the patient reaction of antiphlogiston to the possibility of increase.

5. the method for any one in previous embodiment is wherein measured the expression of Complement Factor D (CFD) in biological sample.

6. the method for any one in embodiment 1-4 has wherein been measured Complement Factor D (CFD) and serine protease inhibitor peptidase inhibitors in biological sample, clade B, member's 9 (SERPINB9) expression.

7. the method for any one in embodiment 1-4, Complement Factor D (CFD) and/or serine protease inhibitor peptidase inhibitors wherein in biological sample, are measured, clade B, member 9 (SERPINB9) and/or zinc refers to, CCHC contains in territory the expression of 24 (ZCCHC24).

8. the method for any one in embodiment 1-4 has wherein been measured the expression of Complement Factor D (CFD) and/or fructosamine 3 kinase-associated proteins (FN3KRP) and/or interstitial homology frame 1 (MEOX1) in biological sample.

9. the method for any one in embodiment 1-4, Complement Factor D (CFD) and/or serine protease inhibitor peptidase inhibitors wherein in biological sample, are measured, clade B, member 9 (SERPINB9) and/or zinc refers to, CCHC contains in territory the expression of 24 (ZCCHC24) and/or fructosamine 3 kinase-associated proteins (FN3KRP).

10. the method for any one in embodiment 1-4, Complement Factor D (CFD) and/or serine protease inhibitor peptidase inhibitors wherein in biological sample, are measured, clade B, member 9 (SERPINB9) and/or zinc refers to, CCHC contains in territory the expression of 24 (ZCCHC24) and/or fructosamine 3 kinase-associated proteins (FN3KRP) and/or interstitial homology frame 1 (MEOX1).

The method of any one in 11. embodiment 1-4, Complement Factor D (CFD) and/or desmocyte growth factor-21 3 (FGF13) and/or tubulin wherein in biological sample, are measured, β 2A (TUBB2A) and/or solute carrier family 39 (metal ion translocator, member 11) are (SLC39A11) and/or the expression of transmembrane channel-sample 4 (TMC4).

The method of any one in 12. embodiment 1-4, Complement Factor D (CFD) and/or nuclear Pore Complex interaction protein-sample 2 (NPIPL2) and/or zinc finger protein 880 (ZNF880) and/or aldehyde dehydrogenase 5 families wherein in biological sample, are measured, the expression of member A1 (ALDH5A1).

The method of any one in 13. embodiment 1-4, Complement Factor D (CFD) and/or desmocyte growth factor-21 3 (FGF13) and/or tubulin wherein in biological sample, are measured, β 2A (TUBB2A) and/or solute carrier family 39 (metal ion translocators, member 11) (SLC39A11) and/or transmembrane channel-sample 4 (TMC4) and/or nuclear Pore Complex interaction protein-sample 2 (NPIPL2) and/or zinc finger protein 880 (ZNF880) and/or aldehyde dehydrogenase 5 families, the expression of member A1 (ALDH5A1).

The method of any one in 14. embodiment 1-4, Complement Factor D (CFD) and/or serine protease inhibitor peptidase inhibitors wherein in biological sample, are measured, clade B, member 9 (SERPINB9) and/or zinc refer to, CCHC contains in territory 24 (ZCCHC24) and/or fructosamine 3 kinase-associated proteins (FN3KRP) and/or interstitial homology frame 1 (MEOX1) and/or desmocyte growth factor-21 3 (FGF13) and/or tubulin, β 2A (TUBB2A) and/or solute carrier family 39 (metal ion translocators, member 11) (SLC39A11) and/or transmembrane channel-sample 4 (TMC4) and/or nuclear Pore Complex interaction protein-sample 2 (NPIPL2) and/or zinc finger protein 880 (ZNF880) and/or aldehyde dehydrogenase 5 families, the expression of member A1 (ALDH5A1).

The method of any one in 15. foregoing embodiments, wherein, compared with reference level, it is to increase that the expression of the gene of Figure 1A changes.

The method of any one in 16. foregoing embodiments, wherein, compared with reference level, it is to reduce that the expression of the gene of Figure 1B changes.

The method of any one in 17. foregoing embodiments, wherein by the individual reference level comparison of the expression level of at least two genes and described at least two genes.

The method of any one in 18. foregoing embodiments, wherein by the individual reference level comparison of the expression level of at least two genes and described at least two genes, and wherein compared with reference level the expression of the gene of Figure 1A change be increase, and wherein compared with reference level the expression of the gene of Figure 1B change be reduce.

The method of any one in 19. foregoing embodiments, wherein said reference level are predeterminated levels.

The method of any one in 20. foregoing embodiments, wherein said predeterminated level is the threshold value that instruction is used the reaction of DAS28-CRP, ACR20, ACR50 and/or ACR70 measurement.

The method of any one in 21. foregoing embodiments, wherein said biological sample is blood sample or serum sample.

The method of any one in 22. foregoing embodiments, wherein said biological sample is Paxgene whole blood sample.

The method of any one in 23. foregoing embodiments, wherein said biological sample is the PBMC part from blood sample.

The method of any one in 24. foregoing embodiments, wherein said biological sample is the cell subgroup from blood sample.

The method of any one in 25. foregoing embodiments, wherein said biological sample is the cell subgroup from blood sample, in described subgroup, can be wherein one or more in CD14+, CD4+ and CD8+ positive cell.

The method of any one in 26. foregoing embodiments, wherein measures described expression level based on mRNA.

The method of any one in 27. foregoing embodiments, wherein measures described expression level with PCR.

The method of any one in 28. foregoing embodiments, wherein said PCR is selected from multiplex PCR and qRT-PCR.

The method of any one in 29. foregoing embodiments, is wherein used micro-array chip to measure described expression level.

The method of any one in 30. foregoing embodiments, the cycle threshold (Ct) of wherein measuring the expression level of Complement Factor D (CFD) by qRT-PCR and wherein using Assay ID:Hs00157263_m1 (Applied Biosystems) to measure transcript is 30.

