CN106834449B - With the associated interleukin 21 receptor of primary biliary cholangitis and its application - Google Patents
With the associated interleukin 21 receptor of primary biliary cholangitis and its application Download PDFInfo
- Publication number
- CN106834449B CN106834449B CN201710015653.0A CN201710015653A CN106834449B CN 106834449 B CN106834449 B CN 106834449B CN 201710015653 A CN201710015653 A CN 201710015653A CN 106834449 B CN106834449 B CN 106834449B
- Authority
- CN
- China
- Prior art keywords
- pbc
- il21r
- primary biliary
- allele
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention discloses application of the interleukin 21 receptor (IL21R) in the product of preparation detection or auxiliary detection, screening or prediction primary biliary cholangitis (Primary Biliary Cholangitis, PBC).Invention additionally discloses to the mononucleotide polymorphic site of the significant relevant interleukin 21 receptor of primary biliary cholangitis neurological susceptibility are as follows: rs1859308, rs201883233, rs10852316, rs2189521, rs58579343.Present invention firstly discovers that multiple gene polymorphism sites of IL21R are significant related to the generation of PBC, it can be used for one of the index of PBC onset risk prediction.
Description
Technical field
The invention belongs to field of immunology, and in particular to the associated interleukin 21 of primary biliary cholangitis by
Body (IL21R) and its application.
Background technique
Primary biliary cholangitis (primary biliary cholangitis, PBC), is once called as primary biliary
Cirrhosis (primary biliary cirrhosis) is a kind of Chronic Progressive autoimmunity for involving stones in intrahepatic bile duct system
Property disease, be mainly shown as in liver that small bile duct progressive is destroyed sexually revises with Portal inflammation, eventually leads to fibrosis and cirrhosis.
This disease takes place mostly in women above middle age, and male's case only accounts for 10%.With the continuous improvement and diagnosis to PBC disease cognitive
The foundation of method, the disease incidence and illness rate of PBC are in rising trend in the whole world.2003, in District of Shanghai to 5011 health
(26-85 years old) PBC specificity anti-mitochondrial antibody (AMA) (PDC-E2) of examinee carries out screening, and discovery AMA positive rate is higher than
0.16%, 0.3% [5] are higher than in female middle-aged.2006, in In Guangdong Province to the general of 8126 adults (18-83 years old)
The positive rate for looking into middle discovery AMA (PDC-E2) is higher than 0.05%, and 0.15% is higher than in female middle-aged.Recently in District of Shanghai pair
The AMA screening results of 19012 residents find that 0.40% male and 0.94% women AMA are positive, wherein 25 people
(0.13%) PBC is suffered from.With the aging of China's population, PBC will be rapidly developed in China into a kind of more typical disease
Disease was likely to be breached ten thousand patient of 20-30 in 2025, may be up to ten thousand patient of 35-50 to the year two thousand fifty.
Early diagnosis and therapy is the most effective means for controlling the development of PBC disease.The treatment of PBC is lacked effectively at present
Method, ursodesoxycholic acid are the medicines uniquely controling effectively to early stage PBC patient (especially jaundice do not occur patient)
Object, but acted on without healing, and the only resource for saving advanced stage PBC patient is to implement liver transplant.China is virus hepatitis height
The clinical symptoms of the country of hair, PBC are similar to virus hepatitis, and PBC patient is often misdiagnosed as virus hepatitis or drug early stage
Property hepatitis, has seriously affected the diagnosis and treatment of PBC patient.Therefore, early diagnosis and therapy is carried out to PBC patient, there is important society
It can meaning.
PBC has very strong genetic predisposition, and the PBC disease incidence of the first generation relatives of patient is 100 times higher than general population.
The report of comprehensive North America, Europe and Japan, the familial incidence of PBC are 3.8-9%.2005, one in the extensive of North America
Investigation result shows that the relative risk (odds ratio) of patient PBC lineal relative morbidity is up to 10.7.Pass through PBC patient
Homozygotic twin analyzed, find its co-morbid rate up to 63%.Our team are at the past 4 years to domestic PBC patient's
Having found the PBC patient of 3 pairs of enzygotic twins in investigation, the sister's disease symptom and disease time of three couples of patients is all very close,
In conjunction with international data with existing, the homozygotic twin co-morbid rate of PBC patient is up to 72.7%.
Since two thousand nine, PBC tool is shown to the series of results of white man PBC patient whole-genome association (GWAS)
There is very strong genetic predisposition.To apply the North America PBC cooperation group of artificial core member using GWAS and specific site high density
The method of Polymorphism Analysis carries out cohort analysis to North America PBC patient and control crowd, it was confirmed that the inheritance susceptible of PBC
Property and the close phase in the sites such as HLA-II class antigen, IL12A, IL12RB2, STAT4, IRF5, ch17q12-21, MMEL1 and SPIB
It closes, and discloses IL12R signal transduction pathway and Toll-like receptor (TLR)/TNF signal transduction pathway possibility extremely
Lead to the generation of PBC.It is closely related with PBC that the small-scale GWAS research of Japanese scholars has also discovered the site TNFSF15.China
Has certain basis to the genetics research of PBC, domestic scholar is respectively with regard to the gene locis such as HLA and CTLA4 and Han nationality PBC
Genetic predisposition has carried out Primary Study.
We start and complete the Illumina China chip scanning work to 1122 Han nationality's PBC samples, in conjunction with
4046 contrasting datas, have carried out large-scale cohort analysis, find for the first time in the world and confirm the gene loci of IL21R
Reach GWAS conspicuousness, and finds IL21R overexpression in PBC blood samples of patients for the first time, expression degree and liver group
Textured fiber degree is proportional.
Patent document there is no to refer to the relationship of IL21R gene loci and IL21R and PBC in the world at present.
Summary of the invention
Goal of the invention: there is provided IL21R in preparation detection or auxiliary for first technical problem to be solved by this invention
Application in the product of detection, screening or prediction primary biliary cholangitis.
That there is provided a series of is significant with primary biliary cholangitis for second technical problem to be solved by this invention
Relevant mononucleotide polymorphic site (SNP), and find out wherein be associated with primary biliary cholangitis neurological susceptibility it is most significant
Representative site, to provide the mononucleotide polymorphic site (SNP) is easy for assessing primary biliary cholangitis
The purposes of perception.
There is provided IL21R to prepare the application in PBC animal model for third technical problem to be solved by this invention.
