KR20140124767A - Methods related to treatment of inflammatory diseases and disorders - Google Patents

Abstract

The present invention relates to a genetic marker associated with a method for predicting a clinical response to anti-inflammatory treatment in a patient suffering from an inflammatory disease or disorder.

Description

METHODS RELATED TO TREATMENT OF INFLAMMATORY DISEASES AND DISORDERS [0002]

The present invention is directed to methods within the field of diagnosis, prognosis, and treatment optimization of inflammatory diseases and disorders aimed at improving therapeutic options and diets for patients by providing a method for predicting responsiveness to a therapeutic agent.

Inflammatory diseases and disorders, and specifically autoimmune diseases, have a profound effect on the patient's well-being and treatment options are unsatisfactory for many patients. Rheumatoid arthritis (RA) is clinically important, and chronic systemic autoimmune RA is an autoimmune disorder in which the cause of the disease is unknown. Most RA patients suffer from the chronic course of the disease, which is currently receiving treatment but may cause progressive joint destruction, deformity, disability and even premature death. Diagnosis of RA typically relies on clinical and experimental evaluation of the patient's symptoms and symptoms. In general, an empirical evaluation of a patient suspected of having RA may include determination of antibody levels against certain antibodies and cyclic citrullinated peptides (anti-CCP) in sera known as rheumatoid factor (RF) . While these antibodies are often found in serum from RA patients, not all RA patients have them. Additional blood tests known as erythrocyte sedimentation rate (ESR) may also be used. Elevated ESR indicates a general presence of the inflammatory process, but is not necessarily RA. Additional blood tests may be used to assess the level of other factors, such as C-reactive protein (CRP) associated with RA. Radiographic analysis of the affected joint may also be performed. In short, these currently available experimental tests for diagnosing RA are inaccurate and incomplete.

The American College of Rheumatology (ACR) criteria are often used to determine diagnosis and severity (http://www.rheumatology.org).

Attempts have been made to improve diagnosis and prognosis based on biomarkers (eg, Rioja et al., Arthritis and Rheum. 58 (8): 2257-2267 (2008); Pyrpasopoulou et al, Mol. Diagn. Ther. 14 (1): 43-48 (2010), WO 2004/0009479, WO 2007/0105133, WO 2007/038501, WO 2007/135568, WO 2008/104608, WO 2008 / 056198; WO 2008/132176; and WO 2008/154423). Recently, a method of identifying a patient population has been provided that demonstrates a higher reactivity for anti-CD20 therapies based on partial aggregation of RA patients and specific molecular profiles (WO2011028945). However, clinically validated diagnoses or prognoses that enable clinicians or others to accurately define the pathophysiological pattern of rheumatoid arthritis, clinical activity, response to treatment, prognosis, or risk of disease The marker was not identified.

Thus, as RA patients seek treatment, there are many trial and error involved in searching for the therapeutic agent (s) available for a particular patient. This trial and error often involves many risks and uncomfortable patients to find the most effective treatment. Thus, there is a need for more effective means to determine which patients will respond to which treatment and to incorporate these determinants into more effective therapies for RA patients.

Therefore, it would be desirable to objectively identify the presence of the disease in the patient and to determine the presence of the disease in a patient with a response to treatment, prognosis, and / or rheumatoid arthritis, including pathophysiological aspects of rheumatoid arthritis, clinical activity, It would be highly advantageous to have an additional way to define the risks involved.

Thus, there is a continuing need to identify new molecular diagnostic or prognostic markers associated with rheumatoid arthritis, as well as autoimmune disorders.

As described herein, the inventors provide many methods useful for improving the treatment of inflammatory diseases or disorders, autoimmune diseases and specifically RA.

An aspect of the invention is directed to a method of predicting the response of a subject to an anti-inflammatory agent, comprising obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient, The altered expression of one or more of the gene (s) in comparison to the reference level of the gene (s) predicts the response of the subject to the anti-inflammatory agent.

In a further aspect of the present invention,

a) measuring the expression of one or more gene (s) of Figure 1 in a biological sample of said patient, and

b) comparing said level to a reference level of said gene (s), wherein said one or more of said gene (s) is / are compared to said reference level, These altered expressions predict patient response to anti-inflammatory agents.

The present invention further describes a method for identifying an increased likelihood of response to an anti-inflammatory agent, comprising obtaining information about the level of expression of one or more genes of Figure 1 in a biological sample of said antibody , The altered expression of one or more of the gene (s) in comparison to the reference level of the gene (s) indicates that the subject with increased likelihood of response to the anti-inflammatory agent has been identified.

In an embodiment,

a. Measuring the level of expression of one or more gene (s) of Figure 1 in the patient ' s biological sample

b. And comparing said level to a reference level of said gene (s), said method comprising the steps of:

The altered expression of one or more of the gene (s) compared to the reference level of the gene (s) indicates that the patient with increased likelihood of response to anti-inflammatory agents has been identified.

The methods of the invention may also relate to situations where the altered expression is increased expression of the gene of Figure 1A relative to the reference level and / or the reduced expression is a reduced expression of the gene of Figure 1B relative to the reference level.

The method further explains that the level of expression may be determined in mRNA-based blood samples using qRT-PCR or using microarray chips. In certain embodiments of the invention, the level of expression of complement factor D (CFD) is determined and found to be higher than the reference level, which may be defined differently depending on the method applied to the detection of said transcript.

An aspect of the invention relates to an anti-inflammatory agent for the treatment of an autoimmune disease or disorder, wherein the patient has one or more altered expression of the gene of Figure 1 compared to the reference level of the gene (s).

A further aspect of the present invention relates to a method of treating a subject suffering from an inflammatory disease or to the case where the level of expression of one or more of the genes of Figure 1 is altered relative to a reference level and wherein a therapeutic amount of an anti- .

The method may further comprise the step of considering whether the expression level (s) of one or more of the genes of Figure 1 in said patient is altered relative to a reference level.

Aspects of the present invention

a. Measuring the level of expression of one or more gene (s) of Figure 1 in the patient ' s biological sample

b. Comparing the level to a reference level of the gene,

c. Determining if the expression level of one or more of the genes of Figure 1 is inverted relative to the reference level,

d. The method comprising administering to the patient a therapeutically effective amount of an anti-inflammatory agent.

In some cases, the information about gene expression is used to determine if the anti-inflammatory agent is actually administered to the patient and thus the method described above includes an evaluation of the expression data, for example, the expression of one or more of the genes of Figure 1 It will be concluded that the level is changed in comparison with the reference level in the biological sample. It is considered appropriate to consider whether the expression levels of one or more gene (s) in Table 1A are increased relative to the reference level and / or the expression level of one or more gene (s) in Table 1B is reduced relative to the reference level.

In a further aspect, the invention provides a pharmaceutical composition and pharmaceutical composition comprising an anti-inflammatory agent and a pharmaceutically acceptable carrier, together packaged, wherein the patient suffering from an autoimmune disease or disorder is one or more of the genes of Table 1 RTI ID = 0.0 > expression, < / RTI >

Aspects of the present invention

a) one or more compositions comprising at least one detection reagent to determine the level of expression of one or more gene (s) of Table 1A and / or Table 1B; and

and b) the expression level (s) is associated with the likelihood of response of the subject.

Based on this data, improved treatment can be offered to the patient and the effects of trial and error can be minimized. It will be apparent to those skilled in the art that the present invention may be practiced with certain modifications besides the specific examples herein.

Sequence List

The present application includes a sequence listing comprising the following sequences.

SEQ ID NO 1: CFD mRNA probe: CCTGCTGCTACAGCTGTCGGAGAAG

SEQ ID NO 2: 18S rRNA regulatory probe: TGGAGGGCAAGTCTGGTGCCAGCAG

SEQ ID NO 3: rs1683565:

AGAGCCCAAAGCTCATGGAAAAGAGXATATAAAGGAGTCCCTGCAGTAGA

Where X in position 26 is A or G

SEQ ID NO 4: rs1683591:

TCTGTCCACAGGCGGGGGTGGAGGGXATGGCCGGCCTCACACCATCTGCCA

Where X in position 26 is A or G.

SEQ ID NO 5: rs1683590:

AATATCTGAAATTTCCCAGTTTACXAGCCTCTGACGTAACCGTCCTCTCT

Where X in position 26 is A or G.

SEQ ID NO 6: ACTB probe:

CCTTTGCCGATCCGCCGCCCGTCCA

Figure 1 shows a list of transcripts positively associated with the Disease Activity Score of the 28 joint-C-reactive protein (DAS28-CRP) change (week 8) in the anti-IL20 RA test (Table 1A) List of transcripts (Table 1B). Transcripts showing significant associations (False Discovery Rate (FDR) = 5%) in the treated patients (except for the placebo control) are included in the list (with the most significant association at the top of each list Ranked in order). The genes listed in Table 1A have been found to be suitable for use in the methods of the invention where relatively high levels of expression are desirable. The genes listed in Table 1B were found to be suitable for use in the methods of the invention where relatively low levels of expression are desirable.
Figure 2 shows Table 2 which includes the selection of genes from Table 1A and Table IB considered appropriate for use in the methods of the present invention and specifically in methods of applying multivariate analysis. The selected transcript / gene is suitable for multivariate-based prediction of DAS28-CRP.
Figure 3 shows the transcription level distribution of CFD (complement factor D) transcripts in PaxGene whole blood samples of RA-patients in the anti-IL20 test. Robust Multichip Average (RMA) Standardized values appear on the Y-axis (log2 scale). Individual patient samples are presented in cross-hued (black or white) and individual patients are randomly numbered 1-82.
Figure 4 shows the Receiver Operating Characteristic (ROC) curve for the CFD mRNA and the American College of Rheumatology 50% synthetic criteria (ACR50) response in the Phase-2a-IL20 test. The threshold value (RMA normalized expression value) of 10.32 is indicated by X on the ROC curve.
Figure 5 shows the ROC curve of the CFD mRNA and the American College of Rheumatology 70% synthetic criteria (ACR70) response in the Phase-2a-IL20 test.
Figure 6 shows the association of microarray-based detection of quantitative RT-PCR (qRT-PCR) detection of CFD mRNA in pre-dose (day 1) samples at more points in time. On a linear scale, the microarray signal (reverse transformed RMA data (Y-axis)) is compared to the 18S standardized CFD level of the qRT-PCR assay.
Figure 7 shows the ACR20, ACR50 and ACR70 response rates with two alternating thresholds of CFD-based stratification in the anti-IL20 step-2a test (clinicaltrials.gov identifier NCT01282255). When a stratification of the patient based on the CFD mRNA level from the ROC curve of Figure 4 is applied (e.g., a threshold value (RMA normalized expression value) greater than 10.32 is used), a high response patient population is obtained Bottom). The upper part of chart A shows the response when only individuals with threshold values lower than the CFD level are included. Similar abundance is obtained in response patients (bottom of Chart B) when applying an alternating threshold for CFD (based on a complete quantification of CFD and beta actin (ACTB)).
Figure 8 shows the levels of Bb in the joint cyst fluid of patients with RA showing high or low CFD expression levels in the PaXGene sample as assessed by qPCR.

The present invention relates to methods for predicting the therapeutic effect of an anti-inflammatory compound. Currently available therapies, as described in the Background section, have a low success rate, at least to some extent, and treatment often involves some trial and error. The present invention provides a method for identifying a subset of patients with a high treatment success rate that avoids the inconvenience associated with the difficulty of finding a plurality of patients at risk and effective treatment.

Justice

For purposes of understanding the present application, the following definitions may be used unless otherwise stated herein.

The term "polynucleotide" or "nucleic acid ", as used interchangeably herein, refers to a polymer of a certain length of nucleotide and includes DNA and RNA. Nucleotides can be any substrate that can be integrated into a polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or analogs thereof, or DNA or RNA polymerases. Polynucleotides may also include modified nucleotides, such as methylated nucleotides and analogs thereof. If present, modifications to the nucleotide structure may be delivered before or after assembly of the polymer. The sequence of the nucleotide may be interrupted by a non-nucleotide component. Polynucleotides may be further modified after polymerisation, e. G., By conjugation with label elements and other types of modifications known in the art.

The term "oligonucleotide" as used herein refers to short, single-stranded polynucleotides, which are nucleotides of at least about seven nucleotides in length to less than about 250 nucleotides in length. Oligonucleotides may also be synthesized. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and completely applicable to oligonucleotides.

The term "primer" refers to a single-stranded polynucleotide capable of permitting polymerisation of a complementary nucleic acid by hybridizing to a nucleic acid, usually by providing a 3 ' -OH group.

The term " array "or" microarray "refers to a sequential arrangement of array elements, preferably polynucleotide probes (e.g., oligonucleotides) capable of hybridization on a substrate. The substrate may be a solid substrate, such as a glass slide, or a semi-solid substrate, such as a nitrocellulose membrane.

The term "amplification" refers to the process of producing a copy of at least one of the reference nucleic acid sequence or its complement. Amplification may be linear or exponential (e. G., PCR). "Copy" does not necessarily mean perfect sequence complementarity or identity with respect to template sequences. For example, the copy may be a nucleotide analogue such as deoxyinosine, an intentional sequence change (e. G., A sequence change introduced through a primer that is hybridizable to the template but not completely complementary thereto), and / Or sequence errors that occur during amplification.

The term "multiplex-PCR" refers to a single PCR reaction performed in a nucleic acid obtained from a single sample (e.g., one patient) using one or more sets of primers for the purpose of amplifying two or more DNA sequences in a single reaction .

The "stringency" of the hybridization reaction can be readily determined by those skilled in the art, usually empirical calculations dependent on probe length, wash temperature, and salt concentration. Generally, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization is usually dependent on the ability to re-anneal the denatured DNA when complementary strands are present in an environment below their melting point. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature. As a result, higher relative temperatures tend to make reaction conditions more stringent, while lower temperatures make them less stringent. For further details and description of the rigidity of the hybridization reaction, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

(1) those that use low ionic strength and high temperature for washing, for example, 0.015 M sodium chloride / 0.0015 M citric acid at 50 < 0 > C, Sodium / 0.1 percent sodium dodecyl sulfate; (2) those using a denaturant such as formamide during hybridization, such as 750 mM sodium chloride at 42 ° C, 0.1% bovine serum albumin at pH 6.5 along with 75 mM sodium citrate / 0.1% Ficoll / 0.1% 50% (v / v) formamide containing polyvinylpyrrolidone / 5 OmM sodium phosphate buffer; Or (3) 0.2 x SSC (Sodium Chloride / sodium citrate) for 10 minutes at 42 ° C followed by a 10% SSC containing 0.1 x SSC at 55 ° C for 10 minutes, x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 percent sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA ), 0.1 percent SDS, and 10 percent dextran sulfate.