The method of any one in 31. foregoing embodiments, wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) of CFD and the Assay ID:Hs99999903_m1 (Applied Biosystems/ Invitrogen) of ACTB detect transcript absolute number for copy/beta-actin of at least 0.03 CFD mRNA (gene symbol ACTB) copy.

The method of any one in 32. foregoing embodiments, wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) of CFD and the Assay ID:Hs99999903_m1 (Applied Biosystems/ Invitrogen) of ACTB detect transcript absolute number for copy/beta-actin of at least 0.04 CFD mRNA (gene symbol ACTB) copy.

The method of any one in 33. foregoing embodiments, wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) of CFD and the Assay ID:Hs99999903_m1 (Applied Biosystems/ Invitrogen) of ACTB detect transcript absolute number for copy/beta-actin of at least 0.05 CFD mRNA (gene symbol ACTB) copy.

The method of any one in 34. foregoing embodiments, wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) of CFD and the Assay ID:Hs99999903_m1 (Applied Biosystems/ Invitrogen) of ACTB detect transcript absolute number for copy/beta-actin of at least 0.06 CFD mRNA (gene symbol ACTB) copy.

The method of any one in 35. foregoing embodiments, wherein, in the time using micro-array chip to measure, the expression level of Complement Factor D (CFD) exceedes 9.5 in the log2 scale of RMA or GC-RMA normalized expression value.

The method of any one in 36. foregoing embodiments, wherein according to expression level described in one or more SNP indirect measurements.

The method of any one in 37. foregoing embodiments, wherein expresses the expression level of relevant SNP indirect measurement Complement Factor D (CFD) according to one or more CFD.

The method of any one in 38. foregoing embodiments, wherein according to the expression level of the one or more SNP indirect measurement Complement Factor Ds (CFD) in CFD monoploid piece (haploblock).

The method of any one in 39. foregoing embodiments, wherein according to the expression level that is selected from following one or more SNP indirect measurement Complement Factor Ds (CFD): rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.

The method of any one in 40. foregoing embodiments, the wherein AG by SNP rs1683591 or the genotypic existence of GG and the expression level of indirect measurement CFD.

The method of any one in 41. foregoing embodiments 1-25 is wherein measured described expression level on protein level.

The method of 42. embodiments 41, is wherein used expression level described in TPPA.

The method of 43. embodiments 41, is wherein used Proteomic analysis to measure described expression level.

The method of any one in 44. foregoing embodiments, wherein said experimenter or patient are the patients who suffers from inflammatory diseases or illness.

The method of any one in 45. foregoing embodiments, wherein said patient suffers from autoimmune disease or illness.

The method of 46. embodiments 44 or 45, wherein said patient suffers from rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD), psoriasis arthropathica (PSA) or psoriasis arthropathica.

The method of 47. embodiments 46, wherein said patient suffers from RA.

The method of any one in 48. embodiment 44-47, wherein said patient is accepting or is accepting MTX treatment.

The method of any one in 49. embodiment 44-48, wherein said patient is the insufficient reactor to MTX treatment.

The method of any one in 50. foregoing embodiments 44-49, wherein said patient is accepting the treatment of TNF-alpha inhibitor.

The method of any one in 51. embodiment 44-50, wherein said patient never accepts the treatment of TNF-alpha inhibitor.

The method of any one in 52. embodiment 44-51, wherein said patient is the insufficient reactor to the treatment of TNF-alpha inhibitor.

The method of any one in 53. embodiment 44-52, wherein said patient is the insufficient reactor to one or more treatments for described inflammatory diseases or illness.

The method of any one in 54. embodiment 44-53, wherein said patient is the insufficient reactor to MTX and the treatment of TNF-alpha inhibitor.

The method of any one in 55. embodiment 44-54, wherein said patient is the RF positive.

The method of any one in 56. embodiment 44-55, wherein said patient is RF feminine gender.

The method of any one in 57. foregoing embodiments, wherein said antiphlogiston is antibody.

The method of any one in 58. foregoing embodiments, wherein said antiphlogiston is receptor antagonist.

The method of any one in 59. foregoing embodiments, wherein said antiphlogiston is one or more members' of IL-10 family antagonist.

The method of any one in 60. foregoing embodiments, wherein said antiphlogiston is one or more the antagonist in IL-10, IL19, IL-20, IL-22, IL-24 and IL-26.

The method of any one in 61. foregoing embodiments, wherein said antiphlogiston is one or more the antagonist in IL-19, IL-20 and IL-24.

The method of any one in 62. foregoing embodiments, wherein said antiphlogiston is the antagonist of IL-20.

The method of any one in 63. foregoing embodiments, wherein said antiphlogiston is the antagonist of IL-20, it reduces (medicated) IL-20R1/IL-20R2 of IL-20 mediation and the activation of IL-22R/IL-20R2 acceptor.

The method of any one in 64. foregoing embodiments, wherein said antiphlogiston is the antagonist of IL-20, it reduces the IL-20R1/IL-20R2 of IL-20 mediation and the activation of IL-22R/IL-20R2 acceptor, instead of the receptor activation of IL19 or IL24 mediation.

The method of any one in 65. foregoing embodiments, wherein said antiphlogiston is anti-human IL-20 antibody.

66. treat the method for inflammatory diseases or illness in experimenter, and in described experimenter, the expression level of one or more genes of Fig. 1 is changed compared with reference level, and described method comprises and gives described experimenter by the antiphlogiston of therapeutic dose.