4th technical problem to be solved by this invention answering in terms of preparing PBC therapeutic agent there is provided IL21R
With.
Technical solution: in order to solve the above-mentioned technical problem, the technical scheme adopted by the invention is as follows: in a first aspect, providing
IL21R preparation detection or auxiliary detection, screening or predict primary biliary cholangitis product in application.We open
The Illumina China chip scanning work to 1122 Han nationality's PBC samples is moved and completes, in conjunction with 4036 contrasting datas, into
It has gone large-scale cohort analysis, has found for the first time in the world and confirm that the gene loci of IL21R has reached GWAS conspicuousness,
And discovery IL21R expresses degree in PBC patient's liver organization for the first time and liver organization degree of fibrosis is proportional；Especially by
Whole-genome association finds that the gene pleiomorphism of IL21R and PBC morbidity have substantial connection.
Second aspect provides a series of to the monokaryon glycosides of the significant relevant IL21R of primary biliary cholangitis neurological susceptibility
Sour polymorphic site is used by being research object to 1122 Chinese Han nationality PBC Patient Sample As and 4036 normal human samples
HumanOmniZhongHua-8 (v1.1) scanning carries out the analysis of full-length genome associated data, carries out point of gene pleiomorphism (SNP)
Type, the data obtained using chip, the comparative analysis using PLINK software to all polymorphic sites find the more of IL21R gene
There were significant differences in PBC and normal population for the frequency of a SNP.With the mononucleotide polymorphic site of IL21R are as follows: rs1859308,
Allele is C/T；Rs201883233, allele A/C；Rs10852316, allele C/A；Rs2189521, etc.
Position gene is A/G；Rs58579343, allele A/G.
The third aspect, the present invention carry out linkage disequilibrium value by SNP to the site IL21R, find multiple SNP with
The linkage relationship of rs10852316, rs2189521.Using the iPlex method of Sequenom, for wherein rs10852316,
Rs2189521 polymorphic site carries out verification test；And Impute2 and PLINK software is used, logistic regression principle carries out, with
Gender is covariate, by synergistic effect model analysis；It is again seen that there were significant differences；All SNP in table 1 be in PBC and
There is the gene polymorphic site of marked difference between control, can be used for the risk profile to PBC.
Fourth aspect, by the present invention in that logistic regression principle carries out analysis and assesses each SNP site with PLINK software
With the relationship of primary biliary cholangitis, the relative risk (Odd ratio, OR) and 95% of dangerous allele is calculated
Credibility interval obtains a series of dangerous allele of this SNP site.The dangerous allele of the SNP site of IL21R is distinguished
Be: rs1859308 polymorphic site is C；Rs201883233 polymorphic site is A；Rs10852316 polymorphic site is C；
Rs2189521 polymorphic site is A；Rs58579343 polymorphic site is A.
5th aspect, the present invention is by the way that IL21R special tissue chemical analysis, to 30 PBC patients, 30 itself are exempted from
The liver tissue slices of epidemic disease hepatitis (AIH), 25 chronic hepatitis B patients (CHB) and 6 normal controls (HC) carry out
The expression of IL21R albumen is measured, it is found that IL21R significantly increases (P < 0.01) in PBC patient's liver organization, IL21R's
The degree of inflammation and degree of fibrosis of expression and PBC patient's liver organization are positively correlated.
IL21R expression or activation preparation PBC animal model are introduced in terms of 6th, in the animal model that the present invention establishes, and
This model is used for the screening of PBC therapeutic agent.
The utility model has the advantages that the present invention have the advantages that following characteristic and:
1) present invention firstly discovers that multiple gene polymorphism sites of IL21R are significant related to the generation of PBC, can be used for
One of the index of PBC onset risk prediction.
It 2) is the target that can be used for PBC targeted therapy present invention discover that IL21R is significantly increased in PBC patient's liver organization
Point.
3) preparation PBC animal model is expressed or activated to the discovery invented possibly through IL21R is introduced in animal model,
And this model to be used for the screening of PBC therapeutic agent.
Detailed description of the invention
Fig. 1 is the associated diagram of identified IL21R gene region mononucleotide polymorphism site and PBC in embodiment 1；Figure
In 1: abscissa " Position on chr " is the position (unit Mb) on chromosome；Ordinate is single nucleotide polymorphism position
Point is associated with conspicuousness P value (- log10 (p-value)) with PBC's, and right side Recombination rate is recombination fraction, unit
(CM/Mb)；Represent site rs2189521 with ◆ indicate.
Fig. 2 is that tissue chemical analysis IL21R suffers from 30 PBC patients, 30 autoimmune hepatitis (AIH) in embodiment 3
Person, the expression in 25 chronic hepatitis B (CHB) patients and 6 normal control (HC) liver tissue slices.Fig. 2A is to implement
In the expression of the IL21R of 1 PBC patient tissue liver tissue slices in example 3.Fig. 2 B is in embodiment 3 in 1 AIH patient group
Knit the expression of the IL21R of liver tissue slices.Fig. 2 C is in embodiment 3 in 1 CHB patient tissue liver tissue slices
The expression of IL21R.Fig. 2 D is to organize the expression of the IL21R of liver tissue slices in 1 HC in embodiment 3.Fig. 2 E is embodiment 3
Middle IL21R is in 30 PBC patients, 30 AIH patients, 25 chronic hepatitis B (CHB) patients and 6 normal (HC) livers
The statistic analysis result of expression in histotomy (* * * is P < 0.001, and * * is P < 0.01).Fig. 2 F is IL21R in embodiment 3
Expression and the analysis knot of the liver organization degree of inflammation correlation of PBC patient in the liver tissue slices of 30 PBC patients
Fruit.Fig. 2 G is expression and the liver organization of PBC patient of the IL21R in the liver tissue slices of 30 PBC patients in embodiment 3
The analysis result of degree of fibrosis correlation.
Specific embodiment
Below by specific embodiment and attached drawing, the present invention is further described.
Experimental material used, main agents and formula are as follows in the embodiment of the present invention:
Main experimental materials and main agents:
1, the DNA sample and serum of primary biliary cholangitis patient and normal control population；
2, it whole-genome association chip analysis kit: is produced by Illumina company
HumanOmniZhongHua-8 (v1.1) assay kit includes chip and reagent.