"Moderate stringency conditions" can be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989 and include use of wash solutions and less stringent And one hybridization condition (e.g., temperature, ionic strength, and percent SDS). Examples of moderately stringent conditions include, but are not limited to, 20 percent formamide at 37 degrees Celsius, 5 x SSC (150 mM NaCl, 15 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10 percent dextran sulphate , And 20 mg / ml denatured sheared salmon sperm DNA, followed by washing the filters at 1 x SSC at about 37-50 < 0 > C. Those skilled in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length and the like.

The term "detection" includes any detection means, including direct and indirect detection.

The term " level of expression "or" expression level "is used interchangeably and refers to the amount of a polynucleotide or amino acid product or protein in a biological sample. "Expression" generally refers to the process by which gene-encoded information is converted into a structure that is present and functioning in the cell. Thus, as used herein, "expression" of a gene may represent transcription into a polynucleotide, translation of a protein, or even a post-translational modification of the protein. The fragments of the transcribed polynucleotide, translated protein, or post-translationally modified protein can also be used as a template for transcription of the transcribed polynucleotide, translated protein, or post-translationally modified protein from the transcripts or degraded transcripts produced by alternative splicing, Lt; RTI ID = 0.0 > of < / RTI > "Expressed gene" also includes mRNAs that are transcribed into polynucleotides and then translated into proteins, and those that are transcribed into RNA but not translated into protein (e. G., Translation and ribosomal RNA).

The term "expression profile" can be used to define the level of expression of a group of genes that provide a more composite picture of transcriptional activity in a sample.

The term "biomarker" refers to an indicator of the condition of a patient as used herein; Thus, the biomarker may be useful in assessing the disease status of a patient, including diagnoses, and in evaluating the response of an individual to treatment. A biomarker is a molecular entity, which can be detected in a biological sample of a patient. Biomarkers include but are not limited to DNA, RNA, proteins, carbohydrates, and other biochemical substances or moieties, including combinations thereof, such as glycolipids or glycoprotein-based molecular markers. "Diagnostic marker" and "prognostic marker" refer to a biomarker " marker " that indicates that the presence or absence or level of a molecular entity can provide information about diagnosis and / or prognosis, "Specification. Some biomarkers may be suitable for diagnosis and some are suitable for subsequent disease development and therapeutic response, while others are suitable for predicting clinical response to treatment.

The "amount" or "level" of a "diagnostic marker" associated with an increased clinical benefit to a patient is a detectable level in the patient's biological sample. Expression levels can be measured by methods known to those skilled in the art and may be described herein. The level or amount of expression of the evaluated biomarker can be used to determine or predict the response of the treatment.

The term " altered expression "refers to an increased or decreased expression level of a gene, usually measured at the level of mRNA or protein. Expression levels are considered to be altered relative to the reference level, for example, the level of expression is "higher" or "lower" than a predetermined appropriate level. The altered expression level of a gene may also indicate a "high" or "low" gene expression compared to other genes and / or relative to the level of expression of another individual.

The term "increased expression" or "increased level" refers to an increased or increased expression level of the gene and is usually measured at the mRNA or protein level. Expression levels are considered to be increased relative to the reference level, for example, the level of expression is "higher" than the appropriate predetermined level. The increased expression level of a gene refers to a gene that is expressed at a "high" level in an individual relative to other genes and / or relative to the level of expression of another individual.

The term " reduced expression "or" reduced level "refers to reduced or decreased expression levels of the gene and is usually measured at the mRNA or protein level. Expression levels are considered to be reduced relative to the reference level, e.g., the level of expression is "lower" than the appropriate predetermined level. A reduced level of expression of a gene refers to a gene that is expressed at a "lower" level in an individual relative to other genes and / or relative to the level of expression of another individual.

The term "rheumatoid factor, " or" RF "refers to an IgM, IgG, or IgA isotype of an antibody that has been detected in the patient's serum and has received an antigenic determinant present in human and animal IgGs, either singly or in any combination .

The term "positive for RF" refers to the result of an assay for RF, for example, an ELISA assay, and the result is a threshold or cut for the assay for samples considered to contain a detectable level of RF proliferatively - higher than the cut-off.

The term "voice for RF" refers to the result of an assay for RF, e.g., an ELISA assay, and the result is a threshold or cut for the assay for a sample considered to proliferably contain an undetectable level of RF - Higher than off.

The term "sample" or "biological sample" refers to a composition obtained or derived from a preferred subject containing one or more molecular entities that are detected, measured or identified as used herein. For example, Patient sample ", "subject sample ", and variants thereof, refer to any sample obtained from a patient or a preferred subject that is expected or known to contain a characterized cellular and / or molecular entity, But are not limited to, samples.

The term "tissue sample" or "cell sample" or "blood sample" means a sample comprising one or more cells obtained from a subject. The source of the tissue or cell sample may be a fresh, frozen or preserved organ or tissue sample or a solid tissue of a living tissue or aspirate; Cerebrospinal fluid, amniotic fluid, peritoneal fluid, interstitial fluid, or body fluid such as blood or any blood component. The tissue sample or cell sample may also be a primary cell or a cultured cell or cell. Alternatively, the tissue or cell sample is obtained from a diseased tissue / organ (e.g. demonstrating pathological characteristics). Tissue samples contain compounds that do not naturally mix with natural tissue, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics,

The term "serum sample" refers to any serum sample obtained from an individual. Methods for obtaining sera of mammals are well known in the art.

&Quot; Control sample ", "control cell ", or" control tissue ", as used herein, are intended to refer to a sample Refers to a biological sample, cell, or tissue that does not. In one embodiment, a control sample, a control cell, or a control tissue is obtained from an apparently unaffected portion of a patient's body in which the same subject or disease or disorder is being identified using the compositions or methods of the present invention. In one embodiment, the control sample, control cell, or control tissue is obtained from a portion of an individual's body that is not a subject or patient being identified using the composition or method of the invention.

The term "diagnosis" is used herein to indicate identification or classification of a molecular or pathological condition, disease, or disease. For example, "diagnosis" may refer to the identification of specific types of inflammatory diseases or disorders or specific autoimmune diseases such as RA.

The terms "predictive "," predictive ", or variations thereof are used to indicate the likelihood that a patient will respond to a drug or set of drugs, preferably or undesirably. In one embodiment, the prediction relates to the degree of the reactions. In one embodiment, the prediction relates to the probability that the patient will improve treatment for the next treatment, for example, for a particular treatment, and for a particular period of time without recurrence of the disease. The predictive methods of the present invention can be used to clinically determine treatment by selecting an appropriate treatment format for a particular patient. The predictive method of the present invention is a useful tool in determining whether a patient is more likely to respond favorably to a therapeutic regimen, such as a particular therapeutic regimen, including, for example, administration of a particular medicament or therapeutic agent or combination thereof.

The term "indication "," indicating ", or variations thereof, is used to denote the resulting instructions, wherein an "indication" based on the altered expression level of the gene described herein means that the subject or patient responds to anti- This is because it provides information that there is a high possibility. Based on these guidelines, the methods of the present invention can be used to clinically determine treatment by selecting an appropriate treatment regimen for any particular patient.

As described herein, "treatment" refers to clinical intervention to alter the natural course of an individual being treated, and may be performed before or during the course of clinical pathology. The desired effect of the treatment may be in the prevention or alleviation of the onset or recurrence of the disease or disease, the alleviation of the symptoms of the disease or disorder, the reduction of any direct or indirect pathological consequences of the disease, the reduction of the disease progression rate, Or alleviation and / or progression or improved prognosis. In some embodiments, the methods and compositions are useful for delaying the development of a disease or disorder.

"Effective amount" refers to an effective amount, to achieve the desired therapeutic or prophylactic result, to the required dosage amount and for the required period of time. A "therapeutically effective amount" of a therapeutic agent may vary depending on factors such as the individual's disease state, age, sex, and weight, and the ability of the antibody to elicit the desired response in the individual. A therapeutically effective amount is also one in which any toxic or deleterious effect of the therapeutic agent is counteracted by a therapeutically beneficial effect. A "prophylactically effective amount" refers to an amount effective to achieve the desired prophylactic outcome, for the required dosage amount and for the required period of time. Typically, a prophylactically effective dose will be less than a therapeutically effective dose, since, although not necessarily, the prophylactic dose is used before the disease or at an early stage of the disease.

The term "individual "," subject ", or "patient ", as used herein, may be used interchangeably and usually refers to a vertebrate animal. In certain embodiments, the vertebrate animal is a mammal. Mammals include, but are not limited to, primates (human and non-human primates, etc.) and rodents (e.g., mice and rats). In certain embodiments, the mammal is a human. The term "patient" further indicates that the subject is not a healthy subject. In one embodiment, "patient" is an individual diagnosed with or suffering from an indication (s) or symptom (s) associated with an inflammatory disease or disorder. In one embodiment, "patient" suffers from an autoimmune disease or disorder, such as RA.

A "control subject" refers to a healthy subject not being diagnosed with and / or suffering from any symptom or symptom associated with an apparently inflammatory disease or disorder.

"Associated" or "associated" means comparing the performance and / or outcome of the first analysis or protocol with the performance and / or outcome of the second analysis or protocol in any manner. For example, the results of the first analysis or protocol may be used to perform the second protocol and / or the results of the first analysis or protocol may be used to determine whether a second analysis or protocol should be performed. With respect to embodiments of gene expression analysis or protocols, the results of gene expression assays or protocols may be used to determine whether a particular therapeutic regimen should be performed.

The term "patient response" or "response" can be assessed using any endpoint that represents a benefit to the patient, including a) inhibition of disease progression, b) reduction in the number of disease episodes and / D) inhibition of disease cell invasion into adjacent peripheral organs and / or tissues, e) inhibition of disease spread, f) reduction of autoimmune reactions which may cause regression or resection of disease lesions, ) Of the degree of one or more symptoms associated with the disorder, h) the post-treatment disease is an increase in the length of the period, and / or i) a reduced mortality rate during a particular period after treatment . For purposes of patient response, inhibition refers to cover, decrease, slowing or complete inhibition or appropriate symptom (s).

The expression "does not respond" relates to their response to one or more of the drugs previously administered to the subject or patient, wherein upon administration of such drug (s), they are treated, clinically unacceptably high Or exhibit no or sufficient indication of a disorder that does not maintain the indication of treatment after the first administration of such drug (s), and is used in this context as defined herein have. The phrase "unresponsive" includes a description of the objects that are resistant and / or resistant to the previously administered drug (s), and the subject or patient has progressed while receiving the drug (s) (E.g., within six months) of the completion of therapy involving the subject or patient with the medicament (s) for which he or she no longer responds. Thus, non-responsiveness to one or more medicaments includes subjects that continue to have active disease even after prior or current related treatments. For example, a patient may have active disease activity after treatment of about one to three months with the non-reactive drug (s). This reactivity may be assessed by a skilled clinician in the treatment of the disorder in question. For purposes of non-responsiveness to the medicinal product (s), a subject who has exhibited a clinically unacceptably high level of toxicity from a previous or current treatment with one or more medicaments "may, for example, But are not limited to, congestive heart failure, demyelination (leading to multiple sclerosis), significant hypersensitivity, neuropathologic events, high degree of autoimmunity, endometrial cancer, Cancer, such as non-Hodgkin's lymphoma, breast cancer, prostate cancer, lung cancer, ovarian cancer, or melanoma, tuberculosis; TB), < / RTI > and the like, or one or more adverse side effects associated therewith that are deemed serious by a skilled clinician.

The term "insufficient response" or "insufficient response" is used to describe a patient who has experienced an unsatisfactory effect of a particular treatment. This may be characterized by low therapeutic effect and / or by actual side effects. Criteria are considered equivalent to non-responsiveness. The term "insufficient response" is used with respect to a therapeutic agent for which a specific response is expected or intended based on previous tests. If a "sufficient response" is not obtained after a certain period of time, treatment is usually discontinued and the patient is considered an "insufficient respondent. It may also be that the patient continues to treat, but continues in combination with further treatment to improve the response to the treatment.

The term "sufficient response" is used to describe the therapeutic effect of a patient when anticipation of therapeutic efficacy is realized.

A "medicament" is an active drug for treating a disease, disorder, and / or disease. In one embodiment, the disease, disorder, and / or disease is RA or its symptoms or side effects.

An "anti-inflammatory agent" is a compound, medicament or drug, which is expected to reduce or reduce the symptoms (s) of an inflammatory reaction or inflammatory disease or disorder.

&Quot; RA therapeutic agent ", "effective therapeutic agent for treating RA ", and grammatical variations thereof, when provided in an effective amount, as described herein, are known to provide a therapeutic response in a subject afflicted with RA, Or represents a medicament expected by the clinician.

"Antagonist" refers to a molecule that is capable of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the activity of a particular or specified protein, including binding to one or more receptors in the case of a ligand or binding to one or more ligands in the case of a receptor do. An antagonist can be an antibody and its antibody-binding fragments, proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, oligosaccharides, bioorganic molecules, peptidomimetics, pharmacologic agents and their metabolites, Regulatory sequences, and the like. Antagonists can also be used to inhibit proteins, and low molecular inhibitors of fusion proteins, receptor molecules and derivatives that specifically bind to proteins to isolate binding to the target, antagonist modifications of proteins, protein-related antisense molecules, RNA aptamers ), And ribozymes for proteins.

details

The inventors of the present invention have found that patients with a high likelihood of successful treatment can be identified based on the examination of the expression profile of a particular gene. The present invention is based on data obtained as described in the embodiments. Patients in accordance with the present invention are typically suffering from an inflammatory disease or disorder, and specifically an autoimmune disease or disorder. Based on the data obtained, information can be used in a variety of ways, since patients with improved likelihood of response to therapy can be selected.

One aspect of the invention is directed to a method for predicting the response of a subject to an anti-inflammatory agent, comprising obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject , The altered expression of one or more of the gene (s) in comparison to the reference level of the gene (s) predicts the response of the subject to the anti-inflammatory agent.

Other expressions may be used to describe the context in which to evaluate gene expression of one or more of the genes of Figure 1. It is equally useful to obtain information on the level of expression, to assess the level of expression or to consider the level of expression. All of these methods do not require the step of acquiring a blood sample or the like because the blood sample may have previously occurred, and so the method can be used for the purpose of predicting the likelihood of clinical response or clinical response, And that information on gene expression is provided. This further indicates that information regarding the level of gene expression obtained previously may be used in the method according to the present invention.