67. treat the method for inflammatory diseases or illness in patient, comprising:

A. in described patient, consider whether the expression level of one or more genes of Fig. 1 is changed compared with reference level,

B. give described patient by the antiphlogiston of therapeutic dose.

68. treat the method for inflammatory diseases or illness in patient, comprising:

A. in the biological sample from described patient, measure compared with reference level, whether the expression level of one or more genes of Fig. 1 is changed,

B. give described patient by the antiphlogiston of therapeutic dose.

69. treat the method for inflammatory diseases or illness in patient, comprising:

A. in the biological sample from described patient, measure the expression level of one or more genes of Fig. 1,

B. by the reference level comparison of described level and described gene,

C. measure compared with described reference level, whether the expression level of one or more genes of Fig. 1 is changed, and

D. give described patient by the antiphlogiston of therapeutic dose.

The method of any one in 70. foregoing embodiments 68-69, wherein, compared with described reference level, in described biological sample, the expression level of one or more genes of Fig. 1 is changed.

The method of any one in 71. foregoing embodiments 68-70, wherein said method is characterised in that any or multiple in the feature of foregoing embodiments 15-65.

72. goods, comprise pharmaceutical composition packaging together and label, described pharmaceutical composition comprises antiphlogiston and pharmaceutically acceptable carrier, and described label illustrates that described pharmaceutical composition is used for the treatment of the patient of the expression change of one or more genes of suffering from autoimmune disease or illness and having Fig. 1.

The goods of 73. embodiments 72, wherein said goods are characterised in that any or multiple in the feature of foregoing embodiments 5-46.

74. treat the antiphlogiston of inflammatory diseases or illness in experimenter, and wherein said experimenter shows compared with the reference level with described gene, and the expression of one or more genes of Fig. 1 changes.

The antiphlogiston of 75. embodiments 74, is characterised in that any or multiple in the feature of foregoing embodiments 15-65.

76. compositions, comprise at least one detection reagent, and it is for measuring the expression level of one or more genes of table 1.

The composition of 77. embodiments 76, wherein said detection reagent is used for measuring the expression of Complement Factor D (CFD).

The composition of 78. embodiments 76, wherein said detection reagent is CFD probe.

The composition of 79. embodiments 76, wherein said detection reagent is CFD primer.

The composition of 80. embodiments 76, wherein said detection reagent is the primer of expressing relevant SNP for detection of CFD.

The composition of 81. embodiments 76, wherein said detection reagent is for detection of one or more primers that are selected from following CFD and express relevant SNP: rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.

82. test kits, comprising: the composition of any one and working instructions in embodiment 76-81.

The test kit of 83. embodiments 82, further comprises reference sample.

The test kit of 84. embodiment 82-83, further comprises for standardized detection reagent.

The test kit of 85. embodiment 82-84, how wherein said working instructions comprise about the expression level description associated with reaction possibility.

The test kit of 86. embodiment 82-85, wherein said test kit will have the possibility of reaction for measuring patient to antiphlogiston.

87. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, at least one test has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient.

88. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, at least one test has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

89. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed.

90. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

91. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, in embodiment 1-43, at least one test of any one has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient.

92.

93. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, in embodiment 1-43, at least one test of any one has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

94. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, in embodiment 1-43 any one after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed.

95. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston in embodiment 1-43 any one after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

The method of any one in 96. embodiment 87-94, wherein said experimenter or patient are the patients who suffers from inflammatory diseases or illness.

The method of any one in 97. embodiment 87-94, wherein said patient suffers from autoimmune disease or illness.

The method of any one in 98. embodiment 87-96, wherein said patient suffers from rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD), psoriasis arthropathica (PSA) or psoriasis arthropathica.

The method of 99. embodiments 97, wherein said patient suffers from RA.

The method of 100. embodiment 87-98, wherein said patient is accepting or is accepting MTX treatment.

The method of 101. embodiment 87-99, wherein said patient is the insufficient reactor to MTX treatment.

The method of any one in 102. foregoing embodiments 87-100, wherein said patient is accepting the treatment of TNF-alpha inhibitor.

The method of 103. embodiment 87-101, wherein said patient never accepts the treatment of TNF-alpha inhibitor.

The method of 104. embodiment 87-103, wherein said patient is the insufficient reactor to the treatment of TNF-alpha inhibitor.

The method of any one in 105. embodiment 87-103, wherein said patient is the insufficient reactor to one or more treatments for described inflammatory diseases or illness.

The method of 106. embodiment 87-104, wherein said patient is the insufficient reactor to MTX and the treatment of TNF-alpha inhibitor.

The method of 107. embodiment 87-105, wherein said patient is the RF positive.

The method of 108. embodiment 87-106, wherein said patient is RF feminine gender.

The method of 109. embodiment 87-107, wherein said antiphlogiston is antibody.

The method of 110. embodiment 87-108, wherein said antiphlogiston is receptor antagonist.

The method of 111. embodiment 87-109, wherein said antiphlogiston is one or more members' of IL-10 family antagonist.

The method of 112. embodiment 87-110, wherein said antiphlogiston is one or more the antagonist in IL-10, IL19, IL-20, IL-22, IL-24 and IL-26.

The method of 113. embodiment 87-111, wherein said antiphlogiston is one or more the antagonist in IL-19, IL-20 and IL-24.

The method of 114. embodiment 87-112, wherein said antiphlogiston is the antagonist of IL-20.

The method of 115. embodiment 87-113, wherein said antiphlogiston is the antagonist of IL-20, it reduces the IL-20R1/IL-20R2 of IL-20 mediation and the activation of IL-22R/IL-20R2 acceptor.

The method of 116. embodiment 87-114, wherein said antiphlogiston is the antagonist of IL-20, it reduces the IL-20R1/IL-20R2 of IL-20 mediation and the activation of IL-22R/IL-20R2 acceptor, instead of the receptor activation of IL19 or IL24 mediation.

The method of 117. embodiment 87-115, wherein said antiphlogiston is anti-human IL-20 antibody.

The method of 118. treatment inflammatory diseasess, comprise and give inflammatory diseases patient by the antiphlogiston of pharmacy effective dose, described patient has such express spectra: wherein with respect to the expression at the first biomarker in the unresponsive people of described antiphlogiston, the expression of the first biomarker increases, and wherein said the first biomarker is Complement Factor D (CFD).