Main solution is prepared:
1, phosphate buffer (PBS, 1L): 8g NaCl, 0.2g KCl, 0.24g KH2PO4, 3.628g Na2HPO4·
12H2O, distilled water are settled to 1L；
2, saturated sodium chloride solution (5M NaCl, 1L): 292.5g NaCl, distilled water dissolution is settled to 1L；
3,1M Tris-HCl buffer (pH 8.0): 30.3g Tris base is dissolved in 200ml distilled water, and hydrochloric acid is adjusted
PH value is settled to 250ml to 8.0；
4,0.5M EDTA (PH 8.0): 36.5g EDTA is dissolved in NaOH solution, is adjusted pH to 8.0, is settled to 250ml；
5, nuclei lysis buffer (Nuclei Lysis Buffer, 500ml): 40ml 5M NaCl, 2ml 0.5M EDTA
(PH8.0), 5ml 1M Tris-HCl (pH 8.0), 453ml distilled water；
6, proteinase K buffer (Proteinase K buffer, 100ml): 50ml glycerol, 100ul 1M
Tris-HCl (pH7.5), 200 μ l 1M CaCl2, 47ml distilled water；
7, Proteinase K (Proteinase K Solution, 10mg/ml): 100mg Proteinase K powder is dissolved in 10ml albumen
In enzyme K buffer；
8, digestive juice (Nuclei-SDS-Proteinase K-Master Mix Lysis buffer, 504ml): 420ml
Nuclei Lysis Buffer, 3.5ml Proteinase K (10mg/ml), 17.5ml 10%SDS, 0.35ml 0.5M
EDTA (PH 8.0), 62.65ml distilled water；
9, TE buffer (PH 8.0): 1ml 1M Tris-HCl buffer (pH 8.0), 0.2ml 0.5M EDTA (PH
8.0), distilled water is settled to 100ml；
10,6 × DNA spotting buffer (10ml): 88mg EDTA, 5mg bromophenol blue, 5mg dimethylbenzene is green, is dissolved in the bis- steamings of 4ml
In water, adds after 3.6ml glycerol and be adjusted to PH7.0 using NaOH, be settled to 10ml；
11,50 × TAE buffer: 242g Tris-base, 57.1ml glacial acetic acid, 200ml 0.5M EDTA (PH 8.0),
Distilled water is settled to 1L.
1 whole-genome association of embodiment
The present invention has found being associated with for IL21R gene loci and primary biliary cholangitis by following methods and step.
One, method
1122 Chinese Han nationality PBC Patient Sample As and 4036 normal human samples are had chosen in Chinese han population first
For research object, HumanOmniZhongHua-8 (v1.1) scanning is carried out, the parting of gene pleiomorphism (SNP) is carried out, is used
Comparative analysis of the PLINK software to all polymorphic sites finds the frequency of multiple SNP of IL21R gene in PBC and normal population
In there were significant differences.
Two, case and check sample inclusion criteria
All PBC patients for being included in research meet following standard: 1), all patients be Han nationality；2), AMA-M2 serum
Learn tests positive；3), biochemical indicator shows cholestasis evidence, is mainly shown as that ALP, GGT are increased；5), all kinds of hepatitis
Negative (hepatitis B virus surface antigen is negative, hepatitis B virus DNA in serum for poison infection and HIV infection index
Less than Hepatitis C virus RNA in 200 copy numbers/milliliter, serum less than 500 copy numbers/milliliter, viral hepatitis type E antigen negative, human immunity
Defective virus negative antibody)；6), without infection by Schistosoma history；7) patient main suit's drinking amount is less than 100ml/ days.
Genome-wide screening compares population sample and comes from Anhui, and Jiangsu, the normal Check-up crowd in Shandong, biochemical indicator is just
Often, no clinical disease characterization, readme body are strong.Case was screened between 22~85 years old, and average age is 54.7 years old；Control is 15 years old
It is screened between by 96 years old, average age is 34.8 years old.
Three, the essential characteristic of crowd is tested
Test crowd is that chip detection its essential characteristic of sample is as follows:
Table 1
Four, the preparation of the genome DNA sample of primary biliary cholangitis (PBC) patient and normal control population
1, the non-anticoagulation of patient and normal person are acquired in non-anticoagulation collecting pipe by each hospital.Collecting pipe is centrifuged,
Separate serum and blood clot.The serum on the blood sample upper layer of defrosting is mixed gently with pipettor in superclean bench, is dispensed
Enter 4 1.5ml blind nuts and save pipe, is stored in -80 DEG C.
2, separation gel is taken out with ladle, clot is poured into weighing boat, is sufficiently shredded clot with scissors, then inhaled with plastics
Broken clot is transferred in 50ml centrifuge tube by pipe.
3, weighing boat is rinsed with PBS buffer solution and heparin tube, recovery and rinsing liquid are mixed to 50ml centrifuge tube with plastic suction pipe
Liquid, centrifugation, 2500rpm, 15min, abandon supernatant by 4 DEG C.
4, plus 5ml digestive juice, mixing are put into water-bath constant temperature oscillator, 50 DEG C, 200rpm is digested overnight.
5, add 1.5ml 5M NaCl after digestion completely, mix；It is stored at room temperature 10min, is during which mixed by inversion repeatedly centrifugation,
3800rpm, 30min, room temperature.
6, transfer supernatant adds 2 times of volume dehydrated alcohols, mixes well in 50ml centrifuge tube.
7, the cotton-shaped DNA precipitating that will be seen that with pipettor is transferred to the 2ml EP pipe containing 500 μ l, 70% ethyl alcohol and carries out clearly
It washes.
8, it is centrifuged, 13000rpm, 5min, room temperature, abandons supernatant；It is centrifuged again, 13000rpm, 1min, room temperature is abandoned with pipettor
Raffinate to the greatest extent, dries, is dissolved with distilled water.
Five, HumanOmniZhongHua-8 (v1.1) chip scanning parting and the analysis of full-length genome associated data
HumanOmniZhongHua-8 (v1.1) chip be purchased from ILLUMINA Inc., parting according to method for product require into
Row.Concrete operations severe steps are carried out by the experimental procedure of Illumina company HumanOmniZhongHua-8 (v1.1) chip,
Associated description can equally be shown in document [Adler, A.J., Wiley, G.B., Gaffney, the P.M.Infinium Assay delivered
for Large-scale SNP Genotyping Applications.J.Vis.Exp.(81),e50683,doi:
10.3791/50683(2013).].Each DNA sample uses 200 nanograms (ng), in strict accordance with Illumina company
HumanOmniZhongHua-8 (v1.1) chip illustrates that experimental procedure is handled.