One aspect of the invention is a method for identifying a subject with increased likelihood of responding to an anti-inflammatory agent, comprising obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject Wherein the altered expression of one or more of the gene (s) in comparison with the reference level of the gene (s) in the sample identifies a subject with increased likelihood of responding to the anti-inflammatory agent.

The alternative expression may be used according to the method of the present invention, such as taking into account the level of expression or the level of expression, as well as, as described above, the method may also be used to obtain a blood sample, But does not necessarily include a step of checking the level of the < RTI ID = 0.0 >

In a further aspect of the invention the method comprises measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient and comparing said level with a reference level of said gene.

Thus, one aspect of the present invention is

a) measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject; and

b) comparing the level to a reference level of the gene (s)

Wherein the altered expression of one or more of the gene (s) predicts a response of the subject to an anti-inflammatory agent, wherein the altered expression of the gene (s) relative to the reference level predicts the response of the subject to the anti-inflammatory agent.

Additional aspects include

a) measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject,

b) comparing the level to a reference level of the gene (s)

The present invention relates to a method of identifying an increased response to an anti-inflammatory agent, wherein the altered expression of one or more of the gene (s) relative to the reference level of the gene (s) Indicating that the object has been identified.

Gene expression

The molecular background of many inflammatory diseases or disorders, including autoimmune diseases or disorders, is poorly understood and therefore the diagnosis is complicated and prone to inaccuracies. Currently available therapies are useful for some patients but not others, the reason for which has not yet been clarified. In order to increase treatment success, partial grouping of patients depending on various parameters has been attempted.

One option is to characterize the patient's gene expression profile and group patients based on that profile. Gene expression is usually measured at the RNA level or at the protein level, since the level of translation product is determined by the provided mRNA or alternatively. Alternatively, gene expression may be measured or indirectly determined, for example, by association with other genes or markers, as well as polymorphic markers such as SNPs. SNPs are usually large genes and are easily assayed. Thus, gene expression can be measured at various levels by a number of methods known to those skilled in the art.

The test used to measure gene expression by mRNA levels is used when two or more primers are used for the purpose of amplifying two or more DNA sequences in a single reaction performed in a nucleic acid isolated from a biological sample such as a blood sample of a patient, It may also be based on PCR technology such as multiplex-PCR. The method may be a two-step method involving the step of cDNA synthesis prior to amplification. Microarray chips are also useful for analyzing large groups of genes, and these microarray chips can be specially designed to include appropriate probes, or the information of standard chips for the desired gene may be used for gene expression Can be collected to evaluate the profile.

The specificity of the PCR and array technology is dependent on hybridization of the primer and probe to the mRNA molecule in the analyzed sample and the stringency can be adjusted by parameters known to those skilled in the art.

Measurement of gene expression by association with other genes or markers may be performed when there is evidence that the detection of the other gene or marker is related to the level of expression of the desired gene. As described in Example 4 herein, the skilled artisan can perform an expression quantitative trait loci (eQTL) analysis on a desired gene and confirm the SNP association or association with the expression level of the gene. As a further alternative, the level of expression may thereby be determined by association with another gene (s) or marker (s).

Measurements of gene expression at the protein level are also believed to be the detectable proteins in samples obtained from patients until now.

Proteins may also be detected using suitable techniques, which are often antibodies based on the fact that antibodies with specificity for the provided proteins may be generated and used based on techniques known in the art. Antibody-based techniques are mostly available when gene expression data of a small number of genes are used. A more complex analysis of gene expression at the protein level can be made using proteome analysis.

Functional assays for specific gene products can equally well be applied for the purpose of determining expression levels. Functional assays can be assays to test for biological or enzymatic activity and depend on the functionality of the protein and the industry knowledge of such protein activity.

One embodiment of the present invention, as described above,

a) measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient,

b) comparing said level with a reference level of said gene,

(S), wherein the altered expression of one or more of the gene (s) relative to the reference level of the gene (s) is indicative of the patient's response to the anti-inflammatory agent Predict.

The same criteria may be applied to identify or select patients for treatment using anti-inflammatory agents based on the desire to identify patients with increased likelihood of response to treatment with the inflammatory agent.

As can be seen in the examples disclosed herein, the altered expression levels of one or more genes of Figure 1 represent clinical responses to anti-inflammatory agents. It is more attractive to focus on one or more genes (s) that are increased relative to the reference level. Alternatively, the emphasis may be on one or more gene (s) reduced relative to the reference level. One of these characteristics, genes associated with improved patient response rates, are listed in Figures 1A and 1B, respectively. In a further embodiment, the methods described herein relate to situations where the altered expression of the gene of Figure 1A is increased relative to the reference level. In a further embodiment, the method described herein relates to the case where the altered expression of the gene of Figure 1B is reduced relative to the reference level. In further embodiments, more genes may be included, such as one or more gene (s) of Figure 1A having an expression level higher than the reference level in combination with one or more gene (s) of Figure 1B having an expression level lower than the reference level And thus expression information on a plurality of genes is used. In one embodiment, the expression levels of at least two genes are compared to the respective reference levels. It is further possible to combine the information that the altered expression of the gene of Figure 1A is increased relative to the reference level, with the knowledge that the altered expression of the gene of Figure 1B is reduced relative to the reference level.

A combination of genes useful in a multivariate-based method according to the present invention is illustrated in Table 2, and in this way, information on the level of expression of one or more genes, such as at least two, at least three, at least four, may be used.

As further described below, the level of reference will be gene specific and dependent on the particular purpose of the method.

Reference level

Reference levels may be unaffected or at an expression level in a healthy subject, which is the most likely case for a gene when the altered expression of the gene is a characteristic of an inflammatory disease or disorder, and such a gene is useful as a diagnostic marker It is possible. In one embodiment, the reference level may be unaffected or the level of expression in a healthy subject.

As is evident from the data herein, other biomarkers are not necessarily affected relative to the patient or represent different expression in healthy individuals. In one embodiment, the reference level may be an average of the level of expression determined in a healthy individual or group of patients or a mixture thereof. In other situations, the level of gene expression of a particular gene may provide information that predicts the therapeutic potential of the patient using an anti-inflammatory agent, but the expression profile can not be associated with a disease state or diagnostic criteria. This may not reflect disease variability due to the fact that the diagnosis is not accurate as a diagnostic tool. These biomarkers may nonetheless have large values because they can be used according to the present methods of treatment for individual patients likely to respond to the treatment provided.

Based on this information, the reference level may be a predetermined level, any level of expression useful in screening patients responding to anti-inflammatory agents. In embodiments according to the present invention, the reference level is a predetermined level.

The examples here demonstrate that levels of expression of a single gene can be used according to the methods of the present invention. Thus, the predetermined level may be an expression level indicative of the response provided, such as a response measured by DAS28-CRP, ACR20, ACR50 and / or ACR70 response. The reference level or the predetermined level may take into account the threshold value and the threshold value may be chosen to target a certain level of response in the patient population. The selected threshold will indicate the probability of reaching an ACR20, ACR50 and / or ACR70 response in a portion of the patient. Similarly, thresholds may be selected based on a DAS28-CRP score targeting a particular score in the patient population. The level may thus be set to de-select non-responders for each criterion, or to increase a portion of the patient reaching one or more of the criteria for a positive response. Biomarkers are therefore useful for predicting therapeutic responses and predicting the extent of response when targeting only high-response individuals.

In one embodiment, the predetermined reference level is at least 40%, e.g., 45%, such as 50%, such as 55%, such as 60%, for example, For example, it may be based on an ROC curve that is set to select an expression level that reaches an ACR50 response at 65% or at least 70%, for example.

In one embodiment, the predetermined reference level is at least 25%, e.g., 30%, such as 35%, e.g., 40%, such as 45%, for example, For example, it may be based on the ROC curve set to select expression levels that reach ACR70 response at 50%.

In one embodiment in accordance with the present invention, the level of expression of complement factor D (CFD), also known as adygosine, is used to select, identify and / or determine whether a patient has a higher probability of responding to anti-inflammatory agents. The genes are listed in FIG. 1A (and FIG. 2) and illustrate how genes with increased expression levels can be used in the methods of the present invention. Although expression levels are determined using microarray technology and qRT-PCR in the examples herein, it is also contemplated to consider alternative methods of measuring mRNA levels of CFDs and generally methods for measuring protein level or activity of CFDs Are suitable according to the present invention.

Thus, the methods of the present invention include that the level of expression of complement factor D (CFD) is greater than 9.5 at log 2-scale of normalized expression values when determined by microarray technology. Increasing the threshold to, for example, 9.8, 10.0, 10.2, 10.3, 10.4 or 10.5 based on the ROC data provided herein provides a more specific but less sensitive method.

The level of expression may also be determined based on PCR measurements, such as PT-PCR, because qRT-PCR performed using internal controls or using multiplex PCR can be assayed at one time or with more than one transcript have.

Thus, the method of the present invention may include a method wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is detected as a periodic threshold value of 30 (cycle threshold value; Ct) ID: Hs00157263_m1 (Applied Biosystems by Life technologies). In this additional embodiment, the CFD transcript may be detected within the PCR cycle 28 or even 26. At the same time, 18S RNA is more preferably detected with a cycle threshold value (Ct) of 12.5 in the same cDNA sample, confirming the quality of the PCR assay.

The efficiency of the amplification reaction can also be measured and should be higher than 95%, and 100% represents the theoretical doubling of the amplicon per cycle. Alternatively, the efficiency of the PCR amplification should be at least 1.9 or preferably at least 1.93, and 2.0 represents the theoretical doubling of the amplicon per cycle.

In a further embodiment, the methods of the invention comprise a method wherein the level of expression of complement factor D (CFD) is measured indirectly by SNP detection. One or more SNPs may be evaluated in this manner. In contrast to gene expression, SNP detection provides a yes / no, yes / no (= no / yes) or no / no response, but not a relative or low magnitude of expression, thus the assessment focuses on the genotype corresponding to the desired altered expression Should be met.

The reference level may be "no / no" depending on the SNP's selected and at least one allele for the altered expression should provide "yes. &Quot; In alternative embodiments, the reference level may be" yes / It may be "yes / no".

In the example of CFD, increased CFD expression would be associated with a specific "reference level" for each SNP. Thus, this method can be used to measure the level of expression of complement factor D (CFD) indirectly by detection of one or more of rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898 .

The reference level will be AA, AG, or GG, as it relates to a single nucleotide, A or G.

For the SNP rs1683591 described in the examples, the reference level would be the AA genotype (low CFD expression and AG and GG genotypes represent altered expression of CFD (high CFD expression)).

Thus, the method according to the invention comprises a method wherein the level of CFD is measured indirectly by the presence of the AG or GG genotype of SNP rs1683591.

The specificity of the method can be increased by lowering the threshold, as indicated by the method of using microarray data and RT-PCR data, but this results in some loss of sensitivity.

If increased expression of the gene is appropriate for the method according to the invention, in addition to CFD, increasing the threshold will provide a higher specificity but lower sensitivity.

Conversely, if reduced expression of the gene is appropriate for the method according to the invention, the expression level threshold will provide a higher specificity but lower sensitivity. It is also clear that in this case the expression level should be lower than the threshold value to meet the threshold criterion.

As identified herein, other genes, likewise alone or in combination, can be used to predict the likelihood of a clinical response in a patient and thereby determine whether the selected patient will respond to the treatment given on the basis of a high probability of responding to the treatment May also be used in a method for selecting.

Biological sample

Beyond initial diagnosis, the starting point for any aggregation or characterization of individual patients is information based on biological samples or previously obtained biological samples. A biological sample according to the present invention may be any sample obtained from a patient prior to or after use of the invention. The sample is preferably a blood sample that can be readily obtained by routine methods, but other types of samples may also be used. The sample may also be a serum sample. In some cases tissue samples, such as synovial fluid samples, may be used. One skilled in the art will understand how to process the provided sample before measuring the level of expression of a given set of genes. Whole blood samples may be collected as PaxGene samples.

If the desired gene is expressed in a particular cell type, it may reflect the sample used in the expression study. Thus, a biological sample may be a fraction of these, including monocytes, such as one or more of CD14 +, CD4 + and / or CD8 + positive cells, or even samples of peripheral blood mononuclear cells among blood samples, also referred to as PBMC fractions .

In cases where the gene encodes a soluble protein marker, expression studies may be performed in serum samples, and the presence of the protein, rather than transcripts, may be assessed. Soluble proteins in serum may be detected using ELISA, for example, as known in the art, using specific antibodies. It may be considered that more complex analysis of gene expression at the protein level can be achieved using proteomic analysis once more proteins are evaluated.

In addition to the level of expression and variations thereof, the biological sample may also be used to determine the rheumatoid factor (RF) status of the patient.

Patient and Patient Status

In one embodiment, the subject is an individual diagnosed with or suffering from a patient, for example, an indication (s) or symptom (s) associated with the inflammatory disease or disorder described herein. In one embodiment, the patient suffers from an autoimmune disease or disorder. In a specific embodiment, the patient is a RA patient or suffering from a symptom of RA.

The sample may be obtained from a patient who is naive for the treatment of an inflammatory disease or disorder and that treatment for an inflammatory disease or disorder has not been previously administered to the patient. For patients suffering from autonomic inflammation, the disease is likely to be a rare event, with regard to the class of biological agents in particular, considered various treatments before the anti-inflammatory agents described herein are considered. In some cases, gene expression information may be obtained from a previously obtained sample, and thus the patient may no longer be naive for the provided treatment, while the sample may be considered a naive. In some cases, the sample may be obtained from a patient currently being treated for an inflammatory disease or disorder. The patient may be treated using any medicament that is not limited to the anti-inflammatory agents mentioned herein.

Drugs used as first line drugs for the treatment of inflammatory diseases or disorders will usually be administered to the patient before it is evaluated whether the treatment according to the invention has a high success probability.

Drugs that have been treated or previously treated with the patient include those similar to non-steroidal anti-inflammatory drugs (NSAIDs), corticosteroids, Plaquenil ™, Azulfidine ™, Methotrexate ™, etc., similar to Asprin ™, Ibuprofen ™, (DDS), anti-rheumatic drugs (DMARDs), Copaxone ™ (glatirimer acetate), Gilneya ™ (pingolimodem), Flagyl ™, Cipro ™ -like antibiotics, local corticosteroids, vitamin D analogue cream (Dovonex ™), local retinoids Tazorac ™, moisturizers, topical (skin-applied) medications including local immunosuppressants (tacrolimus and pimecrolimus), coltar, anthralin, etc., Raptiva ™, Ustekimumab ™, PUVA, UVB and May include one or more of a cell therapy similar to CellCept (TM) (mycophenolate mofetil). It is also possible to use a combination of IFN-beta, OrenciaTM (CTLA4-Ig), HumiraTMF (anti-TNF), CimziaTM (anti-TNF, PEGFab), TysabriTM (a4-integrin mAb), SimponiTM, Rituxan / MabTheraTM, Actemra / RoActemra (TM), and Kineret (TM).