The method of 119. embodiments 118, the expression ratio of the CFD in wherein said inflammatory diseases patient is at high at least one standard deviation of expression of the CFD in the unresponsive people of described antiphlogiston.

The method of 120. embodiments 118, wherein said inflammatory diseases is autoimmune disease or illness.

The method of 121. embodiments 120, wherein said autoimmune disease or illness are selected from rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD) and psoriasis arthropathica (PSA).

The method of 122. embodiments 121, wherein said autoimmune disease is RA.

The method of 123. embodiments 118, wherein said inflammatory diseases patient has such express spectra: wherein with respect to the expression at the second biomarker in the unresponsive people of described antiphlogiston, the expression of the second biomarker increases, wherein said the second biomarker is SERPINB9 (serine protease inhibitor peptidase inhibitors and clade B (ovalbumin), member 9).

The method of 124. embodiments 118, wherein said inflammatory diseases patient has such express spectra: wherein with respect to the expression at the second biomarker in the unresponsive people of described antiphlogiston, the expression of the second biomarker increases, wherein said the second biomarker is selected from following one or more: SERPINB9 (serine protease inhibitor peptidase inhibitors, clade B (ovalbumin) member 9) and ZCCHC24 (zinc refer to, CCHC contains 24 in territory).

The method of 125. embodiments 118, wherein said inflammatory diseases patient has such express spectra: wherein with respect to the expression at the second biomarker in the unresponsive people of described antiphlogiston, the expression of the second biomarker increases, wherein said the second biomarker is selected from following one or more: SERPINB9 (serine protease inhibitor peptidase inhibitors, clade B (ovalbumin) member 9), (zinc refers to ZCCHC24, CCHC contains 24 in territory), FN3KRP (fructosamine 3 kinase-associated proteins), FN3KRP (fructosamine 3 kinase-associated proteins), MEOX1 (interstitial homology frame 1), FGF13 (desmocyte growth factor-21 3), TUBB2A (tubulin, β 2A), SLC39A11 (solute carrier family 39 (metal ion translocator), member 11), TMC4 (transmembrane channel-sample 4), NPIPL2 (nuclear Pore Complex interaction protein-sample 2), ZNF880 (zinc finger protein 880) and ALDH5A1 (aldehyde dehydrogenase 5 families, member A1).

The method of 126. embodiment 118-125, wherein said antiphlogiston is one or more the antagonist in IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26.

The method of 127. embodiment 118-126, wherein said antiphlogiston is one or more the antagonist in IL-19, IL-20 and IL-24.

The method of 128. embodiment 118-127, wherein said antiphlogiston is the antagonist of IL-20.

The method of 129. treatment autoimmune diseases, comprising:

Qualification autoimmune disease patient;

Judge that described patient expresses the first biomarker, wherein the first biomarker is Complement Factor D (CFD);

Based on following understanding, select the treatment of antiphlogiston as patient: described antiphlogiston is effective in autoimmune disease patient, with respect to the expression at the first biomarker in the unresponsive experimenter of described antiphlogiston, in described patient, the express spectra of the first biomarker increases; With

Give described patient by described antiphlogiston.

The method of 130. embodiments 129, wherein said autoimmune disease or illness are selected from rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD) and psoriasis arthropathica (PSA).

The method of 131. embodiments 130, wherein said autoimmune disease is RA.

The method of 132. embodiments 129, wherein select antiphlogiston further to comprise following understanding as patient's treatment: described antiphlogiston is effective in autoimmune disease patient, with respect to the expression at the second biomarker in the unresponsive experimenter of described antiphlogiston, in described patient, the express spectra of the second biomarker increases, wherein the second biomarker is selected from following one or more: SERPINB9 (serine protease inhibitor peptidase inhibitors, clade B (ovalbumin) member 9), (zinc refers to ZCCHC24, CCHC contains 24 in territory), FN3KRP (fructosamine 3 kinase-associated proteins), FN3KRP (fructosamine 3 kinase-associated proteins), MEOX1 (interstitial homology frame 1), FGF13 (desmocyte growth factor-21 3), TUBB2A (tubulin, β 2A), SLC39A11 (solute carrier family 39 (metal ion translocator), member 11), TMC4 (transmembrane channel-sample 4), NPIPL2 (nuclear Pore Complex interaction protein-sample 2), ZNF880 (zinc finger protein 880) and ALDH5A1 (aldehyde dehydrogenase 5 families, member A1).

The method of any one in 133. embodiment 129-132, wherein said antiphlogiston is one or more the antagonist in IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26.

The method of any one in 134. embodiment 129-133, wherein said antiphlogiston is one or more the antagonist in IL-19, IL-20 and IL-24.

The method of any one in 135. embodiment 129-134, wherein said antiphlogiston is the antagonist of IL-20.

The method of 136. embodiments 129, the judgement of wherein described patient being expressed to the first biomarker comprises the detection of mRNA.

The method of 137. embodiments 136, wherein comprises multiplex PCR and qRT-PCR to the detection of mRNA.

The method of 138. embodiments 129, wherein expresses the expression level of relevant SNP indirect measurement Complement Factor D (CFD) according to one or more CFD.

The method of 139. embodiments 129, wherein according to the expression level of the one or more SNP indirect measurement Complement Factor Ds (CFD) in CFD monoploid piece (haploblock).

The method of 140. embodiment 138-139, wherein according to the expression level that is selected from following one or more SNP indirect measurement Complement Factor Ds (CFD): rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.

The method of 141. embodiments 140, the wherein AG by SNP rs1683591 or the genotypic existence of GG and the expression level of indirect measurement CFD.

142. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, at least one test has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient.

143. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, at least one test has shown that, compared with reference level, the expression level of one or more genes of Fig. 1 is changed in the biological sample from described patient; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

144. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed.

145. treat the method for inflammatory diseases or illness in patient, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, after measured compared with reference level, in the biological sample from described patient, the expression level of one or more genes of Fig. 1 is changed; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, has predicted the reaction of described experimenter to described antiphlogiston.