HumanOmniZhongHua-8 (v1.1) chip typing data by ILLUMINA Inc. BeadStudio software
It manages and exports, associated data analysis is equally carried out [Zuo, X.et al.Whole-exome SNP array by the document delivered
Identifies 15new susceptibility loci for psoriasis.Nat Commun 6,6793,2015].
The typing data of BeadStudio output is analyzed using PLINK, according to the same pairing mechanism of state (pairwise identity-
By-state), repeat samples and relationship sample are excluded.Using smartpca software, according to principal component analysis principle
(principal component analysis) excludes group's heterogeneous samples, shares 1,122PBC patient and 4, and 036 is normal right
According to as a result, for statisticalling analyze.The SNP that parting success rate is lower than 98% is excluded, the frequency (minor in analysis sample is excluded
Allele frequency, MAF) it is lower than 0.01 SNP, exclude the Hardy-Weinberg in normal reference sample
Equilibrium value P < 1 × 10-4SNP.By excluding, 776,516 autosomal SNP are shared for comparing.Using
PLINK software, SNP correlation analysis are imitated using gender as covariate (covariate) using additivity using the principle of linear regression
Principle (additive allelic effect) is answered, each SNP site and the associated conspicuousness of PBC are assessed, calculates dangerous equipotential
The relative risk (Odds ratio, OR) of gene and 95% credibility interval, directly obtain in analysis OR value, credibility interval and
P value, to obtain the dangerous allele in the site.(GWAS) analytical calculation, which is associated with, by full-length genome obtains SNP chip
In each site significance (P value) is associated with PBC, found out between PBC according to significance (P value is less than 0.0001)
There are potential associated chromosomal regions, and obtain the significantly associated mononucleotide polymorphism site of PBC neurological susceptibility and its equipotential
Gene.The reckoning (Imputation) of SNP be using the Hans' result in thousand Human Genome Programs as reference value (Reference),
Using IMPUTE2 software, in conjunction with 1,122PBC patient and 4, the result of 036 normal control is calculated.
Result is analyzed referring to table 2 and Fig. 1, as the result is shown in the gene regions IL21R, there are 5 mononucleotide polymorphism sites
The disease associated haplotype frequency of (rs1859308, rs201883233, rs10852316, rs2189521, rs58579343) exists
It is significantly higher than control crowd in PBC, p value is 9.88 × 10-7-5.40×10-9.There are 15 SNP and rs1859308,
Rs201883233, rs10852316, rs2189521, rs58579343 linkage disequilibrium (r2=0.9-1) extrapolate corresponding p
Value, is significantly higher than control crowd (p=9.63 × 10 in PBC-7-6.41×10-8).Chromosomal region mononucleotide polymorphic
Linkage disequilibrium (Linkage disequilibrium, LD) situation between property site, refers to different single nucleotide polymorphism
Between site there is Non random association, indicate (0-1) with r2.A series of this mononucleotide polymorphism site and its allele
It is: rs6498017, allele G/A；Rs757374, allele G/A；Rs722516, allele A/G；
Rs722517, allele C/T；Rs1107788, allele T/C；Rs11074854, allele C/G；
Rs1859309, allele T/C；Rs1859308, allele C/T；Rs1859307, allele A/G；
Rs201883233, allele A/C；Rs1859306, allele G/A；Rs11074855, allele T/C；
Rs10852316, allele G/T；Rs7199163, allele G/T；Rs982204, allele A/G；
Rs72535012, allele CTT/C；Rs1116973, allele T/A；Rs2382582, allele A/C；
Rs2189521, allele A/G；Rs58579343, allele T/C.Wherein dangerous allele is respectively:
Rs6498017 polymorphic site is G；Rs757374 polymorphic site is G；Rs722516 polymorphic site is A；Rs722517 is more
State property site is C；Rs1107788 polymorphic site is T；Rs11074854 polymorphic site is C；Rs1859309 polymorphic position
Point is T；Rs1859308 polymorphic site is C；Rs1859307 polymorphic site is A；Rs201883233 polymorphic site is A；
Rs1859306 polymorphic site is G；Rs11074855 polymorphic site is T；Rs10852316 polymorphic site is G；
Rs7199163 polymorphic site is G；Rs982204 polymorphic site is A；Rs72535012 polymorphic site is CTT；
Rs1116973 polymorphic site is T；Rs2382582 polymorphic site is A；Rs2189521 polymorphic site is A；
Rs58579343 polymorphic site is T.(being shown in Table 2).The relative risk of PBC, which occurs, for the individual for carrying these dangerous allele is
There is no 1.32-1.41 times of carrier.