If the sample obtained prior to treatment is not used, the patient may be treated with one of a wide variety of anti-inflammatory agents, including NSAIDs, DMARDs and TNF-alpha inhibitors, as mentioned above. Patients will often be treated with methotrexate (MTX).

It is also believed that the previously applied therapy does not provide sufficient response in the patient and thus the patient is no longer naive to the treatment but is considered an insufficient respondent. Speaking of diagnostic and clinical responses, the criteria applied to determine if a given patient is an insufficient respondent will depend on the disease or disorder being treated, as described below.

Thus, if the treatment of TNF-alpha inhibitor implies at least one of the drugs recognized as a TNF-alpha inhibitor comprising both an antibody drug and a soluble receptor drug, then the patient has insufficient response to MTX treatment and / or TNF- It may be.

Expression of the gene selected for the identification method described herein is not affected by prior or simultaneous treatment with any anti-inflammatory agent, either before or simultaneously with the biological sample being obtained.

It may also be appropriate to consider the patient's rheumatoid factor (RF) status and anti-cyclic citrated protein antibody (anti-CCP) status as mentioned above. Assays for determining RF and anti-CCP status are known in the art, and those skilled in the art can apply any of these assays without difficulty in accordance with the manufacturer's instructions. Patients that are positive for RF have a higher level of rheumatoid factor than the specific threshold for indicating the presence of RF in the sample. In the case of negative, the level of rheumatoid factor is lower than the threshold, indicating the absence of RF in the sample.

In one embodiment, the patient RF status is positive or negative. In a further specific embodiment, the patient RF status is positive or negative.

In one embodiment, the patient's anti-CCP status is positive or negative. In further particular embodiments, the patient anti-CCP status is positive or negative.

indication

As described hereinabove, the present invention relates specifically to the treatment of a variety of diseases, including autoimmune and inflammatory diseases or disorders.

The disease or disorder treated with an anti-inflammatory agent is selected from the group consisting of rheumatoid arthritis, pediatric rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, Sjogren's syndrome, multiple sclerosis, Inflammatory bowel disease such as ulcerative colitis and Crohn's disease, systemic lupus erythematosus, or lupus nephritis, and any combination thereof, as well as those diseases, It is a comorbid condition associated with cardiovascular disease, a non-limiting example of a comorbid condition. In a further embodiment, the other exemplary conditions are selected from the group consisting of juvenile chronic arthritis, osteoarthritis, spondyloarthropathies other than ankylosing spondylitis, systemic sclerosis (scleroderma), idiopathic Inflammatory diseases such as idiopathic inflammatory myopathies (dermatomyositis, polymyositis), vasculitis, systemic vasculitis, temporal arteritis, atherosclerosis, sarcoidosis, sarcoidosis, myasthenia gravis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria, pernicious anemia, autoimmune thrombocytopenia autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura), immune-mediated thrombocytopenia ), Thyroiditis (Grave's disease, Hashimoto's thyroiditis, pediatric lymphocyte thyroiditis, atrophic thyroiditis), diabetes mellitus, type 2 diabetes, immune - mediated renal diseases (glomerulonephritis, tubulointerstitial nephritis, autoimmune oophoritis, pancreatitis, autoimmune orchitis, autoimmune uveitis, - idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy. The present invention also relates to a method for the treatment of chronic inflammatory demyelinating polyneuropathy, In addition to the central nervous system and peripheral nervous system (demyelinating diseases), infectious hepatitis (infectious h hepatitis A and other non-hepatitis B viruses), autoimmune chronic active hepatitis, viral hepatitis, primary biliary Hepatobiliary disease such as primary biliary cirrhosis, granulomatous hepatitis, Wegener's granulomatosis, Behcet's disease, and sclerosing cholangitis, pediatric fat Inflammatory bowel disease such as celiac disease, gluten-sensitive enteropathy and Whipple's disease, bullous skin disease, erythema multiforme and contact dermatitis an autoimmune or immunomodulatory agent including contact dermatitis, atopic dermatitis (dermatitis), dermitis herpetiformis, pemphigus vulgaris, vitiligo (leukoderma) Allergies such as skin diseases, asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria, sepsis, endotoxemia, And is useful in the treatment of immune diseases of the lungs such as eosinophilic pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumonitis, chronic obstructive pulmonary disease, and graft rejection And graft-versus-host disease, including, but not limited to, osteoporosis, osteoarthritis, and graft-versus-host disease.

Inflammatory diseases can be caused by many different pathways and components. Inflammation may be caused by a vasculature (for example, endothelial cells, endothelial cells, smooth muscle cells), cells of the immune system (e.g., T and B lymphocytes, monocytes and neutrophils (Eg, dendritic cells, macrophages, and NK cells), cell-based soluble intermediates (cytokines, chemokines) and also resident cells of targeted tissue (eg, epithelial cells, synovial fibroblasts, Nerve cells) that are involved in the event. Each of these elements, including their regulators, may play a role in disease development and may subsequently be targets for therapy for the above-mentioned diseases and disorders. Inflammatory diseases may thus also be characterized by pathways affected, such as, for example, B or T-cell mediated diseases or disorders, such as cytokine mediated disorders or receptor mediated disorders.

Thus, the indication for the present invention is that the IL-10 family, such as a disorder mediated by down-regulation of signal transduction / activity of receptors and ligands described herein below, It can also be a disability.

Indications that may be treated using the modulators of the IL-10 family of cytokines and receptors include rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Inflammatory Bowel Disease (IBD) ), Psoriasis or psoriatic arthritis (PSA).

Anti-inflammatory agent

As described herein above, several pathways are involved in inflammation and each pathway may be targeted at various levels. Inhibition of receptor signaling may be accomplished by blocking the receptor as exemplified by the biological therapeutic agent targeted for treatment of a particular autoimmune disease and / or cancer, by providing a soluble receptor fragment, or by inhibiting the ligand from binding or signaling through the receptor . For example, a patient with cancer may be treated with an antibody against CD20 (anti-CD20); Patients with rheumatoid arthritis may be treated with anti-CD20, TNF antagonists (soluble TNFR or anti-TNF-a); Patients with psoriasis may be treated with anti-CD11a; Patients with multiple sclerosis may be treated with INF-beta; Patients with ulcerative colitis may be treated with anti-TNF-alpha, and patients with Crohn's disease may be treated with anti-TNF-alpha or anti-alpha4 integrin. Unfortunately, these treatments are not completely effective.

It has previously been described that members of the IL-10 family are targets useful for the treatment of inflammatory diseases or disorders (WO 2001/46261).

The IL-10 family includes IL-10, IL19, IL-20, IL-22, IL-24 and IL-26 which bind to the following receptor heterodimers:

IL-10: Binding to IL-10R1 / IL-10R2

IL-19 binds to IL-20R1 / IL-20R2

IL-20: Binding to IL-20R1 / IL-20R2 and IL-22R / IL-20R2

IL-22 binds to IL-22R / IL-10R2

IL-24 binds to IL-20R1 / IL-20R2 and IL-22R / IL-20R2

IL-26: No known receptor

This receptor overlap suggests that some functionality is specific to each family member, but there are also some shared effects. The precise role of each ligand and receptor in inflammatory diseases has not yet been established, but many are linked to disease. Examples include IL-20, which may be targeted by antibodies or receptor fragments (WO 2001/45261) for the treatment of inflammatory diseases, IL-22, which is a member of the IL-10 family of cytokines, and IL- IL-19, IL-17 (W010025369, WO2010102251).

Interleukin-19 (IL-19), IL-20, and interleukin-24 (IL-24) are members of the interleukin-10 (IL-10) cytokine family. As shown above, these three interleukins bind and signal through the IL-20R1 / IL-20R2 heterodimer receptor. IL-20 and IL-24 (but not IL-19) are also ligands to the receptor complex consisting of IL-20R2 and IL-22R1 (Parrish-Novak et al., J Biol Chem 2002; 277: 47517-47523; Dumoutier et al., J Immunol 2001; 167: 3545-3549). With other members of the IL-10 family, IL-19 and IL-20 have been proposed to form distinct subfamilies of helical cytokines with at least IL-19 and IL-20 having a similar three-dimensional structure (Chang et al. , J Biol Chem 2003; 278: 3308-13).

Therefore, antagonism of IL-20 activity using receptor fragments or monoclonal antibodies has been described as a promising approach to the treatment of a variety of inflammatory diseases. The antigenic epitope of human IL-20 (hIL-20), as well as rat or mouse monoclonal antibody binding huIL-20 has also been described (e.g., WO2005052000, US20060142550, and WO2007081465). IL-20 monoclonal antibodies capable of reducing IL-20-mediated activation of the IL-20R1 / IL-20R2 and IL-22R1 / IL-20R2 receptor complexes in at least one species, 000721.

Thus, an anti-inflammatory agent may be an antagonist of IL-20 that may reduce IL-20 mediated activation of both IL-20R1 / IL-20R2 and IL-22R / IL-20 receptors. Anti-inflammatory agents may be specific by not decreasing receptor activation through IL-19 or IL-24 receptors.

Targeting of each ligand and receptor based on at least a shared mode of activity may provide a similar biological effect. Thus, anti-inflammatory agents according to the present invention modulate signal transduction of the above-mentioned receptors by binding antagonists, e. G., Ligands or receptors of IL-10 family members and their receptors, thereby resulting in a biological activity of the ligand or receptor Lt; / RTI > Assays for determining the antagonistic activity of IL-10 family members are known in the art and are described in WO 2010/000721.

The anti-inflammatory agent according to the present invention may be in a pharmaceutical composition comprising a pharmaceutical composition, for example, an anti-inflammatory agent, and a pharmaceutically acceptable carrier and label. Anti-inflammatory or pharmaceutical compositions may be suitable for oral, intravenous (iv) and / or subcutaneous (s.c.) administration. The anti-inflammatory or pharmaceutical composition may be for repeated administration, such as once a month or once a week.

The method herein may also take into account the route of administration or diet, as the reaction may also depend on the therapeutic regimen to which the reaction is applied. In one embodiment, the response prediction or indication is based on the fact that the anti-IL-20 antibody is administered once a week. In one embodiment, the antibody is administered subcutaneously.

Clinical response

Depending on the indication, the diagnostic and clinical response may be determined by various methods. A non-patient indicates that, upon administration of the provided anti-inflammatory agent, any or sufficient indication of treatment of the disorder being treated is considered non-responsive. Conversely, the patient responds by indicating that, upon administration of the provided anti-inflammatory agent, sufficient indications of treatment of the disorder being treated are considered reactive.

Sufficient indications of treatment vary from disease to patient and the patient experiences "sufficient" treatment, but does not mean that improvement of only one or more clinical parameters is observed. Reactivity may be considered at other times after administration of the anti-inflammatory agent and the patient may respond after one or more doses until a positive result is obtained for a short or long period of time, when the patient is considered reactive.

The success rate (for example, the frequency with which the anti-inflammatory agent is administered to the patient to be responded) may be increased based on the present invention, and the frequency of reaching a strong response as well as a high success rate in the administered patient .

The clinical response may be determined by methods known in the art. It is desirable that the official disease score approved by the public authority be used. These disease scores develop over time, so that future methods for obtaining clinical scores are also considered to be appropriate for the present invention.

It is contemplated that those skilled in the art will be able to ascertain appropriate clinical parameters for a particular disease or disorder and therefore only a few key clinical parameters are included herein. Autoimmune diseases are diagnosed based on various criteria.

The methods herein relate to the indication and prediction of a patient's response to an anti-inflammatory agent, depending on the indication and symptoms, and the predicted response may be expected at other times. Indications and predictions in the individual embodiments relate to reactions that must be obtained within 12 months, 10 months, 8 months, 6 months, 5 months, 4 months, 3 months, or 2 months.

Rheumatoid arthritis (RA)

Rheumatoid arthritis may be diagnosed based on criteria defined by the American College of Rheumatology (ACR) et al. Reactivity to treatment may be based on a degrease score when applying these criteria. Prevention or disturbance of radiation damage is also the goal of RA treatment. The American College of Rheumatology (ACR) 20% synthetic standard for improvement includes a 20% improvement in the number of soft and swollen joints and five additional measures (pain, physical function, patient overall health assessment, physician's overall health assessment, Material level) if there is a 20% improvement in at least three of them. Similarly, ACR50 and ACR70 show a higher degree of improvement for the patient.

Thus, the effectiveness of an anti-inflammatory agent as a therapeutic agent for RA may be quantified based on a number of patients or a portion of patients who achieve ACR20, ACR50, and / or ACR70.

As an alternative to ACR scores, the progression of rheumatoid arthritis may also be followed using 28 joint disease activity scores (DAS28). It was developed in Nijmegen in the 1980s and is a combined index widely used as an indicator of RA disease activity and response to treatment, along with the DAS-based European League Against Rheumatism (EULAR) response criteria. The joints included in DAS28 are (in both directions) proximal interphalangeal joints (10 joints), joints (10), wrists (2), elbows (2), shoulders (2) and knees (2). Looking at these joints, the number of soft joints at the time of contact (TJC28) and during swelling (SJC28) is counted. (Mg / l) of C-reactive protein (CRP) and the patient also underwent a subjective assessment of disease activity on a scale of 0 to 100 for the previous 7 days, 0 being " Is "the highest activity possible ". DAS28 is calculated based on the present application.

Using DAS, several thresholds have been developed for high disease activity, low disease activity, or remission. The score can also be used as a response criterion and the clinical response of the patient can be assessed when the patient's DAS is measured at two time points (e.g. before and after treatment).

The present invention relates to improving the effectiveness of RA therapy. Although several compounds have been improved and used in the treatment of RA, the treatment results are not nearly optimal for all patients, and involve some aspects of the tests and arrows that do not apply the method of predicting the efficacy of RA treatment.

Recently, a method of increasing the efficacy of RA therapy with antibody treatment (rituximab) against CD20 has been described (WO2011 / 028945, Owczarczyk et al. 2011, Science translational medicine). Another sub-grouping of patients with RA in WO2011 / 028945 is defined based on the patient's expression profile and some association with clinical responses is also identified by identifying subgroups of RA patients who are less likely to respond to anti-CD20 therapy . High (over threshold) mRNA levels of one or more of FcRH5 and CXCL13 increase the ARC50 ratio in RA patients. Additional sub-grouping, which is dependent on the RF status, allows further improvement, which results in an ARC50 criterion for about 40% of patients, which is the hallmark of the lymphatic subset and the target of rituximab It may reflect sub-aggregation dependent on the B-cell pathway.

The present invention demonstrates that the altered expression levels of the genes of Figures 1 and 2 exhibit a higher clinical response than the average clinical response in RA patients.

Systemic lupus erythematosus (SLE)

Speaking of RA, the effectiveness of SLE therapy may be based on the American College of Rheumatology (ACR) classification criteria. These criteria have been established for use primarily in scientific investigations and clinical trials, but not for diagnostic purposes, and not all SLE patients pass the entire criteria.

Multiple sclerosis (MS)

Several subtypes of disease are present and other prognoses and progression are observed.

In 1996, the United States National Multiple Sclerosis Society defined four subtype definitions as 1) relapsing remitting, 2) secondary progression, 3) primary progression, and 4) progressive recurrence Standardized. A variety of diagnostic and evaluation criteria are used to seriously complicate the testing of drugs potentially effective in the treatment of MS. Based on MS, an autoimmune disease, immuno-modulators such as anti-inflammatory agents may be useful in the treatment or management of MS.

Psoriatic arthritis (PSA)

Psoriatic arthritis may be diagnosed based on criteria defined by the American College of Rheumatology (ACR). Reactivity to treatment may be based on the severity score when applying these criteria. Prevention or disturbance of radiation damage is also a goal for PSA treatment. The American College of Rheumatology (ACR) 20% synthetic standard for improvement includes a 20% improvement in the number of soft and swollen joints and five additional measures (pain, physical function, patient overall health assessment, physician's overall health assessment, Material level) if there is a 20% improvement in at least three of them. Similarly, ACR50 and ACR70 show a higher degree of improvement for the patient.

Thus, the effectiveness of an anti-inflammatory agent as a therapeutic agent for PSA may be quantified based on a number of patients or a portion of a patient obtaining ACR20, ACR50, and / or ACR70.

As an alternative to ACR scores, the progression of psoriatic arthritis may also be attributed to the use of 28 joint disease activity scores (DAS28). It was developed at NyeMehen in the 1980s and is a combined index widely used as an indicator of PSA disease activity and response to treatment with EULAR response criteria. The joints included in DAS28 are (in both directions) proximal interphalangeal joints (10 joints), joints (10), wrists (2), elbows (2), shoulders (2) and knees (2). Looking at these joints, the number of soft joints at the time of contact (TJC28) and during swelling (SJC28) is counted.

(Mg / l) of C-reactive protein (CRP) and the patient also underwent a subjective assessment of disease activity on a scale of 0 to 100 for the previous 7 days, 0 being " Is "the highest activity possible ". DAS28 is calculated based on the present application.

Using DAS, several thresholds have been developed for high disease activity, low disease activity or exemption. The score can also be used as a response criterion and the clinical response of the patient can be assessed when the patient's DAS is measured at two time points (e.g. before and after treatment).

Skin psoriasis is a major aspect of PsA, but the degree of activity in the skin is not necessarily related to cardiac activity. Many instruments have been developed to evaluate skin psoriasis. Widely used instruments are psoriasis area and severity index (PASI). The PASI uses the formula to assess the individual severity of the lesion, thickness / induration, and scale for erythema, and then to describe the overall degree of skin surface that accompanies it, with a score of 0 -72. ≪ / RTI >

The Psoriatic Arthritis Response Criteria (PSARC) was developed specifically for PSA clinical trials. PsARC consists of four measurements: 1) overall evaluation of the patient's disease activity (an improvement of 1 on the 5-point Likert scale is needed for the response), 2) 3) joint pain (a score of 30% or more in total score is needed for the reaction, using a 4-point scale to evaluate 68 or 78 joints), and 4) Joint swelling (using a 4-point scale, requiring a reduction of 30% or more in total score to evaluate 68 or 78 joints). In order to become a 'PsARC Reactor', the patient must achieve an improvement in 2 of 4 measurements, one of which must be joint pain or annoyance, without weakening any of the measurements.

cure

One aspect of the invention relates to a method of treatment based on information derived from an embodiment of the present invention. A method for predicting the clinical success of an anti-inflammatory agent provides a method of treating a patient, which is subsequently identified by the method. Since the method of identifying a patient meeting a predefined specific criterion can easily be performed separately from the actual treatment of the patient, the method applied includes determining if the patient meets a predetermined specific criteria, It is a preferred embodiment. When applying the method of treatment according to the present invention, the patient is expected to respond with a high level of certainty, which may not be the case without prior knowledge of the fact that the patient meets a predetermined standard.

In a further embodiment,

a. In this patient, considering whether the expression level of one or more of the genes of Figure 1 is altered relative to a reference level,

b. Comprising administering to said patient a therapeutic amount of an anti-inflammatory agent.

To a method of treating an inflammatory disease or disorder in a patient.

In addition, in one embodiment,

a. In the biological sample of the patient, it is determined whether the level of expression of one or more of the genes of Figure 1 is altered relative to a reference level,

b. Comprising administering to said patient a therapeutic amount of an anti-inflammatory agent.

To a method of treating an inflammatory disease or disorder in a patient.

In an embodiment,

a. Measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient,

b. b. Comparing the level to a reference level of the gene,

c. Determining whether the expression level of one or more of the genes of Figure 1 is altered relative to the reference level,

d. Administering a therapeutic amount of an anti-inflammatory agent in said patient,

To a method of treating an inflammatory disease or disorder in a patient.

As an alternative to the method, the reference level may be at a predetermined level.

In a further embodiment, each of the methods

The expression level of one or more of the genes of Figure 1 is altered relative to the reference level in the biological sample.

Reference is made to the description of the present application, including more detailed information of the method of prediction associated with the method of treatment of the present invention.

An aspect of the invention relates to an anti-inflammatory agent for the treatment of an inflammatory disease or disorder in a subject, wherein said subject exhibits at least one altered expression of the gene of Figure 1 compared to a reference level of said gene.

Reference is made to the detailed description of the above description of the method of treatment and includes more detailed information of the predictive or confirmatory method that is clearly equally relevant in defining the nature of the anti-inflammatory agent and their medical use.

Article of manufacture

In a further aspect, the invention provides a pharmaceutical composition and pharmaceutical composition comprising an anti-inflammatory agent and a pharmaceutically acceptable carrier, together packaged, wherein the pharmaceutical composition comprises a patient suffering from autoimmune disease or disorder with altered expression of one or more of the genes of Figure 1 ≪ RTI ID = 0.0 > a < / RTI >

Reference is made to the description of the present application, including further detailed information of the prediction method associated with the article of manufacture of the present invention.

Detection Agents and Kits

The invention further relates to a composition comprising one or more genes (s) of Figure 1, in particular one or more genes of Figure 2, and at least one detecting agent which specifically determines the level of expression of CFD. The detection agent (s) may be an antibody, a probe or a primer specific to each gene including mRNA and the protein encoded thereby.

A further aspect of the present invention relates to a kit comprising a composition for detection or a composition comprising the detection agent and instructions for use as described above. Where internal control is useful, the kit may further comprise a reference gene composition. The kit may also contain a detection agent for expression normalization, such as a detection agent for detecting globulin genes. It is a further part of the present invention to include an explanation as to whether the expression level (s) is associated with a response probability for an anti-inflammatory agent as described herein. Specifically, kits for determining the level of expression of complement factor D (CFD) and its evaluation are contemplated.

Therapeutic target

Anti-inflammatory agents are modulators of pathways essential for the phenotype of an inflammatory disease or disorder. As is evident from the data herein, the selected genes are so far considered as novel therapeutic targets for the treatment of inflammatory diseases or disorders, since they have not been previously described with respect to autoimmune diseases and specifically RA.

Concrete example

The present invention is summarized in the following embodiments, but not limited, as described herein.

1. A method for predicting the response of a subject to an anti-inflammatory agent comprising obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject, Wherein the at least one altered expression level of the gene (s) predicts the response of the subject to an anti-inflammatory agent as compared to a reference level.

2. a. Measuring the level of expression of one or more gene (s) of Figure 1 in the patient ' s biological sample and

b. A method of predicting a patient's response to an anti-inflammatory agent comprising comparing the level to a reference level of the gene (s), wherein the altered expression of one or more of the gene (s) A method for predicting a patient's response to an anti-inflammatory agent.

3. A method for identifying a subject with increased probability of responding to an anti-inflammatory agent, comprising obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject, Wherein the altered expression level of one or more of the gene (s) compared to the reference level of the gene (s) indicates that the subject with increased probability of responding to the anti-inflammatory agent has been identified.

4. a. Measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient,

b. Comparing said level of expression to a reference level of said gene (s)

A method for identifying a patient having an increased probability of responding to an anti-inflammatory drug,

Wherein the altered expression of one or more of the genes in comparison to the reference level of the gene (s) indicates that a patient with increased likelihood of responding to the anti-inflammatory agent has been identified.

5. The method of any one of embodiments 1 to 4 wherein the complement factor D (CFD) is measured in a biological sample.

6. The method of any one of embodiments 1 to 4, wherein the expression of complement factor D (CFD) and a serpin peptidase inhibitor, clade B, member 9 (SERPINB9) in a biological sample is measured.

7. A pharmaceutical composition according to any one of embodiments 1 to 4 wherein the complement factor D (CFD) and / or the serpin peptide inhibitor, the cleate B, the SERPINB9 and / or the zinc finger ), The expression of CCHC domain containing 24 (ZCCHC24) is measured.

8. The method according to any one of embodiments 1 to 4, wherein the complement factor D (CFD) and / or the fructosamine 3 kinase related protein (FN3KRP) and / or the hepatic tissue homeobox 1 MEOX1) is measured.

9. A pharmaceutical composition according to any one of embodiments 1 to 4, wherein the complement factor D (CFD) and / or serpin peptidase inhibitor, clade B, SERPINB9 and / or zinc finger, CCHC Wherein the expression of the domain containing 24 (ZCCHC24) and / or fructosamine 3 kinase related protein (FN3KRP) is measured.

10. The method of any one of embodiments 1 to 4 wherein the complement factor D (CFD) and / or serpin peptidase inhibitor, clade B, SERPINB9 and / or zinc finger, CCHC Wherein the expression of the domain containing 24 (ZCCHC24) and / or the fructosamine 3 kinase related protein (FN3KRP) and / or the mesenchyme homeome box 1 (MEOX1) is measured.

11. The method of any one of embodiments 1 to 4, wherein the complement factor D (CFD) and / or fibroblast growth factor 13 (FGF13) and / or tubulin, beta 2A (TUBB2A) and / Wherein the expression of carrier family 39 (metal ion transporter, member 11) (SLC39A11) and / or transmembrane channel-like 4 (TMC4) is measured.

12. The pharmaceutical composition according to any one of embodiments 1 to 4, wherein complement factor D (CFD) and / or nuclear membrane pore complex interacting protein-like 2 (NPIPL2) and / or zinc finger protein 880 (ZNF880) and / Or the expression of the aldehyde dehydrogenase 5 family, member A1 (ALDH5A1) is measured.

13. A pharmaceutical composition according to any one of embodiments 1 to 4 wherein the complement factor D (CFD) and / or fibroblast growth factor 13 (FGF13) and / or tubulin, beta 2A (TUBB2A) and / (SLC39A11) and / or transmembrane channel-like 4 (TMC4) and / or nuclear membrane pore complex interacting protein-like 2 (NPIPL2) and / or zinc finger protein 880 ZNF880) and / or the aldehyde dehydrogenase 5 family, member A1 (ALDH5A1).

14. A pharmaceutical composition according to any one of embodiments 1 to 4 wherein the complement factor D (CFD) and / or the serpin peptidase inhibitor, clade B, SERPINB9 and / or zinc finger, CCHC (FN3KRP) and / or mesenchymal homeome box 1 (MEOX1) and / or fibroblast growth factor 13 (FGF13) and / or tubulin, beta 2A (ZCCHC24) and / or fructosamine 3 kinase related protein (TIPB2A) and / or solute carrier family 39 (metal ion transporter, member 11) (SLC39A11) and / or transmembrane channel-like 4 (TMC4) and / or nuclear membrane pore complex interacting protein- / Or the expression of zinc finger protein 880 (ZNF880) and / or aldehyde dehydrogenase 5 family, member A1 (ALDH5A1).

15. The method of any one of embodiments 1 to 14 wherein the altered expression of the gene of Figure 1A is increased as compared to a reference level.

16. The method of any one of embodiments 1 to 15, wherein the altered expression of the gene of Figure IB is reduced compared to a reference level.

17. The method of any one of embodiments 1 to 16, wherein the expression level of at least two genes is compared to an individual reference level of at least two genes.

18. The method of any one of embodiments 1 to 17 wherein the level of expression of the at least two genes is compared to the respective reference level of at least two genes and the altered expression of the gene of Figure 1A is increased relative to the reference level RTI ID = 0.0 > 1B < / RTI > gene is reduced relative to the reference level.

19. The method of any one of embodiments 1 to 18, wherein the reference level is a predetermined level.

20. The method of any one of embodiments 1 to 19, wherein the predetermined level is a threshold value indicative of the response measured using DAS28-CRP, ACR20, ACR50 and / or ACR70.

21. The method of any one of embodiments 1-20, wherein the biological sample is a blood sample or a serum sample.

22. The method of any one of embodiments 1 to 21 wherein the biological sample is a Paxgene complete blood sample.

23. The method of any one of embodiments 1-25 wherein the biological sample is a PBMC fraction of a blood sample.

24. The method of any one of embodiments 1 to 23 wherein the biological sample is a subset of the cells of the blood sample.

25. The method of any one of embodiments 1-31 wherein the biological sample is a subset of cells of a blood sample and may be one or more of CD14 +, CD4 + and CD8 + positive cells in the subset.

26. The method according to any one of embodiments 1 to 25, wherein the level of expression is measured based on mRNA.

27. The method according to any one of embodiments 1 to 26, wherein the level of expression is measured using PCR.

28. The method according to any one of embodiments 1 to 27 wherein the PCR is selected from the group consisting of multiplex PCR and qRT-PCR.

29. The method according to any one of embodiments 1 to 28, wherein the level of expression is measured using a microarray chip.

30. The method of any one of embodiments 1-9, wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is verified using the assay ID: Hs00157263_m1 (Applied Biosystems) And a Cycle Threshold Value (Ct).

31. The method of any one of embodiments 1-30 wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is assayed for CFD ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) and A method wherein at least 0.03 copies of the CFD per copy of beta-actin mRNA (gene symbol ACTB) is detected in an anonymous number using Hs99999903_m1 (Applied Biosystems / Invitrogen) for ACTB.

32. The method of any one of embodiments 1-31, wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is assayed for CFD ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) and A method wherein at least 0.04 copies of CFD per copy of beta-actin mRNA (gene symbol ACTB) is detected in an anonymous number using the Hs99999903_m1 (Applied Biosystems / Invitrogen) for ACTB.

33. The method of any one of embodiments 1-32, wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is assayed for CFD ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) and Is detected in an anonymous number of at least 0.05 copies of CFD per copy of beta-actin mRNA (gene symbol ACTB) using Hs99999903_m1 (Applied Biosystems / Invitrogen) for ACTB.

34. The method of any one of embodiments 1 to 33 wherein the level of expression of complement factor D (CFD) is measured by qRT-PCR and the transcript is assayed for CFD ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) and A method wherein at least 0.06 copies of the CFD per copy of beta-actin mRNA (gene symbol ACTB) is detected in an anonymous number using Hs99999903_m1 (Applied Biosystems / Invitrogen) for ACTB.

35. The method of any one of embodiments 1-34, wherein the level of expression of complement factor D (CFD) is greater than 0.5 at log2 scale of RMA or GC-RMA normalized expression values when measured using a microarray chip Way.

36. The method of any one of embodiments 1 to 35 wherein the level of expression is measured indirectly based on one or more SNPs.

37. The method of any one of embodiments 1-36 wherein the level of expression of complement factor D (CFD) is measured indirectly based on one or more CFD expression-related SNPs.

38. The method of any one of embodiments 1-37, wherein the level of expression of complement factor D (CFD) is indirectly measured based on one or more SNPs in a CFD haploblock.

39. The method of any one of embodiments 1 to 38 wherein the level of expression of complement factor D (CFD) is selected from the group consisting of rs1683565, rs1683591, rs1683590, rs1683574, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898. Lt; RTI ID = 0.0 > SNP < / RTI > selected from the group consisting of SNPs.

40. The method of any one of embodiments 1 to 39 wherein the level of expression of CFD is measured indirectly by the presence of the AG or GG genotype of SNP rs1683591.

41. The method of any one of embodiments 1 to 25 wherein the level of expression is measured at the protein level.

42. The method of embodiment 41, wherein the level of expression is measured using an antibody.

43. The method of embodiment 41, wherein the level of expression is measured using proteomic analysis.

44. The method according to any one of embodiments 1 to 43, wherein the subject or patient is suffering from an inflammatory disease or disorder.

45. The method according to any one of embodiments 1 to 44, wherein the patient is a patient suffering from an autoimmune disease or disorder.

46. The method of embodiment 44 or embodiment 45 wherein the patient is suffering from rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease (IBD), psoriatic arthritis How to suffer from arthritis.

47. The method of embodiment 46 wherein the patient is a patient suffering from RA.

48. The method as in any of embodiments 44-47, wherein the subject has been or is being treated with MTX.

49. The method as in any one of embodiments 44-48, wherein the subject is an insufficient subject for MTX treatment.

50. The method according to any of embodiments 44 to 49, wherein the patient is being treated with a TNF-alpha inhibitor.

51. The method as in any of embodiments 44 to 50, wherein the patient is naïve for treatment of TNF-alpha inhibitor.

52. The method as in any of embodiments 44 to 51, wherein the subject is an insufficient subject for treatment of TNF-alpha inhibitor.

53. The method as in any of embodiments 44 to 52, wherein the subject is an insufficient subject for one or more treatments applicable to the inflammatory disease or disorder.

54. The method as in any one of embodiments 44-53, wherein the subject is an insufficient subject for MTX and TNF-alpha inhibitor treatment.

55. The method as in any of embodiments 44-54, wherein the patient is RF-positive.

56. The method as in any of the embodiments 44-55, wherein the subject is RF-negative.

57. The method of any one of embodiments 1 through 56, wherein the anti-inflammatory agent is an antibody.

58. The method according to any of embodiments 1 to 57, wherein the anti-inflammatory agent is a receptor antagonist.

59. The method of any one of embodiments 1 to 58, wherein the anti-inflammatory agent is an antagonist of one or more members of the IL-10 family.

60. The method of any one of embodiments 1 to 59, wherein the anti-inflammatory agent is at least one antagonist of IL-10, IL19, IL-20, IL-22, IL-24 and IL-26.

61. The method of any one of embodiments 1 to 60, wherein the anti-inflammatory agent is at least one antagonist of IL-19, IL-20 and IL-24.

62. The method of any one of embodiments 1 to 61 wherein the anti-inflammatory agent is an antagonist of IL-20.

63. The method of any one of embodiments 1 to 62 wherein the anti-inflammatory agent is an antagonist of IL-20 and is administered IL-20 of both the IL-20R1 / IL-20R2 and IL-22R / IL- A method for reducing activation.

64. The method of any one of embodiments 1 to 63 wherein the anti-inflammatory agent is an antagonist of IL-20 and is administered IL-20 of both IL-20R1 / IL-20R2 and IL- Activation but not IL19 or IL24 administered receptor activation.

65. The method of any one of embodiments 1-64, wherein the anti-inflammatory agent is an anti-human IL-20 antibody.

66. A method of treating an inflammatory disease or disorder in a subject, wherein the level of expression of one or more of the genes of Figure 1 is altered in comparison to a reference level, and wherein a therapeutic amount of an anti-inflammatory agent is administered to the subject.

67. a. In the patient, considering whether the expression level of one or more of the genes of Figure 1 is altered relative to a reference level,

b. Comprising administering to said patient a therapeutic amount of an anti-inflammatory agent.

A method of treating an inflammatory disease or disorder in a patient.

68. a. Measuring, in the biological sample of the patient, whether the expression level of one or more of the genes of Figure 1 is altered relative to a reference level,

b. Comprising administering to said patient a therapeutic amount of an anti-inflammatory agent.

A method of treating an inflammatory disease or disorder in a patient.

69. a. Measuring the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient,

b. Comparing the level to a reference level of the gene,

c. Determining whether the expression level of one or more of the genes of Figure 1 is altered relative to the reference level,

d. Comprising administering to said patient a therapeutic amount of an anti-inflammatory agent.

A method of treating an inflammatory disease or disorder in a patient.

70. The method according to Embodiment 68 or Embodiment 69, wherein the level of expression of at least one of the genes of Figure 1 is changed in comparison to said reference level in said biological sample.

71. The method as in any of embodiments 68-70, wherein the method is characterized by one or more of the features of embodiments 15-65.

72. A pharmaceutical composition and pharmaceutical composition comprising an anti-inflammatory agent and a pharmaceutically acceptable carrier, packaged together, for treating a patient suffering from an autoimmune disease or disorder with one or more altered expression of the gene of Figure 1 A mark indicating that the article is intended to be produced.

73. The article of manufacture of embodiment 72, wherein the article is characterized by one or more of the features of embodiments 5 to 46.

74. An anti-inflammatory agent for the treatment of an inflammatory disease or disorder in a subject, wherein said subject has at least one altered expression level of the gene of Figure 1 compared to a reference level of said gene.

75. The anti-inflammatory agent of embodiment 74, wherein the anti-inflammatory agent is characterized by one or more of the features of embodiments 15 to 65.

76. A composition comprising at least one detecting agent for determining the level of expression of one or more gene (s) of Table 1.

77. The composition of embodiment 76, wherein the detecting agent is for determining the expression of complement factor D (CFD).

78. The composition of embodiment 76, wherein the detection agent is a CFD probe.

79. The composition of embodiment 76, wherein the detection agent is a CFD primer.

80. The composition of embodiment 76, wherein the detecting agent is a primer for detecting a SNP associated with CFD expression.

81. The method of embodiment 76 wherein the detecting agent detects SNPs associated with CFD expression associated with CFD expression selected from rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs4417648, rs1651891, rs1651890, and rs2930898. Lt; / RTI > primer.

82. A kit comprising a composition according to any one of embodiments 76 to 81 and instructions for use.

83. The kit of embodiment 82, further comprising a reference sample.

84. The kit of embodiment 82 or 83, further comprising a detection agent for standardization.

85. The kit as in any one of embodiments 82-84, wherein the instructions include an indication of whether expression level (s) is associated with a response probability.

86. The kit as in any one of embodiments 82 to 85, wherein the kit is for determining a probability that a patient will respond to the anti-inflammatory agent.

87. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, at least one test is performed in a biological sample of the patient, Wherein the expression level of one or more of the genes of Figure 1 is altered relative to a reference level.

88. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, at least one test is performed in a biological sample of the patient, Wherein the level of expression of one or more of the genes of Figure 1 is altered relative to a reference level and wherein the altered expression level of one or more of the gene (s) relative to the reference level of the gene (s) / RTI >

89. A method of treating an inflammatory disease or disorder in a patient comprising administering to said patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of said anti-inflammatory agent, one of the genes of Figure 1 Wherein the level of expression is determined to be altered relative to a reference level.

90. A method of treating an inflammatory disease or disorder in a patient comprising administering to said patient a therapeutically effective amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, one of the genes of Figure 1 Wherein the expression level is determined to be altered relative to a reference level and wherein the altered expression level of one or more of the gene (s) relative to the reference level of the gene (s) predicts the response of the subject to the anti-inflammatory agent.

91. A method of treating an inflammatory disease or disorder in a patient, said method comprising administering to said patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of said anti-inflammatory agent, Wherein at least one test indicates that the expression level of one or more of the genes of Figure 1 in the biological sample of the patient is altered relative to a reference level.

92.

93. A method of treating an inflammatory disease or disorder in a patient, said method comprising administering to said patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of said anti-inflammatory agent, At least one test indicates that the level of expression of one or more of the genes of Figure 1 in the biological sample of the patient is altered relative to a reference level and wherein the altered expression level of one or more of the gene (s) To predict the response of the subject to the anti-inflammatory agent.

94. A method of treating an inflammatory disease or disorder in a patient, said method comprising administering to said patient a therapeutic amount of an anti-inflammatory agent, prior to administration of said anti-inflammatory agent, according to any one of embodiments 1 to 43 Wherein the expression level of one or more of the genes of Figure 1 in the biological sample of the patient is determined to be altered relative to a reference level.

95. A method of treating an inflammatory disease or disorder in a patient, the method comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein, prior to administration of the anti-inflammatory agent, , The level of expression of one or more of the genes of Figure 1 in the patient's biological sample is varied relative to a reference level and the altered expression level of one or more of the gene (s) relative to the reference level of the gene (s) To predict the reaction of the subject to the subject.

96. The method as in any of embodiments 87 to 94 wherein the subject or patient is a patient suffering from an inflammatory disease or disorder.

97. The method according to any one of embodiments 87 to 94, wherein the patient suffers from an autoimmune disease or disorder.

98. The method of any one of embodiments 87-96, wherein the patient is suffering from a condition selected from the group consisting of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease (IBD), psoriatic arthritis ) Or how to suffer from psoriatic arthritis.

99. The method of embodiment 97, wherein the patient suffers from RA.

100. The method as in any one of embodiments 87-98, wherein the patient has been or is being treated with MTX.

101. The method as in any of embodiments 87-99, wherein the subject is an insufficient subject for MTX therapy.

102. The method as in any of embodiments 87 to 100, wherein the patient is being treated with a TNF-alpha inhibitor.

103. The method as in any of embodiments 87 to 101, wherein the patient is naïve to treatment with TNF-alpha inhibitor.

104. The method as in any of embodiments 87 to 103 wherein the subject is an insufficient subject for treatment with TNF-alpha inhibitor.

105. The method as in any of embodiments 87 to 103, wherein the subject is an insufficient subject for one or more treatments applicable to the inflammatory disease or disorder.

106. The method as in any of embodiments 87 to 104 wherein the subject is an insufficient subject for MTX and TNF-alpha inhibitor therapy.

107. The method as in any of embodiments 87- 105 wherein the patient is RF positive.

108. The method as in any of embodiments 87- 106 wherein the patient is RF-negative.

109. The method according to any of embodiments 87 to 107, wherein the anti-inflammatory agent is an antibody.

110. The method of any one of embodiments 87 to 108, wherein the anti-inflammatory agent is a receptor antagonist.

111. The method of any one of embodiments 87 to 109, wherein the anti-inflammatory agent is an antagonist of one or more members of the IL-10 family.

112. The method of any one of embodiments 87 to 110 wherein the anti-inflammatory agent is at least one antagonist of IL-10, IL19, IL-20, IL-22, IL-24 and IL-26.

113. The method of any one of embodiments 87 to 111, wherein the anti-inflammatory agent is at least one antagonist of IL-19, IL-20 and IL-24.

114. The method of any one of embodiments 87 to 112, wherein the anti-inflammatory agent is an antagonist of IL-20.

115. The method of any one of embodiments 87-113 wherein the anti-inflammatory agent is an antagonist of IL-20 and is administered IL-20 of both the IL-20R1 / IL-20R2 and IL-22R / IL- ≪ / RTI >

116. The method of any one of embodiments 87 to 114, wherein the anti-inflammatory agent is an antagonist of IL-20 and is administered IL-20 of both the IL-20R1 / IL-20R2 and IL- 22R / IL- Activity, but not IL19 or IL24 administered receptor activation.

117. The method of any one of embodiments 87 to 115, wherein the anti-inflammatory agent is an anti-human IL-20 antibody.

118. A method of treating a patient suffering from an inflammatory disease having an increased expression profile of expression of a first biomarker relative to expression of a first biomarker in a person not responding to an inflammatory agent, comprising administering a therapeutically effective amount of an anti- inflammatory agent Wherein the first biomarker is a complement factor D (CFD).

119. The method of embodiment 118 wherein the expression of CFD in a patient afflicted with an inflammatory disease is at least one standard deviation higher than the expression of CFD in a person not responding to an anti-inflammatory agent.

120. The method of embodiment 118, wherein the inflammatory disease is an autoimmune disease or disorder.

121. The method of embodiment 120 wherein the autoimmune disease or disorder is selected from the group consisting of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease (IBD), and psoriatic arthritis Lt; / RTI >

122. The method according to Embodiment 121, wherein the autoimmune disease is RA.

123. The method of embodiment 118, wherein the patient suffering from an inflammatory disease has an expression profile in which the expression of the second biomarker is increased relative to the expression of the second biomarker in a person who does not respond to the anti-inflammatory agent, and the second biomarker is SERPINB9 (A serpin peptide inhibitor and clade B (ovalbumin), member 9).