Universal method

total RNA purifying

Can obtain total RNA from the biological sample of any type by several different methods well known by persons skilled in the art.

Embodiment is herein the data that obtain based on using PaxGene blood RNA KIT IVD (QIAGEN), and described test kit is particularly suitable for the sample of time expand collection subsequent analysis.Process PaxGene blood sample and separate total RNA according to the scheme of PaxGene PAXgene Blood RNA Kit (QIAGEN) according to manufacturers (Qiagen) specification sheets.

sphaeroprotein mRNA reduces

According to the specification sheets of manufacturers, use GLOBINClear test kit (Applied Biosystems, Foster City, CA, USA), can obtain the minimizing of the sphaeroprotein mRNA in total RNA sample.

rNA integrity confirms

Before being further analyzed, confirm that the integrity of RNA sample is suitable.

Can be according to manufacturer specification, use Agilent 2100 Bioanalyzer and total RNA Nano chip (Agilent Technologies, Santa Clara, CA, USA).Conventionally the sample of RNA integrity counting (RIN-scoring) higher than 7 is just considered to can accept for further analysis.

affyMetrix GeneChip hybridization, scanning and analysis

By 3'IVT Express test kit (Affymetrix, Santa Clara, Ca, USA), according to manufacturer specification, use total RNA sample, prepare the cRNA (target) of mark from the total RNA of 50 nanogram(ng).Described in manufacturers, preparation hybridization mixture also hybridizes to human genome U133 Plus 2.0 GeneChips at 45 DEG C in hybrid heater 640 (Affymetrix) (Affymetrix) reach 17h (60 RPM).After hybridization, use fluidics scheme " EukGE-WS2v5_450 " (Affymetrix), by gene chip at GeneChip washing and dyeing in fluidics station 450.By GeneChips at GeneChip scanning in scanner 3000 (Affymetrix).By the Bioconductor bag " Affy " that uses R environment and can find in following URL:cran.r-project.org & bioconductor.org, will export " * .cel file " RMA (Robust Multiarray Average) stdn for microarray data.

With the statistical analysis that can derive from the Open-Source Tools (can derive from URL:cran.r-project.org) of statistics programmed environment R and QluCore Omics explorer 2.2 (QluCore AB, Sweden) and carry out microarray data.Microarray stdn by RMA (Robust Multiarray Average), (HGU133Plus2_Hs_ENSG), it can derive from URL:brainarray.mbni.med.umich.edu to use Affy bag (can derive from URL:cran.r-project.org) and custom chip defined file (custom Chip Definition File)).

Use Simca-P+11 softwares (Umetrics, Ume, Sweden) and offset minimum binary (PLS) instrument to carry out multivariable prediction.

Use GraphPad Prism 5 (GraphPad software, CA, USA) to prepare ROC (recipient's operating characteristics) curve.

quantitative RT-PCR

According to the specification sheets of manufacturers, use random primer and TaqMan reverse transcription reagent (Applied Biosystems, Foster City, CA, USA), by preparing 25 microlitre cDNA from the total RNA of 200 ng, carry out quantitative RT-PCR analysis.

Carry out qPCR analysis with cumulative volume 25 microlitres, each sample duplicate (6, the cDNA of 10 times of dilutions of 95 microlitres), use TaqMan PCR core reagent (Applied Biosystems) and ABI PRISM 7900HT sequence detection system (Applied Biosystems).

Use CFD mRNA and the primer of 18S rRNA and the probe of FAM mark, detect the expression level of CFD mRNA, ACTB mRNA and 18S rRNA.Primer and probe are ordered in the mode that detects as required (Assays-on-Demand) (Applied Biosystems).The probe sequence of these mensuration is as follows: CFD (CCTGCTGCTACAGCTGTCGGAGAAG (Assay ID:Hs00157263_m1)), ACTB (CCTTTGCCGATCCGCCGCCCGTCCA (Assay ID:Hs Hs99999903_m1) and 18S rRNA (TGGAGGGCAAGTCTGGTGCCAGCAG; Assay Hs99999901_s1).Use ABI Prism SDS 2.2 softwares (Applied Biosystems) analytical data, and expression level is normalized to 18S rRNA or ACTB mRNA.

The reliable detection of PCR product should be measured at CFD in (ID:Hs00157263_m1) and can detect in circulation (Ct-value) 26, should be at Ct=12 with the detection (assay ID Hs99999901_s1) of 18S rRNA, within 5 o'clock, obtain.Also can be by carrying out below stdn: by calculating Δ-Ct value, or the plasmid-encoded CFD, the ACTB that dilute by use and the typical curve of 18S, and the CFD copy number of quantitative assay is associated with ACTB or the 18S copy number of quantitative assay.

Above, the transcript of formal gene symbol mark for analyzing.

Embodiment

The qualification of embodiment 1-predictability transcript

Gather the blood sample of testing from 1b phase and 2a phase from patient at following time point, described test checks anti-IL-20 security, tolerance and effect (clinical trial government identification: NCT01038674 and NCT01282255) in rheumatoid arthritis (RA) patient: in testing in the 1b phase before administration after (the 1st day) and administration the 8th, 15,29,43 and 99 days, and in testing in the 2a phase before administration after (the 1st day) and administration the 15th, 36 days.During 6 weeks, giving once in a week patient's (7 doses altogether) and during 11 weeks, giving once in a week patient (12 doses altogether) respectively.

Obtain as described above total RNA.After sphaeroprotein mRNA minimizing and the confirmation of RNA integrity, hybridize by AffyMetrix GeneChip according to said procedure, analyze RNA sample.

In order to identify transcript (its to measure variation in for example ACR20, ACR50 and ACR70 in the scoring of DAS28-CRP and Other diseases relevant) in whole blood PaxGene sample, we have carried out regression analysis to the express spectra from single patient, described patient includes 1b in and the 2a phase tests, and described test checks anti-IL20 antibody effect in RA patient.According to mainly (baseline) and the sample that obtained at the 8th, 15,29,36 and 43 days before administration, select to show in time relative stability the therefore suitable transcript as stratification mark before administration.