IL21R gene region mononucleotide polymorphism site sequence:
As shown in the SEQ ID NO.1 in sequence table:
rs6498017
ATGATCCAGCCCAAATGTCAACACT[A/G]TCAAGGTGGAGAAACCCTGCCAAAT
As shown in the SEQ ID NO.2 in sequence table
rs757374
TTGGTCCCTATCCAACTGGGCTGGG[A/G]ACTTGTAGGGTCCTGGGAGACTGTC
As shown in the SEQ ID NO.3 in sequence table
rs722516
GGGGCATGATATCTCAGAAACAGCC[A/G]GGATACAGTGACCAGGAGAAGAGTA
As shown in the SEQ ID NO.4 in sequence table
rs722517
ATACTAGTCTAGTAAACAGCAACAA[C/T]TATAAGTACCTTTATTTTTTAGATG
As shown in the SEQ ID NO.5 in sequence table
rs1107788
CAGCAACCACTGAGCTGATTGGGCA[C/T]CTCTGCAAGCTTTCTCTTAGGGGAC
As shown in the SEQ ID NO.6 in sequence table
rs11074854
CCAGCTCTGCAGTCAGAAAAGAAAG[C/G]CAGCTGAATCCATGCCTGATGAAGG
As shown in the SEQ ID NO.7 in sequence table
rs1859309
TGATTCTTAGAAAGACATAGGAGGG[C/T]TTACCATGGAGGGAGATAATTATGG
As shown in the SEQ ID NO.8 in sequence table
rs1859308
GGTCATGAGCAGGTCCAGACCAGCA[C/T]AGTCAGAGTTGATGAACTGGAGAAG
As shown in the SEQ ID NO.9 in sequence table
rs1859307
TTTGGAAAGAGAAGACTCAGGGTGG[A/G]GGTCATGAGCAGGTCCAGACCAGCA
As shown in the SEQ ID NO.10 in sequence table
rs 201883233
TTCCAAATACTTCTGCTGTCTCATG[A/C]TTTTTTTTACTGTCTCCACACCAGC
As shown in the SEQ ID NO.11 in sequence table
rs1859306
GAACAGGCAACCGAGAAGGTAGAGC[A/G]GCTGGTGTGGAGACAGTAAAAAAAA
As shown in the SEQ ID NO.12 in sequence table
rs11074855
TGAATATCTGGCTTGAAGTAAAGGA[C/T]GTCACATGCTTCAGGGGGACCATGG
As shown in the SEQ ID NO.13 in sequence table
rs10852316
AAAATGGAAATAGCTTGGTTATTTTTCCCAGATTCCAGAAGTAAGA[G/T]ATCATTTTAAAAATCAG
ATAATACAGAATAACATAAAAAATTAAAAA
As shown in the SEQ ID NO.14 in sequence table
rs7199163
aataaaaGGTGGTTTTGATAGCTTA[G/T]TGCAGATGGCAAGTCCCTTACAACT
As shown in the SEQ ID NO.15 in sequence table
rs982204
GCAATCATTTGTCTCTAGACTTCTC[A/G]TTCCATAAAGGAATTAGCTCTTAAG
As shown in the SEQ ID NO.16 in sequence table；
rs72535012
AATTTACAAAGACTAGGGGAGTAT[C/CTT]TTTTATTTTGTTTTTCTTTTTGGCT
As shown in the SEQ ID NO.17 in sequence table；
rs1116973
aattttccagttttccttctgctat[A/T]gatacctaacttcattgtgatcaga
As shown in the SEQ ID NO.18 in sequence table
rs2382582
aaagcatttgacaaaatttaacacc[A/C]tttcatgataaaaacactcagtaaa
As shown in the SEQ ID NO.19 in sequence table
rs2189521
CACTCAGGGAGAGGCAGGCAGAGGGCCAGACGCCGAGCTTAC[A/G]GTCACTCAGCAGAGAGACGCC
AGTGGGTCTGTCTGAGGCCGCT
As shown in the SEQ ID NO.20 in sequence table
rs58579343
TTTGCTTTTGTAATGTTTATGGATC[C/T]TTTCCTTTGCTAATCTAACAAGAGA
Table 2 and the significantly associated IL21R gene region mononucleotide polymorphism site of primary biliary cholangitis
Wherein " OR (95%CI) " indicates to carry disease associated haplotype compared with carrying normal haploid individual
Individual occur PBC relative risk.Chromosome location is referring to Human Genome GRCh37/hg19..
The confirmatory experiment of embodiment 2rs10852316, rs2189521
By being directed to rs10852316 therein, rs2189521 is tested 907 PBC patients and 2027 normal controls
Card, it is again seen that there were significant differences.PBC patient's verification sample is as the standard in embodiment 1；Analyze normal reference sample
From Southeast China University's teacher's physical examination, biochemical indicator is normal, and ultrasound diagnosis is good for without liver and spleen exception, no clinical disease characterization, readme body.It tests
It confirms to test the material in implementing and time such as without explanation, by the offer of Sequenom company.
1, IL21R gene region mononucleotide polymorphism site sequence is verified
Rs10852316 sequence
AAAATGGAAATAGCTTGGTTATTTTTCCCAGATTCCAGAAGTAAGA[G/T]ATCATTTTAAAAATCAG
ATAATACAGAATAACATAAAAAATTAAAAA
rs2189521
CACTCAGGGAGAGGCAGGCAGAGGGCCAGACGCCGAGCTTAC[A/G]GTCACTCAGCAGAGAGACGCC
AGTGGGTCTGTCTGAGGCCGCT
2, design of primers
It is to be measured using Sequenom company Genotyping Tools and MassARRAY Assay Design software design
The PCR amplification primer and Single base extension primer of SNP site, and Integrated DNA Technologies is transferred to synthesize.
Design is as follows using DNA primer and probe:
Rs10852316:
1 sequence of primer, ACGTTGGATGGGTTATTTTTCCCAGATTCC；
Primer 2 sequence, ACGTTGGATGCTGGGTGGTGGGAATTTTTA；
Probe sequence, aggggTCCCAGATTCCAGAAGTAAGA
Rs2189521:
1 sequence of primer, ACGTTGGATGTGTCAGCCACACTCAGGGA；
Primer 2 sequence, ACGTTGGATGAGACCCACTGGCGTCTCTCT；
Probe sequence, tctttCCAGACGCCGAGCTTAC
3, PCR amplification
PCR amplification uses multiple PCR technique, carries out in 384 orifice plates, and each reaction system total volume is 5 μ l.At one
PCR master mix solution is prepared in new 1.5ml EP pipe.
Prepare PCR master mix liquid:
PCR Mix is to each reaction, μ L
10×PCR Buffer 0.5μL
MgCl2(25mM)0.4μL
dNTP mix(25mM)0.1μL
HotStar Taq(5U/μL)0.1μL
Water 1.9μL
PCR primer mix (each 0.5pmol of primer 1 and 2) 1 μ L
Total Volume4μL
Using 24 channel sample injectors, adjusting injection volume is 4 μ L, and PCR is added in each well of 384 orifice plates
Master mix liquid.384 orifice plate is PCR reaction plate.384 orifice plate of DNA sample prepared is taken out, 24 channels are used
Sample injector, adjusting injection volume are 1 μ L, include template DNA 20-50ng, Hotstar Taq in each 5 μ lPCR reaction system
0.5U, every amplimer 0.5pmol, the 25mM dNTPs of 0.1 μ l.The setting PCR reaction in the PCR instrument of compatible 384 orifice plates
Condition are as follows: 94 DEG C 4 minutes；94 DEG C 20 seconds, 56 DEG C 30 seconds, 72 DEG C 1 minute, 45 circulation；72 DEG C 3 minutes；4 DEG C of holdings.By 384
Hole PCR reaction plate is placed in PCR instrument, starting PCR reaction.