124. The method of embodiment 118, wherein the patient suffering from an inflammatory disease has an expression profile in which the expression of the second biomarker is increased relative to the expression of the second biomarker in a person who does not respond to the anti-inflammatory agent, and the second biomarker is SERPINB9 (A serpin peptide inhibitor, clade B (ovalbumin), member 9) and ZCCHC24 (zinc finger, CCHC domain containing 24).

125. The method of embodiment 118, wherein the patient suffering from an inflammatory disease has an expression profile in which the expression of the second biomarker is increased relative to the expression of the second biomarker in a person that does not respond to the anti-inflammatory agent, (A zinc finger, CCHC domain containing 24), FN3KRP (a fructosamine 3 kinase related protein), FN3KRP (fructosamine 3 kinase), SERPINB9 (a serpin peptidase inhibitor, clade B (ovalbumin) member 9), ZCCHC24 Related protein), MEOX1 (mesenchymal cell membrane growth factor 1), FGF13 (fibroblast growth factor 13), TUBB2A (tubulin, beta 2A), SLC39A11 (solute carrier family 39 (metal ion transporter) At least one of the group consisting of NPIPL2 (membrane perforating channel-like 4), NPIPL2 (nuclear membrane pore complex interacting protein-like 2), ZNF880 (zinc finger protein 880), and ALDH5A1 (aldehyde dehydrogenase family 5, member A1) ≪ / RTI >

126. The method of any one of embodiments 118 to 125 wherein the anti-inflammatory agent is at least one antagonist of IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26.

127. The method of any one of embodiments 118 to 126, wherein the anti-inflammatory agent is at least one antagonist of IL-19, IL-20 and IL-24.

128. The method of any one of embodiments 118 to 127, wherein the anti-inflammatory agent is an antagonist of IL-20.

129. A method for treating an autoimmune disease,

Identifying a patient with an autoimmune disease;

Determining that the first biomarker expresses a first biomarker, wherein the first biomarker is a complement factor D (CFD);

A method for treating a patient based on the recognition that the anti-inflammatory agent is effective in patients with an autoimmune disease that has an increased expression profile of the first biomarker relative to the expression of the first biomarker in a subject that does not respond to the anti- Selecting an anti-inflammatory agent as an anti-inflammatory agent; And

Administering an anti-inflammatory agent to the patient.

130. The method of embodiment 129 wherein the autoimmune disease or disorder is selected from the group consisting of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease (IBD), and psoriatic arthritis Lt; / RTI >

131. The method of embodiment 130, wherein the autoimmune disease is RA.

132. The method of embodiment 129, wherein the step of selecting an anti-inflammatory agent as a treatment for a patient comprises the step of administering an anti-inflammatory agent wherein the anti- inflammatory agent is selected from the group consisting of Lt; RTI ID = 0.0 > autoimmune < / RTI >disease; The second biomarker is SERPINB9 (Serpin peptidase inhibitor, Clade B (Ovalbumin) member 9), ZCCHC24 (zinc finger, CCHC domain containing 24), FN3KRP (fructosamine 3 kinase related protein), FN3KRP (Tubulin protein), FGF13 (fibroblast growth factor 13), TUBB2A (tubulin, beta 2A), SLC39A11 (solute carrier family 39 (metal ion transporter), MEMOX1 11), TMC4 (membrane through channel-like 4), NPIPL2 (nuclear membrane pore complex interacting protein-like 2), ZNF880 (zinc finger protein 880), and ALDH5A1 (aldehyde dehydrogenase family 5, member A1) ≪ / RTI >

133. The method of any one of embodiments 129-132 wherein the anti-inflammatory agent is at least one antagonist of IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26.

134. The method of any one of embodiments 129-135 wherein the anti-inflammatory agent is at least one antagonist of IL-19, IL-20 and IL-24.

135. The method of any one of embodiments 129-134, wherein the anti-inflammatory agent is an antagonist of IL-20.

136. The method of embodiment 129, wherein determining whether a patient expresses a first biomarker comprises measuring a mRNA.

137. The method of embodiment 136, wherein the measurement of mRNA involves multiplex PCR and qRT-PCR.

138. The method of embodiment 129 wherein the level of expression of complement factor D (CFD) is measured indirectly based on SNPs associated with one or more CFD expression.

139. The method of embodiment 129 wherein the level of expression of complement factor D (CFD) is measured indirectly based on one or more SNPs in the CFD hemispheric blockade.

140. The method of embodiment 138 or embodiment 139 wherein the level of expression of complement factor D (CFD) is selected from the group of rs1683565, rs1683591, rs1683590, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898 A method that is indirectly measured based on SNPs above.

141. The method of embodiment 140, wherein the level of expression of CFD is determined indirectly by the presence of the AG or GG genotype of SNP rs1683591.

142. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, at least one test is performed in a biological sample 1 < / RTI > gene is altered relative to a reference level.

143. A method of treating an inflammatory disease or disorder in a patient, comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, at least one test is performed in a biological sample 1 gene is altered relative to a reference level and the altered expression level of one or more of the gene (s) relative to the reference level of the gene (s) predicts the response of the subject to the anti-inflammatory agent Way.

144. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, one of the genes of Figure 1 Wherein the level of expression is altered relative to a reference level.

145. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, one of the genes of Figure 1 Wherein the level of expression is altered relative to a reference level and the altered expression level of one or more of the gene (s) relative to the reference level of the gene (s) predicts the response of the subject to the anti-inflammatory agent.

General method

Total RNA purification

The total RNA can be obtained in any type of biological sample by a variety of methods known to those skilled in the art.

The examples herein are based on data obtained using PaxGene Blood RNA KIT IVD (QIAGEN), which is particularly suitable for samples that are collected outside of time and need to be analyzed afterwards. PaxGene blood samples were handled according to the manufacturer's instructions (Qiagen) and total RNA was isolated according to the protocol for the PaxGene PAXgenegufdor RNA Kit (QIAGEN).

Globin mRNA reduction

Reduction of globin mRNA in whole RNA samples can be obtained using GLOBINClear kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

RNA integrity check

It is desirable to verify the integrity of the RNA sample before further analysis is performed.

Agilent 2100 Bioanalyzer and total RNA Nano chip (Agilent Technologies, Santa Clara, Calif., USA) can be used according to the manufacturer's instructions. Generally, providing an RNA integrity number (RIN-score) greater than 7 is considered to be acceptable for further analysis.

AffyMetrix GeneChip Hybridization, Scanning and Analysis

Using the total RNA sample, the labeled cRNA (target) was prepared from 50 ng of total RNA by 3 'IVT Express Kit (Affymetrix, Santa Clara, CA, USA) according to the manufacturer's instructions. Hybridization cocktails were prepared as described by the manufacturer and hybridized in Hybridization Oven 640 (Affymetrix) at 45 ° C for 17 hours (60 RPM) in Human Genome U133 Plus 2.0 GeneChips® (Affymetrix). After hybridization, GeneChips were washed and stained at GeneChip® Fluid Engineering Station 450 using the fluid engineering protocol "EukGE-WS2v5_450" (Affymetrix). GeneChips® was scanned on a GeneChip® scanner 3000 (Affymetrix). The resulting "* .cel file" is used to standardize the Robust Multiarray Average (RMA) of GeneChip data by using the R environment and Bioconductor package "Affy", which can be found at URL: cran.r-project.org & bioconductor.org do.

Statistical analysis of microarray data is available as an open-source tool available in the statistical programming environment, R (available at cran.r-project.org), as well as QluCore Omics Explorer 2.2 (QluCore AB, Sweden). The microarray is a Robust Multiarray (RMA) using an Affy package (available at cran.r-project.org) and a custom Chip Definition File (HGU133Plus2_Hs_ENSG) (available at URL: brainarray.mbni.med.umich.edu) Average).

Multivariate predictions are performed using Simca-P + 11 software (Umetrics, Umea, Sweden), and partial least squares (PLS) tools.

ROC (recipient manipulation characteristic) curves are generated using GraphPad Prism 5 (GraphPad Software, CA, USA).

Quantitative RT-PCR

Quantitative RT-PCR analysis is performed by preparing 25 microliters of cDNA from a total of 200 ng total RNA using a random primer and TaqMan Reverse Transcription reagent (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

qPCR assays were performed using a TaqMan PCR core reagent (Applied Biosystems) and an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) in a total volume of 25 microliters in each sample (6,95 microliters of a tenfold dilution of cDNA) Lt; / RTI >

Expression levels of CFD mRNA, ACTB mRNA, and 18S rRNA are determined using primers and FAM-labeled-probes for CFD mRNA and 18S rRNA. Primers and probes were ordered as Assays-on-Demand (Applied Biosystems). The probe sequences for these assays are: CFD (CCTGCTGCTACAGCTGTCGGAGAAG (test ID Hs00157263_m1), ACTB (CCTTTGCCGATCCGCCGCCCGTCCA (test ID: Hs Hs99999903_m1), and 18S rRNA (TGGAGGGCAAGTCTGGTGCCAGCAG; test Hs99999901_s1) (Applied Biosystems), and expression levels were normalized to 18S rRNA or ACTB mRNA.

For reliable assays, PCR products should be detectable within 26 cycles (Ct-value) in the CFD assay (ID: Hs00157263_m1) and detection of 18S rRNA (assay ID Hs99999901_s1) should be obtained at Ct = 12.5. Normalization also uses a standard curve of the diluted plasmid encoding the delta-Ct value, or of CFD, ACTB, and 18S, and uses a quantified number of CFD copies as ACTB or a number of quantified numbers of 18S copies as ACTB Or a number of quantified numbers of 18S copies.

In the above, the official Gene Symbol identifier is used for the analyzed transcript.

Example

Example 1 - Identification of predicted transcription

Blood samples (clinical tials .org identifiers: NCT01038674 and NCT01282255) of the Stage-1b and Stage-2a tests to check the safety, tolerance, and efficacy of anti-IL-20 in patients with rheumatoid arthritis (RA) Patients were collected from the patients: in the Step-1b test, before (Day 1) and on Day 8, Day 15, Day 29, Day 43, and Day 99, Day 1) and at day 15 and day 36 after administration. Patients were dosed once a week for 6 weeks (total 7 doses) and 11 weeks (total 12 doses) each. Total RNA was obtained as described above. After confirmation of globin mRNA reduction and RNA integrity, RNA samples were analyzed by AffyMetrix GeneChip hybridization following the procedure described above.

In order to identify transcripts of whole blood PaxGene samples associated with changes in DAS28-CRP and other disease score measures similar to ACR20, ACR50, and ACR70, we performed a step of examining the effect of anti-IL-20 antibodies in RA patients Regression analysis of the expression profiles of the individual patients enrolled in Step-1b and Step-2a was performed. Based on the samples obtained predominantly (baseline) and on samples taken predominantly on days 8, 15, 29, 36, and 43, they exhibit relative safety over time, Were selected.

We also pursued a multivariate approach to correlate the obtained microarray data points with clinical efficacy.

By using Partial Least Squares (PLS) predictions for latent structures, we identified the best combination of transcripts to predict clinical effects in individual patients treated with anti-IL20. The identified PLS models were cross-validated by permutation tests (reducing the R ² -coefficients for the association between observed and predicted data of 0.8-0.1). This indicates that the PLS model is valid and has not been overloaded. PLS-based forecasting can be performed with any multivariate analysis software tool (Like Simca-P + 11 (Umetrics) or Unscrambler (CAMO software AS, Oslo, Norway). Initially multivariate predictions are made using 18954 data points from the AffyMetrix microarray An embodiment of a set of 14 predicted transcripts is shown in FIG.

In the multivariate-based prediction model, the desired gene was complement factor D (CFD), also known as adipicin. The level of CFD transcript in RA patients is shown in FIG. The levels of mRNA expression in individual patients are stable over time, but differences between patients are evident. The difference between patients with the lowest levels of CFD mRNA and those with the highest levels was almost 8 times.

As shown in Figure 1, CFD was a transit of positive associations in univariate regression analysis. At the same time, these findings prompted the testing of the usefulness of CFD as a high-response predictor in RA-treated patients with anti-IL20 antibodies. This was done by making the receiver operating characteristic (ROC) -curve as shown in Figure 4 (ACR50 response) and Figure 5 (ACR70 response). The area under the curve for the ACR50 response (AUC) was found to be 0.81 (p = 0.00068), indicating a good prediction of the ACR50 response based on CFD mRNA levels.

To test whether CFD mRNA could be a predictor of high response in the anti-IL20 RA-test, thresholds for optimal classification of patients were defined for ACR50 and non-responders, as well as for ACR70 and non-responders Respectively. This was carried out with average CFD-mRNA levels obtained from the four samples collected on Day 1 (before dosing) and on Days 15 and 36. As previously described, CFD mRNA levels were found to be stable over time in these visits. For the ACR50 classification, we found a CFD mRNA threshold of 10.32 (log2 scale at the RMA standard Affymetrix microarray level) (as indicated by X in FIG. 4).

The ACR50 response rate was found to be significantly increased from 37% to 65% when applying this threshold (above 10.32) in RA patients treated with the anti-IL20 antibody from the Phase 2a test data (FIG. 7). Applying an inclusion threshold of 10.32 or greater will include almost half of the patients enrolled in the Phase 2a trial. Similar to the ACR70 response, a threshold of 10.32 in patients receiving RA was found to increase the response rate from 25% to 45%. The abundance of response rate when applying the threshold of 10.32 is specified in FIG.

In patients with a CFD mRNA level of 10.32 or greater in a placebo-treated individual in the Phase 2a trial, the ACR50 response rate was 17% compared to 11 patients with a CFD mRNA level lower than 10.32. The response rate of patients treated with placebo with a CFD mRNA level of at least 10.32 for ACR70 was 8% compared to 0% in patients with CFD mRNA levels below 10.32.

Based on the above analysis, the CFD mRNA level is a good predictor of the high response to anti-IL-20 in patients with RA, especially when included only RA patients with CFR mRNA levels above 10.32 in ACR50 and ACR70 responses It can be obtained.

Example 2 - Association of qRT-PCR with array data

To examine whether CFD mRNA baseline (pre-dose) measurements were associated with CFD mRNA levels at other time points assessed by microarray analysis alone, qRT-PCR was performed on CFD mRNA for pre-dose samples available 0.0 > CFD < / RTI > level recorded from the microarray. Quantitative RT-PCR analysis was performed as described hereinabove and data was obtained from two-fold analysis of each cDNA sample. The CFD mRNA levels of the qRT-PCR platform were normalized to 18S rRNA levels determined by qRT-PCR. To associate microarray levels with qRT-PCR levels, the RNA standardized microarray levels were transformed to linear scales. As shown in FIG. 6, we found a high degree of association (R ² = 0.86) between qRT-PCR measurements at the baseline and microarray measurements at various visits. This indicates that the CFD-based stratification of the RA-patient in the baseline (prior to administration) is feasible, and that the transitions of other predictions, such as CFD, described in Figures 1 and 2, , They were also chosen to exhibit stability over time (as exemplified by the CFD association in Figure 6). The transcripts described herein are therefore particularly suitable for predisposing stratification to predisposed patients in highly responsive patients.

PCR products should be detected within 26 cycles (Ct-value) in CFD assays (ID: Hs00157263_m1) to obtain stratification based on stratification-based qRT-PCR data obtained at a threshold of 10.32 using microarray data. , Detection of 18S rRNA (test Hs99999901_s1) should be obtained with Ct = 12.5. These values correspond to approximately 10.25 in the RMA magnitude of the microarray value, as measured on a sample of individual patients, where the two array detections are close to 10.32 and the average is 10.24. Using the qRT-PCR assay, the detection of CFD of this patient is obtained with a Ct-value of 26 and an 18s control with a Ct value of 12.5.

It is also possible to measure the level of expression of the complement factor D (CFD) level by qRT-PCR and the assay ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) for CFD and Hs99999903_m1 (Applied Biosystems / Invitrogen) for ACTB An anonymous number of at least 0.04 copies per CFD per copy of the beta-acted mRNA (gene signature ACTB) used is a threshold value for improved response.

Example 3 - Disease relevance of CFD mRNA levels in PaxGene samples

To assess whether the CFD levels of peripheral blood in patients with RA were associated with appropriate active markers in the local joints, both PaxGene (whole blood) and joint fluid samples were collected. Complement factor D is an early serine protease in alternative complement pathway activation and cleaves C3b complexed with factor B into C3bBb and Ba. C3bBb is a C3 con- verter that divides additional C3 molecules into C3a and C3b. Since the Bb molecule is unique to alternative complement activation, the level of Bb protein acts as an active marker for this pathway. There is strong evidence that both classical and alternative complement activation are supported by the pathophysiology of rheumatoid arthritis.

A Bb plus EIA (MicroVue product number A027) assay (assay to measure the amount of complement fragment Bb in human plasma or serum) was prepared according to the kit protocol.

Wash buffer (x20) was diluted in demineralised water. 1% HBR1 (18, 42 mg / ml of heterologous antigenic blocker (HBR1) from Scantibodies Lab. Part 3KC533) was added to the wetting agent and 1% HBR was added to the supplemental sample dilution (80 μl HBR1 + 7,92 ml). The reconstituted specimens and controls were diluted in 1 ml of hydration reagent / HBR1 and left for 15 minutes. Samples were diluted 10 times (45 μl + 405 μl) and 20 μl (22 μl + 418 μl) in supplemental sample diluent + 1% HBR1.

Samples were pre-washed 3 times and incubated with 100 μl standard for 30 minutes, washed 5 times, incubated with 50 μl conjugate for 30 minutes, washed 5 times, incubated for 15 minutes with 100 μl substrate, RTI ID = 0.0 > 100 < / RTI >

Absorbance was determined by an ELISA meter installed on a meter set at 450 nm (see 600-690 nm) fitted to a linear curve.

By using the MicroVue Bb Plus EIA assay and HBR1, we were able to measure the level of Bb in the joint fluid of RA patients. A significant association was found when plotting these levels for the CFD mRNA levels of the paired PaxGene samples of the same patient, as shown in FIG.

These findings show that the level of CFD mRNA in the whole blood of RA patients represents an alternative state of complement pathway in the local joints.

Since CFD mRNA levels in whole blood of RA patients are related to the activation status of alternative complement pathways in the tribo-articular joint (the association between CFD mRNA and Bb levels in the PaxGene sample and BSA levels), PaxGene samples from RA patients It is tempting to speculate that CFD mRNA levels may also be predictors of treatment targeting complement activation.

Example 4 - Analysis using single nucleotide polymorphism (SNP)

As an alternative to measuring CFD mRNA levels in PaxGene samples, the analysis of specific single nucleotide polymorphisms (SNPs) in the CFD half-shedding block can provide a convenient way of predicting response. The bimodal distribution of CFD mRNA in PaxGene and other samples clearly indicates that genetic polymorphism may be a basic explanation for the CFD mRNA expression pattern. One skilled in the art can perform an expression quantitative trait locus (eQTL) analysis on CFD and identify SNP associations or binding to CFD expression levels. An example of a SNP that exhibits strong binding to CFD mRNA expression levels in CFD and its haplotypic blockade of its neighbors has the identity rs1683565. The measurement of this SNP, or other SNPs, which exhibit strong binding imbalance for rs1683565 includes hybridization-based methods (e. g., SNP microarrays) and enzyme-based methods (e. g. PCR and restriction fragment length polymorphism methods) But can be implemented by many other means not limited. Other SNPs that exhibit strong binding imbalance for rs1683565 include, but are not limited to, SNPs with identity rs1683591, rs1683590, rs1683569, rs1653588, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890, and rs2930898.

As an example, SNP rs1683591 provides AA, AG, or GG genotypes. Based on its association with CFD expression, the AA genotype corresponds to a low CFD expression (significantly lower response rate), while the AG and GG genotypes represent a higher probability of responding to higher levels of CFD expression and thus anti-inflammatory agents.

Other SNPs (rs1683565, rs1683591, rs1683574, rs1653588, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890, and rs2930898) that exhibit strong binding to the above-mentioned SNPs, But not limited to, methods (e. G., SNP microarrays) and enzyme based methods (e. G., PCR and restriction fragment length polymorphism methods).

In one embodiment, a blood sample was drawn from the patient and genomic DNA was isolated by the reagent DNAzol (Becton Dickinson) according to the manufacturer's instructions. Briefly, 1 ml DNAzol® is mixed with 0.5 ml of whole blood by vortexing or manual mixing. DNA is precipitated from the sample by adding 0.4 ml isopropanol to the DNAzol (R) BD-Blood Lysate. The resulting mixture is vortexed and stored at room temperature for 5 minutes. Spin down DNA precipitated by centrifugation at 6,000 xg for 6 minutes. Remove the supernatant and add 0.5 ml of DNAzol to the DNA pellet. Vortex or shake the DNA pellet until it is completely dissolved. The resulting mixture is centrifuged at 6,000 xg for 5 minutes. The supernatant is then removed and the DNA pellet is washed by mixing with 1 ml of 75% ethanol and centrifuged at 6,000 xg for 5 minutes. Without removal of ethanol and without drying, 200 μl of 8 mM NaOH is added to the DNA pellet and incubated at room temperature for 3-5 minutes, followed by solubilization by vortexing. The alkaline DNA solution is neutralized with 0.1 M HEPES. From the isolated DNA, prepare a quantitative polymerase chain reaction (qPCR) with specific assays for the desired SNP. The qPCR setting can be based on a TaqMan probe designed to specifically detect the desired SNP. As an example, a SNP with identity rs1683565 can be detected by any probe and / or primer combination that can identify the sequence AGAGCCCAAAGCTCATGGAAAAGAG [A / G] ATATGAAAGGAGTCCCTGCAGTAGA. This can be performed by a commercially available assay from Invitrogen (Product Number: 4351379 ID: C 9612061_10). In yet another embodiment the SNP with identity rs1683591 will be detected by any probe and / or primer capable of identifying the sequence TCTGTCCACAGGCGGGGGTGGAGGG [A / G] ATGGCCGGCCTCACACCATCTGCCA. This can be done by a commercially available assay from Invitrogen (Product Number: 4351379 ID: C 9612100_10). In the third embodiment, the SNP with identity rs1683590 will be detected by any probe and / or primer combination that can identify the sequence AATATCTGAAATTTTCCCAGTTTAC [A / G] AGCCTCTGACGTAACCGTCCTCTCT. This can be performed by the commercially available assay of Invitrogen (Product Number: 4351379 ID: C 3153459_10). For TaqMan® genotyping assays, an equivalent of 1 to 10 ng of DNA template per reaction well should be added. To quantify genomic DNA, use a reliable method, such as the A260 assay. Rotate the bottle and mix thoroughly the TaqMan® GTXpress ™ Master Mix (Invitrogen (Cat. 4403311)) and mix the genomic DNA with the TaqMan® genotyping assay as described by the manufacturer. PCR was carried out for 40 cycles (primer annealing at 95 ° C for the first 20 seconds, and then at 60 ° C for 20 seconds in the ABI PRISM 7900HT Sequence Detection System equipped with a compatible PCR instrument (eg FAST block) And then denatured for 3 seconds at 95 [deg.] C). After PCR amplification, end-point plate reading is performed in real-time PCR. Plot the signal values with Invitrogen's SDS software, which uses each fluorescence emission measurement well made during plate reading. The software determines which alleles are present in each sample for subsequent allele identification analysis.

                         SEQUENCE LISTING <110> Novo Nordisk A / S        Frederiksen, Klaus S.   <120> METHODS RELATED TO TREATMENT OF INFLAMMATORY DISEASES AND        DISORDERS <130> 8452.204-WO <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CFD probe <400> 1 cctgctgcta cagctgtcgg agaag 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA probe <400> 2 tggagggcaa gtctggtgcc agcag 25 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> Synthetic sequence <220> <221> variation &Lt; 222 > (26) <223> n is a or G <220> <221> misc_feature &Lt; 222 > (26) <223> n is a, c, g, or t <400> 3 agagcccaaa gctcatggaa aagagnatat gaaaggagtc cctgcagtag a 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> Synthetic sequence <220> <221> variation &Lt; 222 > (26) <223> n is a or G <220> <221> misc_feature &Lt; 222 > (26) <223> n is a, c, g, or t <400> 4 tctgtccaca ggcgggggtg gagggnatgg ccggcctcac accatctgcc a 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> Synthetic sequence <220> <221> variation &Lt; 222 > (26) <223> n is a or G <220> <221> misc_feature &Lt; 222 > (26) <223> n is a, c, g, or t <400> 5 aatatctgaa attttcccag tttacnagcc tctgacgtaa ccgtcctctc t 51 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> Synthetic sequence <400> 6 cctttgccga tccgccgccc gtcca 25

Claims (16)

Claims 1. A method for predicting a response of a subject to an anti-inflammatory agent, comprising: obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said patient, Wherein the altered expression of one or more of the gene (s) relative to the level predicts the response of the subject to the anti-inflammatory agent. A method for predicting a patient's response to an anti-inflammatory agent,
a. Measuring the level of expression of one or more gene (s) of Figure 1 in the patient &apos; s biological sample and
b. Comparing the level to a reference level of the gene (s)
Wherein the altered expression of one or more of the gene (s) in comparison to the reference level predicts a patient &apos; s response to an anti-inflammatory agent. As a method for identifying a subject having an increased probability of responding to an anti-inflammatory agent,
Obtaining information about the level of expression of one or more gene (s) of Figure 1 in a biological sample of said subject, wherein said altered expression of one or more of said gene (s) RTI ID = 0.0 &gt; a &lt; / RTI &gt; increased likelihood of responding to an anti-inflammatory agent. As a method of identifying a patient having an increased probability of responding to an anti-inflammatory agent,
a. Measuring the level of expression of one or more gene (s) of Figure 1 in the patient &apos; s biological sample and
b. Comparing the level to a reference level of the gene (s)
Wherein the altered expression of one or more of the gene (s) in comparison to the reference level of the gene (s) indicates that a patient with increased likelihood of response to the anti-inflammatory agent has been identified. 5. The method according to any one of claims 1 to 4,
a. The altered expression of the gene of Figure 1A is increased relative to the reference level and / or
b. RTI ID = 0.0 &gt; 1B &lt; / RTI &gt; is reduced compared to a reference level. 6. The method according to any one of claims 1 to 5, wherein the level of expression is measured in a blood sample based on mRNA using multiplex PCR or qRT-PCR, or PCR, such as a microarray chip Way. 7. A method according to any one of claims 1 to 6, wherein the level of expression of complement factor D (CFD) is higher than the reference level. 8. The method according to any one of claims 1 to 7,
a. Levels of expression of complement factor D (CFD) were measured by qRT-PCR and transcripts were detected with a periodic threshold value (Ct) of 30 using test ID: Hs00157263_m1 (Applied Biosystems)
b. The level of expression of complement factor D (CFD) is measured using microarray chips and the level of expression is greater than 9.5 at the log2 scale of RMA or GC-RMA normalized expression values
c. The level of expression of complement factor D (CFD) was measured by qRT-PCR and the transcript was analyzed using CFD at least 0.04 copies per copy of beta-actin mRNA using the assay ID: Hs00157263_m1 (Applied Biosystems / Invitrogen) Detected as an anonymous number
d. Wherein the level of expression of complement factor D (CFD) is measured indirectly based on the SNP associated with one or more CFD expression. A method of treating an inflammatory disease or disorder in a patient comprising administering to the patient a therapeutic amount of an anti-inflammatory agent, wherein prior to administration of the anti-inflammatory agent, One test shows that the level of expression of one or more of the genes of Figure 1 in a biological sample of a vital patient is altered relative to a reference level and that the altered expression level of one or more of the gene (s) A method for predicting the response of a subject to an anti-inflammatory agent. 10. A method according to any one of claims 1 to 9, wherein the subject or patient is selected from the group consisting of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease (IBD), psoriatic arthritis PSA) or psoriasis. &Lt; Desc / Clms Page number 13 &gt; 11. The method according to any one of claims 1 to 10, wherein the anti-inflammatory agent is at least one antagonist of IL-19, IL-20 and IL-24. 12. The method according to any one of claims 1 to 11, wherein the anti-inflammatory agent is an anti-human IL-20 antibody. Wherein the patient has at least one altered expression of the gene of Figure 1 compared to a reference level of the gene (s). Claims: 1. A pharmaceutical composition and pharmaceutical composition comprising an anti-inflammatory agent and a pharmaceutically acceptable carrier, packaged together, said that the expression of one or more of the genes of Figure 1 is useful for treating a patient suffering from an autoimmune disease or disorder &Lt; / RTI &gt; a. One or more compositions comprising at least one detecting agent to determine the level of expression of one or more gene (s) of Table 1A and / or Table 1B, and
b. A kit comprising instructions for use of a kit, the kit comprising a method of associating an expression level (s) with a response probability of the subject. 16. The kit according to claim 15, wherein the detecting agent is for determining the expression of complement factor D (CFD).

Images