Also carry out the obtained microarray data point multivariant method associated with clinical efficacy.By using offset minimum binary (PLS) to infer potential structure, qualification is for predicting the best of breed of the transcript of clinical effectiveness at the single patient of accepting anti-IL20.PLS model through identifying is by the permutation tests (R of dependency between by observed data and predicted data ²-coefficient is down to 0.1 from 0.8) and be able to cross validation.This shows that PLS model is effective but not unaccommodated (over-fitted).(Like Simca-P+11 (Umetrics) or Unscrambler (CAMO software AS, Oslo, Norway) can carry out the prediction based on PLS to use any multivariate analysis Software tool.First use 18954 data points from AffyMetrix microarray, carry out multivariable prediction.The example of one group of 14 kinds of predictability transcript is shown in Fig. 2.

Target gene based in multivariable predictive model is Complement Factor D (CFD), also referred to as Adipsin.CFD transcript level in RA patient is shown in Fig. 3.Mrna expression level in single patient is in time and stable, but between patient, has notable difference.Having the patient of CFD mRNA of minimum level and the difference having between the patient of highest level is about 8 times.

As shown in Figure 1, in single argument regression analysis, CFD is also in the relevant transcript of the positive.Meanwhile, these discoveries impel the inspection to CFD availability in the RA-patient who gives anti-IL20 antibody as high response prediction thing.This completes by preparation recipient's operating characteristics (ROC) curve, sees Fig. 4 (ACR50 reaction) and Fig. 5 (ACR70 reaction).The area under curve (AUC) of finding ACR50 reaction is 0,81 (p=0,00068), the good predict of the ACR50 reaction of instruction based on CFD mRNA level.

In anti-IL20 RA-test, whether be the prediction thing of high reaction in order to test CFD mRNA, ACR50 reactor and nonresponder and ACR70 reactor and nonresponder have been defined to the threshold value of patient's optimal classification.Use comfortable the 1st day (before administration) and after administration the 15th and the average CFD-mRNA level of 4 samples that gathers for 36 days carry out such definition.As previously mentioned, in these access, find that CFD mRNA level is in time and stable.For ACR50 classification, find that CFD mRNA threshold value was 10.32 (the log2 scale of RMA standardized A ffyMetrix microarray level) (representing by X) in Fig. 4.

In the time using this threshold value (10.32 or more than) in the RA patient who is giving anti-IL20 antibody in 2a phase testing data, find that ACR50 reactivity is obviously increased to 65% (Fig. 7) from 37%.When using 10.32 or when above selected threshold value, the patient during the 2a phase of including in that comprises about half is tested.For ACR70 reaction, find that the threshold value 10.32 in the RA patient of administration is increased to 45% by reactivity from 25% equally.The improvement (enrichment) of the reactivity in the time using threshold value 10.32 is shown in Fig. 7.

In the individuality that gives placebo of testing in the 2a phase, CFD mRNA level be 10.32 or above patient's ACR50 reactivity be 17%, by contrast, CFD mRNA level is 11% lower than 10.32 reaction rate.For ACR70, CFD mRNA level be 10.32 or the above reaction rate that gives placebo be 8 %, by contrast, CFD mRNA level is 0% lower than 10.32 reaction rate.

Based on above analysis, conclusion is that CFD mRNA level is the good predict thing that the height for anti-IL-20 reacts in RA patient, if with only comprise that CFD mRNA level is 10.32 or when above RA patient, can obtain the especially obvious increase of ACR50 and ACR70 reaction.

Embodiment 2-qRT-PCR is associated with array data

Whether associatedly with the CFD mRNA level of the different time points of evaluating in next comfortable microarray analysis measure in order to detect alone CFD mRNA baseline (before administration), before available administration, on sample, CFD mRNA is carried out to qRT-PCR, and these are associated with the CFD level of the record from microarray.Carry out as described above quantitative RT-PCR analysis and obtain data from the replicate analysis of each cDNA sample.By the CFD mRNA level standardization from qRT-PCR platform to the 18S rRNA level also detecting by qRT-PCR.For microarray level is associated with qRT-PCR level, standardized RNA microarray level is transformed into linear-scale.As shown in Figure 6, find highly associated (R in the qRT-PCR of baseline mensuration with between from the microarray assays of some access ²=0,86).This shows that in the RA-patient's stratification based on CFD of baseline (before administration) be feasible, because Fig. 1 is not only associated with baseline sample through qualification with for example CFD of other predictability transcript described in Fig. 2, and associated with the some time point during the 2a phase tests, these are also selected to show stability (as pass through the dependency institute example of CFD in Fig. 6) in time.Therefore transcript as herein described is particularly suitable for the highly patient's of reaction the front predictability stratification of administration.

In order to obtain stratification based on qRT-PCR data (similar use microarray data threshold value 10.32 and obtain stratification), measure (ID:Hs00157263_m1) at CFD) in PCR product should detect circulating in (Ct-value) 26, should be at Ct=12 with the detection (assay Hs99999901_s1) of 18S rRNA, within 5 o'clock, obtain.These values are equivalent to according to about 10.25 in the RMA of microarray value scale who estimates from the sample of single patient, and wherein twice array detection approaches 10.32, average out to 10.24.Use qRT-PCR to measure, the detection of the CFD in this patient obtains by Ct-value 26, and the Ct value of 18S contrast is 12.5.

Also may measure by qRT-PCR the expression level of Complement Factor D (CFD), wherein using the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) of CFD and the Assay ID:Hs99999903_m1 (Applied Biosystems/ Invitrogen) of ACTB, is the absolute number of at least 0.04 CFD copy/beta-actin copy for the threshold value of the reaction improving.

the disease association of embodiment 3 – CFD mRNA level in PaxGene sample

For whether the CFD level of evaluating in RA patient's peripheral blood can be associated with the related activity mark in local joint, gather paired PaxGene (whole blood) and synovia sample.Complement Factor D is initial serine protease in alternative complement pathway activation, and the C3b of cutting and factor B complexing is C3bBb and Ba.C3bBb is C3 convertase, and it will cut other C3 molecule is C3a and C3b.Because Bb molecule is unique for alternative complement activation, Bb protein level is as the activity mark of this approach.Strong evidence support classics and alternative complement activation participate in the physiopathology of rheumatoid arthritis.

Prepare Bb plus EIA (MicroVue cat# A027) according to test kit scheme and measure (a kind of assay method of measuring the amount of complement fragment Bb in human plasma or serum).

Lavation buffer solution (x20) is diluted in deionized water.By 1% HBR1, (one is had a liking for the different closed reagent (HBR1) 18 that dyes, 42mg/ml, from Scantibodies Lab. Part 3KC533) join moisturizing reagent, and 1% HBR is joined to complement sample thinner (80 μ l HBR1+7,92ml).By the standard of reprovision with to impinging upon dilution standing 15min in 1ml moisturizing reagent/HBR1.((22 μ l+418 μ l) for 45 l) He 20 times of μ l+405 μ sample to be diluted in complement sample thinner+1% HBR1 to 10 times.

Hatch 30 min by sample pre-wash 3 times and with 100 μ l standards, wash 5 times, hatch 30 min with 50 μ l conjugates, wash 5 times, hatch 15 min with 100 μ l substrates, finally stop with 100 μ l stop buffers.

Measure absorbancy by ELISA reader, reader is arranged on to 450 nm (ref is at 600-690nm), use linearity curve matching.

By using MicroVue Bb Plus EIA to measure and HBR1, we can measure Bb level in RA patient's synovia.In the time that these levels are mapped for the CFD mRNA level in the paired PaxGene sample from same patient, find significant correlation, as shown in Figure 8.

This discovery proves, indicates the active state of the alternative complement pathway in local joint from the CFD mRNA level in RA patient's whole blood.

Because from the CFD mRNA level in RA patient's whole blood relevant to the active state of the alternative complement pathway in local joint (relevant between the Bb level in the CFD mRNA in PaxGene sample and in pairs synovia level), attracting is to infer from the CFD mRNA level in RA patient's PaxGene sample it may is also the prediction thing of the treatment of targeting complement activation.

Embodiment 4 – use the analysis of single nucleotide polymorphism (SNP)

As the alternative method that detects the CFD mRNA level in PaxGene sample, can provide the facilitated method of pre-measured reaction to the analysis of some single nucleotide polymorphism (SNP) in CFD monoploid piece.The bimodal distribution of CFD mRNA in PaxGene and other sample clearly shows that genetic polymorphism may be the basis explanation of CFD mrna expression pattern.Those skilled in the art can express quantative attribute locus (eQTL) analysis to CFD, and identify the dependency of SNP and CFD expression level or associated.The example of the strong relevant SNP of CFD mrna expression level in the monoploid piece of demonstration and CFD and contiguous gene thereof has identity rs1683565.Can carry out by multiple different methods the mensuration of other SNP of this SNP or demonstration and the strong linkage disequilibrium of rs1683565, described method includes but not limited to, for example, for example, based on method (SNP microarray) and the method based on enzyme (PCR and restriction fragment length polymorphism method) of hybridization.Show SNP:rs1683591, the rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and the rs2930898 that include but not limited to have following identity with other SNP of the strong linkage disequilibrium of rs1683565.

As an example, SNP rs1683591 provides AA, AG or GG genotype.Associated based on what express with CFD, AA genotype is expressed (having relatively low reactivity) corresponding to low CFD, and AG and GG genotype are expressed and therefore the reaction of antiphlogiston had to high possibility corresponding to higher levels of CFD.

Can be by the method for many abundant descriptions, detect above-mentioned SNP, their combination or other SNP of demonstration and the strong linkage disequilibrium of described SNP (rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898), described method includes but not limited to method (for example SNP microarray) and the method based on enzyme (for example PCR and restriction fragment length polymorphism method) based on hybridization.

In an example, from patient, gather blood sample, and according to manufacturer specification, by reagent D NAzol (Becton Dickinson) isolation of genomic DNA.In brief, by vortex or manual mixing, 1 ml DNAzol is mixed with 0.5 ml whole blood.By 0.4 ml Virahol is joined in DNAzol BD-blood lysate, from sample, precipitate DNA.At room temperature deposit 5 min by gained mixture vortex and by it.By getting off centrifugal the DNA of precipitation at centrifugal 6 min of 6,000 × g.Remove supernatant liquor and 0.5 ml DNAzol is joined in DNA throw out.Vortex or jolting DNA throw out, until dissolve completely.By gained mixture at centrifugal 5 min of 6,000 × g.Then, remove supernatant liquor and by mixing and wash DNA throw out with 1 ml 75% ethanol, then at centrifugal 5 min of 6,000 × g.Remove ethanol, without dry, in DNA throw out, add 200 μ l 8 mM NaOH and pass through at room temperature incubation 3-5 min, then vortex concussion, dissolves DNA.Alkaline DNA solution is neutralized with 0.1 M HEPES.From the DNA separating, preparation has the quantitative polyase chain reaction (qPCR) of the required SNP of specific assay.QPCR arranges can be according to the TaqMan probe through being designed for the required SNP of specific detection.As an example, will have the SNP of identity rs1683565 by any probe and/or the incompatible detection of primer sets, described combination can be distinguished following sequence: AGAGCCCAAAGCTCATGGAAAAGAG[A/G] ATATGAAAGGAGTCCCTGCAGTAGA.This can be undertaken by the commercially available mensuration from Invitrogen (catalog number (Cat.No.): 4351379 ID:C___9612061_10).In another example, will have the SNP of identity rs1683591 by any probe and/or the incompatible detection of primer sets, described combination can be distinguished following sequence: TCTGTCCACAGGCGGGGGTGGAGGG[A/G] ATGGCCGGCCTCACACCATCTGCCA.This can be undertaken by the commercially available mensuration from Invitrogen (catalog number (Cat.No.): 4351379 ID:C___9612100_10).In the 3rd example, will there is the SNP of identity rs1683590 by any probe and/or the incompatible detection of primer sets, described combination can be distinguished following sequence: AATATCTGAAATTTTCCCAGTTTAC[A/G] AGCCTCTGACGTAACCGTCCTCTCT.This can be undertaken by the commercially available mensuration from Invitrogen (catalog number (Cat.No.) 4351379 ID:C___3153459_10).Measure for TaqMan gene type, you must add the DNA profiling that is equivalent to 1-10 ng in each reacting hole.For quantitative assay genomic dna, use for example A260 of reliable method to measure.As described in manufacturers, thoroughly mix TaqMan GTXpress Master Mix (Invitrogen (catalog number (Cat.No.) 4403311)) by rotation bottle and mix with TaqMan gene type mensuration and genomic dna template.For example, at compatible PCR instrument (ABI PRISM 7900HT sequence detection system, there is FAST assembly) in carry out PCR reach 40 circulations (first 95 DEG C 20 seconds, then 40 circulations and primer annealing and 60 DEG C extend 20 seconds, then 95 DEG C of sex change 3 seconds.After pcr amplification, you carry out terminal and read plate in PCR in real time.Use the SDS software from Invitrogen, the fluorometric assay from each hole of carrying out during plate is read in its use, then signal value is mapped.Described software determines which allelotrope is in the sample of each hole, for allelotrope compartment analysis subsequently.

Claims (16)

1. the method for the reaction of prediction patient to antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described patient, wherein the expression of one or more described genes changes compared with the reference level of described gene, predicts the reaction of described patient to described antiphlogiston.

2. the method for the reaction of prediction patient to antiphlogiston, comprising:

A. in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1, and

B. by the reference level comparison of described level and described gene,

Wherein the expression of one or more described genes changes compared with described reference level, predicts the reaction of described patient to described antiphlogiston.

3. qualification has the experimenter's of the possibility of increase method to the reaction of antiphlogiston, comprise: the information that obtains the expression level of one or more genes of Fig. 1 in the biological sample from described experimenter, wherein the expression of one or more described genes changes compared with the reference level of described gene, shows to have identified the experimenter reaction of antiphlogiston to the possibility of increase.

4. qualification has the patient's of the possibility of increase method to the reaction of antiphlogiston, comprising:

A. in the biological sample from described patient, detect the expression level of one or more genes of Fig. 1

B. by the reference level comparison of described level and described gene,

Wherein the expression of one or more described genes changes compared with the reference level of described gene, shows to have identified the patient reaction of antiphlogiston to the possibility of increase.

5. the method for any one in aforementioned claim,

A. wherein compared with reference level, the expression of the change of the gene of Figure 1A increases, and/or

B. wherein compared with reference level, the expression of the change of the gene of Figure 1B reduces.

6. the method for any one in aforementioned claim, is wherein used PCR, and for example multiplex PCR or qRT-PCR, or micro-array chip, based on mRNA, detect described expression level in blood sample.

7. the method for any one in aforementioned claim, wherein the expression level of Complement Factor D (CFD) is higher than reference level.

8. the method for any one in aforementioned claim,

A. wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use Assay ID:Hs00157263_m1 (Applied Biosystems) detection transcript to there is cycle threshold (Ct) 30, or

B. the expression level and the wherein said expression level that wherein use micro-array chip to measure Complement Factor D (CFD) exceed 9.5 in the log2 scale of RMA or GC-RMA normalized expression value, or

C. wherein measure the expression level of Complement Factor D (CFD) by qRT-PCR and wherein use the Assay ID:Hs00157263_m1 (Applied Biosystems/ Invitrogen) for CFD, the absolute number that detects transcript is at least 0.04 CFD copy/beta-actin mRNA copy, or

D. wherein express the expression level of relevant SNP indirect measurement Complement Factor D (CFD) according to one or more CFD.

9. in patient, treat the method for inflammatory diseases or illness, comprise and give described patient by the antiphlogiston of therapeutic dose, wherein, before giving described antiphlogiston, in claim 1-8, at least one test of any one has shown in the biological sample from described patient, compared with reference level, the expression level of one or more genes of Fig. 1 is changed; Wherein the expression level of one or more described genes changes compared with the reference level of described gene, predicts the reaction of described patient to described antiphlogiston.

10. the method for any one in aforementioned claim, wherein said experimenter or patient suffer from autoimmune disease or illness, for example rheumatoid arthritis (RA), systemic lupus erythematous (SLE), multiple sclerosis (MS), inflammatory bowel (IBD), psoriasis arthropathica (PSA) or psoriatic.

The method of any one in 11. aforementioned claims, wherein said antiphlogiston is one or more the antagonist in IL-19, IL-20 and IL-24.

The method of any one in 12. aforementioned claims, wherein said antiphlogiston is anti-human IL-20 antibody.

The antiphlogiston of 13. treatment autoimmune diseases or illnesss, wherein, compared with the reference level of one or more genes of Fig. 1, the expression that patient has one or more genes of Fig. 1 changes.

14. goods, comprise pharmaceutical composition packaging together and label, described pharmaceutical composition comprises antiphlogiston and pharmaceutically acceptable carrier, and described label illustrates that described pharmaceutical composition can be used for the patient that treatment suffers from autoimmune disease or illness and has the expression change of one or more genes of Fig. 1.

15. test kits, comprising:

A. comprise one or more compositions of at least one detection reagent, described detection reagent is used for the expression level of one or more genes of measuring table 1A and/or table 1B, and

B. how that expression level is associated with experimenter's reaction possibility the working instructions of described test kit, comprise.

The test kit of 16. claims 15, wherein said detection reagent is used for measuring the expression of Complement Factor D (CFD).