4, PCR product alkaline phosphatase treatment
PCR after reaction, by PCR product SAP (shrimp alkaline phosphatase, shrimp alkaline phosphatase
Enzyme) processing, with remove system middle reaches from dNTPs.
(1) alkaline phosphatase treatment reaction solution, SAP Mix are prepared.
SAP Mix is to each reaction, μ L
H2O1.53
SAP Buffer(10x)0.17
SAP Enzyme(1.7U/μL)0.3
Total Volume 2
(2) 24 channel sample injectors are used, adjusting injection volume is 2 μ L, and 384 hole PCR reaction plates are added in SAP Mix.It is right
In each alkaline phosphatase treatment reacting hole, reaction system total volume is 7 μ l, wherein 5 μ l, SAP Mix of PCR product, 2 μ l.
(3) 384 orifice plates are placed in the PCR instrument of compatible 384 orifice plates, set PCR reaction condition: 37 DEG C 40 minutes；85
DEG C 5 minutes；4 DEG C of maintenances, starting PCR instrument carry out alkaline phosphatase treatment.
5, Single base extension
(1) after alkaline phosphatase treatment, single base extension, 9 μ l of reaction system total volume are carried out.
(2) single base extension liquid, EXTEND Mix are prepared.
(3) 24 channel sample injectors are used, adjusting injection volume is 2 μ L, and corresponding 384 holes that are added EXTEND Mix are reacted
Plate.For each reacting hole, single base extension system includes 7 μ l and EXTEND Mix liquid of PCR product, 2 μ l after SAP processing
(wherein each 0.94 μ l, iPLEX enzyme of extension primer mixture, 0.041 μ l extends 0.2 μ l of mixture).
(4) 384 orifice plates are placed in the PCR instrument of compatible 384 orifice plates, set PCR reaction condition:
I.94℃ for 30seconds；
II.94℃ for 5seconds；
III.52℃ for 5seconds；
IV.80℃ for 5seconds；
V.GOTO III, 4more times；
VI.GOTO II, 39more times；
VII.72℃ for 3minutes；
VIII.4℃ forever；
Start PCR instrument and carries out single base extension.
6, purifying resin
(1) by the tiling of Clean Resin resin into the resin plate of 6mg；
(2) plus in 16 μ l water to the corresponding aperture of extension products；
(3) resin after drying is poured into extension products plate, sealer, slow speed vertical rotates 30 minutes, makes resin and anti-
Object is answered to come into full contact with；
(4) centrifugation makes resin sink to hole bottom.
7, chip point sample
Start MassARRAY Nanodispenser RS1000 point sample instrument, the extension products after purifying resin are moved to
On 384 hole SpectroCHIP chips.
8, Mass Spectrometer Method
SpectroCHIP chip after point sample is used into MALDI-TOF (matrix-assisted laser
Desorption/ionization-time of fligh, matrix solid-dispersion flight time mass spectrum) analysis,
Testing result is using 4.0 software of TYPER (sequenom) parting and exports result.Totally 907 PBC samples and 2127 controls
Sample has obtained effective result.
Using PLINK software, logistic regression principle is carried out, using gender as covariate, by synergistic effect model to 907
The result of PBC sample and 2127 control samples is statisticallyd analyze.Disease associated haplotype (G) frequency of rs10852316
(0.626) is significantly higher than control crowd (0.556) in PBC, and p value is 5.59 × 10-7.The disease of rs2189521 is single times related
Body (A) frequency (0.754) in PBC is significantly higher than control crowd (0.680), and p value is 9.87 × 10-9.By patient 1,122PBC
With 4, the GWAS of 036 normal control as a result, be overlapped analysis with the result in 907 PBC samples and 2127 control samples,
Using the principle of fixed-effect model (I2 < 25%), statistical analysis includes 2029 PBC samples and 6163 controls altogether
Sample.The result shows that: disease associated haplotype (G) frequency of rs10852316 is significantly higher than control crowd in PBC, and p value is
2.76×10-13, relative risk angle value (96%CI) is 1.32 (1.22-1.41)；The disease associated haplotype (A) of rs2189521
Frequency is significantly higher than control crowd in PBC, and p value is 4.00 × 10-16, relative risk angle value (96%CI) is 1.41 (1.28-
1.52) (3 are shown in Table).
Table 3:IL21R polymorphic site rs10852316, rs2189521 is in whole-genome association and verifying discovery
As a result
The expression analysis of IL21R in 3 primary biliary cholangitis patient's liver organization of embodiment
All hepatic tissues, including 30 PBC patients, 30 autoimmune hepatitis (AIH) patients, 25 chronic hepatitis Bs
(CHB) patient is the Liver biopsy tissue in the guidance of Shanghai Ren Ji hospital ultrasound.The liver organization of 6 normal healthy controls (HC) comes from
Liver transplant donor.Hepatic tissue is fixed through formalin and paraffin embedding saves.The inflammation and degree of fibrosis of hepatic tissue according to
The evaluation of " Scheuer " points-scoring system.
1, hepatic tissue section impregnates 20 minutes in sodium citrate buffer solution；
2, the diluted anti-IL21R antibody (ab13268, Abcam, Cambridge, USA) of 1:150 is added, room temperature keeps 20
Minute；
3, slide is cleaned with sodium phosphate buffer；
4, goat anti-rabbit antibody (the full-automatic immunohistochemistry machine secondary antibody group of the diluted horseradish peroxidase label of 1:2000 is added
Close, 47101, Leica), immunohistochemical staining operation is carried out using the full-automatic immunohistochemistry machine of Leica；
5, the slide of dyeing is analyzed, chooses region under 5 mirrors, record immediately under the microscope of 40*10 amplification
The positive cell number of dyeing, final result add standard deviation to state by average value.Mann-Whitney U analysis principle (Mann-
Whitney U-test) it is used for the statistical analysis of data, P value is considered statistically-significant difference less than 0.05.All analyses are adopted
With Prism software systems (Prism software Version 6.0, Graphpad Software, La Jolla, CA,
USA) is handled.
The result shows that oneself immunity hepatitis and normal liver tissue, IL21R is in PBC patient's liver group compared to hepatitis B
Knit the significant raising of middle expression.In PBC patient, the cell of IL21R expression is usually collected in the liver portal area of inflammation, especially
It is on the interlobular bile duct periphery of damage.The experimental results showed that the number of IL21R positive cell and the degree of inflammation of liver and
The degree of fibrosis of liver is proportional.The number of statistical analysis discovery IL21R positive cell and the degree of inflammation of liver are positively correlated
(r=0.43, p < 0.05)；It is positively correlated (r=0.60, p < 0.01) with the degree of fibrosis of liver, correlated results is shown in Fig. 2.
It above are only the preferred embodiment of the invention, for those of ordinary skill in the art, do not departing from this hair
It under the premise of bright principle, can also make other variations or changes in different ways, these also should belong to protection model of the invention
It encloses.
SEQUENCE LISTING
<110>Southeast China University
<120>with the associated interleukin 21 receptor of primary biliary cholangitis and its application
<130> SG20161226001
<160>26
<170> PatentIn version 3.3
<210>1
<211> 51
<212> DNA
<213>rs6498017
<221> misc_feature
<223> n is a or g
<400>1
atgatccagc ccaaatgtca acactntcaa ggtggagaaa ccctgccaaa t 51
<210>2
<211> 51
<212> DNA
<213>rs757374
<221> misc_feature
<223> n is a or g
<400>2
ttggtcccta tccaactggg ctgggnactt gtagggtcct gggagactgt c 51
<210>3
<211> 51
<212> DNA
<213>rs722516
<221> misc_feature
<223>n is a or g
<400>3
ggggcatgat atctcagaaa cagccnggat acagtgacca ggagaagagt a 51
<210>4
<211> 51
<212> DNA
<213>rs722517
<221> misc_feature
<223> n is c or t
<400>4
atactagtct agtaaacagc aacaantata agtaccttta ttttttagat g 51
<210>5
<211> 51
<212> DNA
<213>rs1107788
<221> misc_feature
<223>n is c or t
<400>5
cagcaaccac tgagctgatt gggcanctct gcaagctttc tcttagggga c 51
<210>6
<211> 48
<212> DNA
<213>rs11074854
<221> misc_feature
<223> n is c or g
<400>6
ccagctctgc agtcagaaaa gaaagncagc tgaatccatg cctgatgaag g 51
<210>7
<211> 51
<212> DNA
<213>rs1859309
<221> misc_feature
<223> n is c, or t
<400>7
tgattcttag aaagacatag gagggnttac catggaggga gataattatg g 51
<210>8
<211> 51
<212> DNA
<213>rs1859308
<221> misc_feature
<223> n is c ort
<400>8
ggtcatgagc aggtccagac cagcanagtc agagttgatg aactggagaa g 51
<210>9
<211> 51
<212> DNA
<213>rs1859307
<221> misc_feature
<223> n is a or g
<400>9
tttggaaaga gaagactcag ggtggnggtc atgagcaggt ccagaccagc a 51
<210> 10
<211> 51
<212> DNA
<213>rs 201883233
<221> misc_feature
<223> n is a or c
<400> 10
ttccaaatacttctgctgtctcatgnttttttttactgtctccacaccagc 51
<210> 11
<211> 51
<212> DNA
<213>rs1859306
<221> misc_feature
<223> n is a org
<400> 11
gaacaggcaa ccgagaaggt agagcngctg gtgtggagac agtaaaaaaa a 51
<210> 12
<211> 51
<212> DNA
<213>rs11074855
<221> misc_feature
<223> n is c or t
<400> 12
tgaatatctg gcttgaagta aaggangtca catgcttcag ggggaccatg g 51
<210> 13
<211>94
<212> DNA
<213>rs10852316
<221> misc_feature
<223> n is g or t
<400> 13
aaaatggaaa tagcttggtt atttttccca gattccagaa gtaaganatc attttaaaaa 60
tcagataata cagaataaca taaaaaatta aaaa 94
<210> 14
<211> 51
<212> DNA
<213>rs7199163
<221> misc_feature
<223> n is g or t
<400> 14
aataaaaggt ggttttgata gcttantgca gatggcaagt cccttacaac t 51
<210> 15
<211> 51
<212> DNA
<213>rs982204
<221> misc_feature
<223> n is a or g
<400> 15
gcaatcattt gtctctagac ttctcnttcc ataaaggaat tagctcttaa g 51
<210>16
<211> 50
<212> DNA
<213>rs72535012
<221> misc_feature
<223> n is c or ctt
<400>16
aatttacaaa gactagggga gtatntttta ttttgttttt ctttttggct 50
<210>17
<211> 51
<212> DNA
<213>rs1116973
<221> misc_feature
<223> n is a or t
<400>17
aattttccag ttttccttct gctatngata cctaacttca ttgtgatcag a 51
<210>18
<211> 51
<212> DNA
<213>rs2382582
<221> misc_feature
<223> n is a or c
<400>18
aaagcatttg acaaaattta acaccntttc atgataaaaa cactcagtaa a 51
<210>19
<211> 51
<212> DNA
<213>rs2189521
<221> misc_feature
<223> n is a or g
<400>19
cactcaggga gaggcaggca gagggccaga cgccgagctt acngtcactc agcagagaga 60
cgccagtggg tctgtctgag gccgct 86
<210> 20
<211> 51
<212> DNA
<213>rs58579343
<221> misc_feature
<223> n is c or t
<400> 20
tttgcttttg taatgtttat ggatcntttc ctttgctaat ctaacaagag a 51
<210>21
<211> 30
<212> DNA
<213>1 sequence of primer of rs10852316
<400>21
acgttggatg ggttattttt cccagattcc 30
<210>22
<211> 30
<212> DNA
<213>the primer 2 sequence of rs10852316
<400>22
acgttggatg ctgggtggtg ggaattttta 30
<210>23
<211>26
<212> DNA
<213>probe sequence of rs10852316
<400>23
aggggtccca gattccagaa gtaaga 26
<210>24
<211>29
<212> DNA
<213>1 sequence of primer of rs2189521
<400>24
acgttggatg tgtcagccac actcaggga 29
<210>25
<211> 30
<212> DNA
<213>the primer 2 sequence of rs2189521
<400>25
acgttggatg agacccactg gcgtctctct 30
<210>26
<211>22
<212> DNA
<213>probe sequence of rs2189521
<400>26
tctttccaga cgccgagctt ac 22
Claims (1)
1. detecting the reagent of IL21R gene polymorphic site rs10852316 and rs2189521 in preparation detection or auxiliary detection, sieve
Look into or predict the application in the product of primary biliary cholangitis, the SEQ ID in rs10852316 sequence such as sequence table
Shown in NO.13, wherein mononucleotide n is that the risk of carrier's primary biliary cholangitis of C is higher than allele A,
Rs2189521 sequence is as shown in the SEQ ID NO.19 in sequence table, wherein mononucleotide n is carrier's primary biliary of A
Property cholangitis risk be higher than allele G.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710015653.0A CN106834449B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 receptor of primary biliary cholangitis and its application |
| PCT/CN2017/092505 WO2018129888A1 (en) | 2017-01-10 | 2017-07-11 | Primary biliary cholangitis-associated interleukin 21 receptor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710015653.0A CN106834449B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 receptor of primary biliary cholangitis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834449A CN106834449A (en) | 2017-06-13 |
| CN106834449B true CN106834449B (en) | 2019-04-30 |
Family
ID=59118411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710015653.0A Active CN106834449B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 receptor of primary biliary cholangitis and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106834449B (en) |
| WO (1) | WO2018129888A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834449B (en) * | 2017-01-10 | 2019-04-30 | 东南大学 | With the associated interleukin 21 receptor of primary biliary cholangitis and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010102387A1 (en) * | 2009-03-09 | 2010-09-16 | University Health Network (Uhn) | Interleukin-12 polymorphisms for identifying risk for primary biliary cirrhosis |
| CN103602671A (en) * | 2013-10-16 | 2014-02-26 | 中国人民解放军第四军医大学 | SNP in KRT8 gene exon area and determination method thereof |
| CN103749388A (en) * | 2014-01-16 | 2014-04-30 | 中国科学技术大学 | Method for breeding IL-12p40 (-/-) IL-2R alpha (-/-) mice used as hepatic fibrosis and primary biliary cirrhosis animal models |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL151388A0 (en) * | 2000-02-21 | 2003-04-10 | Applied Research Systems | Use of il-18 inhibitors |
| CN106834449B (en) * | 2017-01-10 | 2019-04-30 | 东南大学 | With the associated interleukin 21 receptor of primary biliary cholangitis and its application |
-
2017
- 2017-01-10 CN CN201710015653.0A patent/CN106834449B/en active Active
- 2017-07-11 WO PCT/CN2017/092505 patent/WO2018129888A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010102387A1 (en) * | 2009-03-09 | 2010-09-16 | University Health Network (Uhn) | Interleukin-12 polymorphisms for identifying risk for primary biliary cirrhosis |
| CN103602671A (en) * | 2013-10-16 | 2014-02-26 | 中国人民解放军第四军医大学 | SNP in KRT8 gene exon area and determination method thereof |
| CN103749388A (en) * | 2014-01-16 | 2014-04-30 | 中国科学技术大学 | Method for breeding IL-12p40 (-/-) IL-2R alpha (-/-) mice used as hepatic fibrosis and primary biliary cirrhosis animal models |
Non-Patent Citations (3)
| Title |
|---|
| Dysregulation of peritoneal cavity B1a cells and murine primary biliary cholangitis;Yang Y.Q.等;《Oncotarget》;20160420;第7卷(第19期);第26993页左栏第1段，图5，第26999页左栏第1段 |
| Genome-wide association study identifies 12 new susceptibility loci for primary biliary cirrhosis;George F Mells等;《Nature Genetics》;20110313;第43卷(第4期);329-334页 |
| International genome-wide meta-analysis identifies new primary biliary cirrhosis risk loci and targetable pathogenic pathways;Heather J. Cordell等;《NATURE COMMUNICATIONS》;20150922;第2页左栏第2-3段，表1 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2018129888A1 (en) | 2018-07-19 |
| CN106834449A (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Weeks et al. | Polygenic disease: methods for mapping complex disease traits | |
| FI117977B (en) | Method for screening the presence of a genetic defect associated with thrombosis and / or weak anticoagulant response to activated protein C | |
| CN104805198A (en) | Method of identifying disease risk factors | |
| CN101454462A (en) | Hla alleles associated with adverse drug reactions and methods for detecting such | |
| Haworth et al. | POLYMYALGIA RHEUMATICA IS ASSOCIATED WITH BOTH HLA-DRB1* 0401 and DRBl* 0404 | |
| CN102465174A (en) | Method for detecting GJB2 gene mutation by fluorescence quantitative PCR technology, and kit thereof | |
| Nair et al. | Scanning chromosome 17 for psoriasis susceptibility: lack of evidence for a distal 17q locus | |
| CN106755461B (en) | With the associated interleukin 21 of primary biliary cholangitis and its application | |
| AU2014203213A1 (en) | Diagnostic markers for ankylosing spondylitis and uses thereof | |
| CN106834449B (en) | With the associated interleukin 21 receptor of primary biliary cholangitis and its application | |
| CN106834448B (en) | With the associated interleukins 16 of primary biliary cholangitis and its application | |
| CN104651354A (en) | SCML4 gene sequence and expression change detection and application of SCML4 gene sequence in coronary heart disease prediction | |
| AU2009299123A1 (en) | Diagnostic markers for ankylosing spondylitis | |
| CN103397022A (en) | Nucleotide polymorphism markers related to Graves diseases or Graves eye diseases and application thereof | |
| CN107447035A (en) | Warfarin drug science of heredity gene C YP2C9 and VKORC1 polymorphic detection kit | |
| Schöni et al. | Clinical evaluation of a new functional test for detection of activated protein C resistance (Pefakit® APC-R Factor V Leiden) at two centers in Europe and the USA | |
| Belal et al. | Study of large inbred Friedreich ataxia families reveals a recombination between D9S15 and the disease locus | |
| CN107312867B (en) | Diagnose SNP and its application of hypothyroidism | |
| Zorai et al. | Frequency and spectrum of hemochromatosis mutations in Tunisia | |
| CN104372010A (en) | New mutant pathogenic gene of febrile convulsion as well as coding protein and application thereof | |
| CN104711255B (en) | THSD7A gene orders and expression change detection and its application in coronary disease disease forecasting | |
| CN108949953A (en) | Detect primer, method and kit that ABCG8 introne 9 is mutated | |
| WO2000058506A2 (en) | Susceptibility to psoriasis | |
| EP1199372A2 (en) | Polymorphisms in the human P2X7 gene | |
| CN103215265B (en) | Screening kit for age-related macular degenerative disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |