CN104651354A - SCML4 gene sequence and expression change detection and application of SCML4 gene sequence in coronary heart disease prediction - Google Patents
SCML4 gene sequence and expression change detection and application of SCML4 gene sequence in coronary heart disease prediction Download PDFInfo
- Publication number
- CN104651354A CN104651354A CN201510029012.1A CN201510029012A CN104651354A CN 104651354 A CN104651354 A CN 104651354A CN 201510029012 A CN201510029012 A CN 201510029012A CN 104651354 A CN104651354 A CN 104651354A
- Authority
- CN
- China
- Prior art keywords
- seq
- heart disease
- coronary heart
- dna
- mononucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to the technical field of biology. On the one hand, the invention relates to a single nucleotide polymorphism (SNP) site of a coronary heart disease susceptibility gene SCML4, and a corresponding composition and a kit for detecting the SNP site, and particularly relates to an application of a nucleic acid affinity ligand of the SNP site in preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese han population; and on the other hand, the invention relates to a corresponding composition and kit for detecting the SCML4 gene, and further relates to an application of the nucleic acid affinity ligand of the SCML4 gene in preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese han population. A new further scientific basis is provided for research and development of specific coronary heart disease treatment; and a new clue is provided for discovery of a new molecular mechanism of the coronary heart disease, development of new drug targets and individual-based treatment of the coronary heart disease.
Description
Technical field
The present invention relates to biological technical field, in particular to single nucleotide polymorphism (the single nucleotide polymorphism on the SCML4 gene relevant to coronary disease susceptibility, SNP) site, and for the corresponding composition that detects described SNP site and test kit, the nucleic acid affinity ligand particularly relating to described SNP site is in the application for the preparation of detecting, in the composition of examination or prediction Chinese Han Population coronary disease susceptibility.
Background technology
Coronary heart disease, also known as coronary heart disease, be by coronary blood tube wall atherosis cause even inaccessible with coronary stricture be the ischemic heart disease of morphological change.Coronary heart disease is very harmful, and according to the data of the World Health Organization, worldwide, the ischemic heart disease based on coronary heart disease is the number one killer threatening human health.Data presentation: in 2008, the whole world is nearly dies from coronary heart disease (WHO, 2011) more than 7,300,000 people.Although from the severely afflicated area that mortality ratio China is not coronary heart disease at present, because population-based is large, the coronary heart disease number of getting involved of China is very surprising.Estimate that China dies from coronary heart disease per year over 1000000 people.In addition, along with the development of China's economic level and the raising of living standards of the people, the Incidence of CHD of contriver country is also raising year by year.
Clinical and epidemiological study proves, coronary heart disease is common complicated multigenic disease, causes the reason of disease to comprise inherited genetic factors, environmental factors and both interactions.Coronary heart disease has familial aggregation, and research shows, the heredity grade of coronary heart disease is about 40% to 60%.Therefore, coronary heart disease tumor susceptibility gene and susceptibility loci identify by for finding new coronary heart disease molecular mechanism, develop the diagnosis of the early gene of new drug target and coronary heart disease and personalized treatment provides new thread.On genetics, the tumor susceptibility gene finding multigenic disease utilizes association analysis more.Genetic association analysis is divided into two strategies: candidate gene association analysis and whole-genome association (genome wide association study, GWAS).Have benefited from the Human Genome Project and the announcement of HapMap plan to human inheritance's collection of illustrative plates, find from full-length genome level and become possibility with the variation of disease-related.In in the past 6 years, whole-genome association develops into one of important method studying complicated multigenic disease hereditary basis, have and be found by the method more than 50 coronary heart disease related locus, wherein most site finds in white research.But due to the heterogeneity of heredity, these results can not be yellow, and especially contriver's Chinese han population is used.On the other hand, only have 6 to be find based on the institute of Chinese han population in the site found, this is far not enough to the coronary heart disease hereditary basis explaining Chinese han population.In addition, how existing research has only paid close attention to related locus, and lacks effective means for the tumor susceptibility gene that qualification related locus refers to.
In view of known being used for explains the gene of coronary heart disease hereditary basis of Chinese han population and the comparatively small amt in site, in order to improve, Chinese Han Population coronary disease susceptibility detects, the accuracy of examination or prediction, thus more easily, more directly, sensitiveer and detect more specifically, examination or prediction Chinese Han Population coronary disease susceptibility, be necessary to find the new tumor susceptibility gene relevant to coronary disease susceptibility and SNP site.
Summary of the invention
Present invention finds a kind of SCML4 gene relevant to coronary disease susceptibility can explaining the coronary heart disease hereditary basis of Chinese han population newly, to confirm on SCML4 gene closely-related SNP site rs9486729 and the SNP site chain with rs9486729 with coronary disease susceptibility simultaneously.The concrete technical scheme of the present invention is as follows:
First aspect, the invention provides the nucleic acid molecule of separation, it represents single nucleotide polymorphism (SNP) the site rs9486729 on SCML4 gene, and DNA sequence dna is as shown in SEQ ID NO:1, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A.
Second aspect, the invention provides the nucleic acid molecule of separation, and it represents SNP site chain with SNP site rs9486729 on SCML4 gene, and described chain SNP site is selected from following any one:
(1) rs4945789, its DNA sequence dna is as shown in SEQ ID NO:2, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope G;
(2) rs872548, its DNA sequence dna is as shown in SEQ ID NO:3, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(3) rs9320237, its DNA sequence dna is as shown in SEQ ID NO:4, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(4) rs7773622, its DNA sequence dna is as shown in SEQ ID NO:5, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allele C;
(5) rs6568503, its DNA sequence dna is as shown in SEQ ID NO:6, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(6) rs1878780, its DNA sequence dna is as shown in SEQ ID NO:7, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(7) rs12194084, its DNA sequence dna is as shown in SEQ ID NO:8, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(8) rs6568505, its DNA sequence dna is as shown in SEQ ID NO:9, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(9) rs12214724, its DNA sequence dna is as shown in SEQ ID NO:10, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope G;
(10) rs12214852, its DNA sequence dna is as shown in SEQ ID NO:11, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allele C;
(11) rs10457173, its DNA sequence dna is as shown in SEQ ID NO:12, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope A;
(12) rs6568508, its DNA sequence dna is as shown in SEQ ID NO:13, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T;
(13) rs7771956, its DNA sequence dna is as shown in SEQ ID NO:14, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(14) rs9400150, its DNA sequence dna is as shown in SEQ ID NO:15, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope T;
(15) rs4946871, its DNA sequence dna is as shown in SEQ ID NO:16, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(16) rs4946872, its DNA sequence dna is as shown in SEQ ID NO:17, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(17) rs12211874, its DNA sequence dna is as shown in SEQ ID NO:18, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(18) rs9400152, its DNA sequence dna is as shown in SEQ ID NO:19, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(19) rs9480807, its DNA sequence dna is as shown in SEQ ID NO:20, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope G;
(20) rs6915611, its DNA sequence dna is as shown in SEQ ID NO:21, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(21) rs7767848, its DNA sequence dna is as shown in SEQ ID NO:22, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(22) rs10782157, its DNA sequence dna is as shown in SEQ ID NO:23, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(23) rs9384663, its DNA sequence dna is as shown in SEQ ID NO:24, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope G;
(24) rs17530298, its DNA sequence dna is as shown in SEQ ID NO:25, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T;
(25) rs9386677, its DNA sequence dna is as shown in SEQ ID NO:26, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(26) rs9398150, its DNA sequence dna is as shown in SEQ ID NO:27, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(27) rs17596103, its DNA sequence dna is as shown in SEQ ID NO:28, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(28) rs6931026, its DNA sequence dna is as shown in SEQ ID NO:29, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allele C.
Sequence SEQ ID NO:1-29 forms the new single nucleotide polymorphism (SNP) relevant to coronary disease susceptibility.Their allow sensitive, specificity, effectively and simply to the detection of coronary disease susceptibility, examination or Forecasting Methodology, such as by adopting wide-spread and wieldy technology as PCR or nucleic acid hybridization, it has high suitability and utilization ratio, particularly in the low developed area in the world.Because above-mentioned SNP identifies in Chinese han population, therefore think that new SNP can be specially adapted to the detection of Chinese han population coronary disease susceptibility, examination or prediction.
The third aspect, the invention provides the arbitrary combination of the nucleic acid molecule of above-mentioned separation.
In a preferred embodiment of the invention, described combination at least comprises SEQ ID NO:1, and one or more sequence of optional SEQ ID NO:2-29.In another preferred embodiment of the present invention, the combination of the nucleic acid molecule of any separation mentioned above can also be combined with extra SNP, and other suitable SNP of preferred coronary disease susceptibility combine.
In embodiments of the invention, any single SNP can be used as the biomarker of coronary disease susceptibility, the combination of preferred any two or more possible SNP of the present invention, especially preferably the combination of rs9486729 and other one or more SNP.
Fourth aspect, the invention provides for detecting, the composition of examination or prediction Chinese Han Population coronary disease susceptibility, and described composition comprises the nucleic acid affinity ligand as one or more SNP site defined above.
In a preferred embodiment of the invention, nucleic acid affinity ligand mentioned above can be the oligonucleotide being specific to one or more SNP site defined above, or is specific to the probe of one or more SNP site defined above.In another preferred embodiment of the present invention, affinity ligand mentioned above can be have the oligonucleotide with the such as sequence of the nucleotide complementary of SNP site defined above.
5th aspect, the invention provides for detecting, the test kit of examination or prediction Chinese Han Population coronary disease susceptibility, it comprises the oligonucleotide being specific to one or more SNP site defined above, or is specific to the probe of one or more SNP site defined above.In another preferred embodiment of the present invention, described oligonucleotide has the sequence with the such as nucleotide complementary of SNP site defined above.
6th aspect, the invention provides and comprise if the nucleic acid affinity ligand of one or more SNP site defined above is in the application for the preparation of detecting, in the composition of examination or prediction Chinese Han Population coronary disease susceptibility.
7th aspect, the invention provides a kind of method of coronary disease susceptibility of detection, examination or forecasting object, comprises the following steps:
(1) from subject sample isolating nucleic acid;
(2) determine the nucleotide sequence in such as one or more SNP site places existence defined above, wherein existence instruction as allelic in danger defined above has larger possibility to suffer from coronary heart disease.
Eighth aspect, the invention provides for detecting, the composition of examination or prediction Chinese Han Population coronary disease susceptibility, and described composition comprises the nucleic acid affinity ligand being specific to SCML4 gene.
9th aspect, the invention provides for detecting, the test kit of examination or prediction Chinese Han Population coronary disease susceptibility, it comprises the nucleic acid affinity ligand being specific to SCML4 gene, and optionally ancillary component, described ancillary component comprises: PCR damping fluid, dNTP, polysaccharase, ion are as divalent cation or monovalent cation, hybridization solution.
Tenth aspect, the nucleic acid affinity ligand that the invention provides SCML4 gene is in the application for the preparation of detecting, in the composition of examination or prediction Chinese Han Population coronary disease susceptibility.
The beneficial effect that the present invention brings is:
Present invention finds the SNP site rs9486729 be positioned on SCML4 gene promoter area associated with coronary disease susceptibility, be positioned at a series of SNP site chain with rs9486729 of rs9486729 upstream and downstream, can to the crowd not occurring coronary heart disease early clinic symptom by the single nucleotide polymorphism detecting the genomic above-mentioned each site of Chinese Han Population testing sample, the coronary heart disease high risk population especially with conventional risk factors carries out without the fast and convenient examination of wound, early discovery coronary heart disease susceptible object, and take corresponding hygienic measures, reduce the sickness rate of coronary heart disease and myocardial infarction.The present invention researches and develops coronary heart disease gene therapy targetedly to provide new further scientific basis, for finding new coronary heart disease molecular mechanism, develops the personalized treatment of new drug target and coronary heart disease and provides new thread.
Accompanying drawing explanation
Fig. 1 is that coronary heart disease sample carries out high fleet-footed runner's class full-length genome (Affymetrix Genome-wide Human) SNP 5.0 array experiment fragmentation rear electrophoresis figure;
Fig. 2 is whole-genome association Manhattan figure;
Fig. 3 is the association analysis result schematic diagram that rs9486729 upstream and downstream is total to 500kb region;
Fig. 4 is SCML4 gene cell expression pattern analysis schematic diagram;
Fig. 5 is SCML4 gene expression dose and rs9486729 site somatotype correlation analysis result schematic diagram;
Fig. 6 a for after striking low SCML4, the genetic expression schematic diagram of interleukin-6 (IL6);
Fig. 6 b for after striking low SCML4, the genetic expression schematic diagram of E-selectin (SELE);
Fig. 6 c for after striking low SCML4, the genetic expression schematic diagram of intercellular adhesion molecule (ICAM);
Fig. 6 d is for after striking low SCML4, and endotheliocyte (HUVEC) adheres to person monocytic cell (THP-1) quantity schematic diagram;
Fig. 7 is for after striking low SCML4, and HUVEC anti-apoptotic ability reduces schematic diagram.
Embodiment
The present invention is not limited to concrete grammar as herein described, scheme, reagent etc., because these can change.Term used herein only for describe specific embodiments object instead of in order to limit the scope of the invention.Unless otherwise defined, all technology used herein and scientific terminology all have the identical implication usually understood with those skilled in the art.
Before detailed description exemplary of the present invention, definition is provided to the term understanding the present invention very important.
As used herein, term " nucleic acid molecule of separation " refers to nucleic acid entity, such as DNA, RNA etc., and wherein said entity is substantially free of other biological molecule, such as nucleic acid, albumen, lipid, sugar or other materials, as cell debris or growth medium.In general, term " separation " does not also mean that there is not this kind of material completely, or there is not water, damping fluid or salt, unless they exist to disturb in fact the amount of method of the present invention.
Each self-contained one section of 51 Nucleotide of SEQ ID NO:1-29 mentioned above, and represent the allelic sequences of above-mentioned SNP site and 25 Nucleotide background sequence of upstream and downstream thereof.
SEQ ID NO:1 mentioned in this article defines the sequence of SNP site rs9486729, and it is positioned on the promoter region of No. 6 karyomit(e) SCML4 genes, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A.
What SEQ ID NO:2-29 definition mentioned in this article associated with coronary disease susceptibility is arranged in a series of SNP site chain with rs9486729 that SNP site rs9486729 upstream and downstream is total to 500kb region.
In specific embodiment of the invention scheme, nucleic acid molecule is not limited to the sequence of SEQ ID NO:1-29, its can comprise SEQ ID NO:1-29 sequence, be substantially made up of the sequence of SEQ ID NO:1-29 or be made up of the sequence of SEQ ID NO:1-29.Such as, as defined herein, described sequence can comprise the adjacent area in 3' and/or the 5' background of SEQ ID NO:1-29, such as one section of 3' and/or 5' direction extra about 50,100,200,300,400,500,600,700,800,900,1000,1500,2000,3000,4000,5000,6000,7000,10000 an or more Nucleotide from the genomic locations at its place.
In other embodiments of the present invention, nucleic acid molecule can comprise the fragment of SEQ ID NO:1-29, substantially be made up of the fragment of SEQ ID NO:1-29, or be made up of the fragment of SEQ ID NO:1-29, the fragment of described SEQ ID NO:1-29 at least must comprise the polymorphic site at position 26 place being positioned at SEQ ID NO:1-29.Such as, the present invention relates to the sequence of about 50,40,30,20 or 10 or less length of nucleotides or any value therebetween, it at least must comprise the polymorphic site at position 26 place being positioned at SEQ ID NO:1-29.Length shown in described fragment can extend towards 5' or 3' direction or two-way 5' and 3' direction.Preferred length is 50 Nucleotide and less fragment, and polymorphic site is positioned at the center of sequence.
Those skilled in the art can according to rs-name above, from the database be applicable to and relevant infosystem as determined its definite position, nucleotide sequence single nucleotide polymorphism database (dbSNP) (it is quoted and adds herein).
In other embodiments of the present invention, relate to one or more, the sequence of such as one group polymorphic change mentioned above, form the biomarker of coronary disease susceptibility.As used herein, term " biomarker of coronary disease susceptibility " refers to have cognation between mentioned SNP and coronary disease susceptibility.
In other preferred embodiments, one or more or whole above-mentioned SNP sequence can form biomarker.Preferably, single SNP can be used as the biomarker as coronary disease susceptibility defined above.The also combination of preferred any two or more possible SNP of the present invention.Especially the preferably combination of rs9486729 and other one or more SNP.
In another preferred embodiment of the present, the present invention relates to the combination of the nucleic acid of separation, wherein said combination at least comprises SEQ ID NO:1, and one or more sequence of optional SEQ ID NO:2-29.
In specific embodiment of the invention scheme, combination or the combination of any SNP mentioned above can also be combined with extra SNP, other suitable SNP of preferred coronary disease susceptibility well known by persons skilled in the art.
As used herein, term " is determined the nucleotide sequence in SNP site " and is referred to any suitable method or technology, and it detects the character being positioned at the Nucleotide at position 26 place of any one or any combination comprising SEQ ID NO:1-29.This method can mainly sequencing technologies or based on complementary nucleic acid combine technology.
In another preferred embodiment of the present invention, described definite kernel nucleotide sequence can pass through allele specific oligonucleotide (ASO)-dot blot assay, primer extension measures, iPLEX SNP genotyping, Dynamic allele specific hybrid (DASH) genotyping, use molecular beacon, Tetra-primer ARMS PCR, free endonuclease invades and measures, oligonucleotide ligase enzyme measures, PCR-single strand conformation polymorphism (SSCP) is analyzed, quantitative PCR in real time measures, based on the analysis of SNP microarray, restriction fragment length polymorphism (RFLP) is analyzed, target again sequencing analysis and/or genome sequencing analysis carries out.
As used herein, term " nucleic acid affinity ligand " refers to can in conjunction with the nucleic acid molecule of such as SNP site defined above.Preferably, described nucleic acid affinity ligand can in conjunction with the sequence of SEQ ID NO:1-29 or its fragment, and described fragment comprises as SNP site defined above, and the sequence of wherein said SEQ ID NO:1-29 comprises respective Nucleotide as described above.In other embodiments of the present invention, nucleic acid affinity ligand can also combine specifically with the sequence of SEQ ID NO:1-29 or its fragment (comprising as SNP site defined above) at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or 99.5% or 99.6%, 99.7%, 99.8% or 99.9% identical DNA sequence dna, the sequence of wherein said SEQ IDNO:1-29 comprises respective Nucleotide as described above, or in conjunction with any fragment of described sequence.
In other specific embodiments, described nucleic acid affinity ligand can be can specifically in conjunction with the short nucleic acid molecule of the SNP sequence of SEQID NO:1-29, such as RNA, DNA, PNA, CAN, HNA, LNA or ANA molecule or any other suitable nucleic acid well known by persons skilled in the art.
In other specific embodiments, described nucleic acid affinity ligand can comprise any suitable function ingredients known to the skilled, the combination of such as label, fluorescent mark, radio-labeling, dyestuff, albumen or antibody or peptide or recognition site, can be used for another segment DNA of PCR method, can be used as the section of DNA etc. of the recognition site of Restriction Enzyme.Nucleic acid affinity ligand can also provide with the form of catalysis RNA, and described catalysis RNA combines specifically and cuts the sequence comprising SNP of the present invention.
Composition of the present invention can comprise extraly detect coronary disease susceptibility institute must or available other compositions, such as damping fluid, dNTP, polysaccharase, ion are as divalent cation or monovalent cation, hybridization solution etc.
In another preferred embodiment of the present invention, affinity ligand mentioned above can be the oligonucleotide being specific to one or more SNP site defined above, or is specific to the probe of one or more SNP site defined above.As used herein, term " is specific to the oligonucleotide of one or more SNP site " and refers to that length is an about 12-38 Nucleotide, the preferably nucleic acid molecule of an about 15-30 Nucleotide, preferred DNA molecular.Such as, described oligonucleotide can have the length of 16,17,18,19,20,21,22,23,24,25,26,27,28,29 or 30 Nucleotide.These molecules preferably can with dangerous allelic nucleotide on or at least 2,3,4,5,6,7,8,9 or 10 nucleotide complementary around, but comprise relevant to SEQ ID NO:1-29 described in as the complementary sequence of dangerous allelic nucleotide defined above.
In other embodiments, the invention still further relates to specifically in conjunction with the oligonucleotide molecules near SNP site as indicated above in the background of SEQ ID NO:1-29.These oligonucleotide can be designed as the form of pair of primers, and the such as length that allows to increase is 50bp, 75bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 750bp, 1000bp or more and comprises the DNA section of the polymorphic site of SNP of the present invention.
As used herein, term " is specific to the probe of one or more SNP site defined above " and refers to DNA fragmentation, and it can specifically in conjunction with SNP site of the present invention.Such as, described probe can design like this, thus it only combines the sequence comprising dangerous allelic nucleotide.Can such as in hybrid experiment by change salt concentration, amendment temperature of reaction, add to reaction the specificity that other suitable compounds etc. adjust probe further.All right designing probe like this, thus it is in conjunction with SNP site outside, such as, in the sequence of SEQ IDNO:1-29, or its complementary sequence.
In other embodiments, probe of the present invention can with the sequence of SEQ ID NO:1-29 or its fragment (comprising as SNP site defined above), with as described in sequence any fragment or with the complementary sequence at least 90% of these sequences, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or 99.5% or 99.6%, 99.7%, 99.8% or 99.9% identical, the sequence of wherein said SEQ ID NO:1-29 comprises respective dangerous allelic nucleotide as described above.
Probe of the present invention can have any suitable length, and such as 15,20,30,40,50,100,150,200,300,500,1000 or length more than 1000 Nucleotide.Probe can also be suitably modify, such as, by adding mark, as fluorescent mark, dyestuff, radio-labeling etc.
On the other hand, the present invention relates to for detecting, the test kit of examination or predicting susceptibility of coronary heart disease, it comprises the oligonucleotide being specific to one or more SNP site defined above, or is specific to the probe of one or more SNP site defined above.In a preferred embodiment, described oligonucleotide has the sequence with such as dangerous allelic nucleotide complementation defined above.In other embodiments, as test kit defined above can comprise ancillary component, such as PCR damping fluid, dNTP, polysaccharase, ion are as divalent cation or monovalent cation, hybridization solution etc.In other embodiments, described test kit can also comprise ancillary component as the second affinity ligand, and such as two resist, and detect dyestuff, or carry out detection of nucleic acids necessary other suitable compound or liquid.This constituents and further details are well known by persons skilled in the art, and can change according to carried out detection method.In addition, described test kit can comprise specification sheets and/or can provide the information of dependency of obtained result.
As used herein, " subject sample " can be any sample of any suitable part deriving from subject's body.In one embodiment, sample can derive from pure tissue or organ or cell type.In other embodiments of the present invention, sample can derive from body fluid, such as, derive from blood, serum, saliva, urine, ight soil, seminal fluid, lymph liquid etc.Particularly preferably adopt blood sample, it comprises the cell containing DNA, the red corpuscle, erythrocyte precursor cell, white corpuscle etc. of such as non-maturation.The sample used in the context of the present invention should preferably gather in clinical acceptable mode, more preferably gathers in the mode retaining nucleic acid or albumen.
For making technical scheme of the present invention and advantage clearly, below in conjunction with accompanying drawing, embodiment of the present invention is described further in detail.Be to be understood that embodiment and figure should not be construed as restrictive.Those skilled in the art clearly can imagine the further amendment of the principle listed herein.
Embodiment 1: screen coronary heart disease susceptibility loci within the scope of full-length genome:
Subject Population
In the present embodiment, patients with coronary heart disease, namely coronary heart disease case group sample (coronary angiography is positive) and case-data are from Chinese PLA General Hospital, and control sample and data are from Beijing area MEC.The all groups' sample participating in experiment is all notified in writing, and endorsed Informed Consent Form by he or she or family members.The ethic principle that experimental implementation specifies in accordance with " Declaration of Helsinki ", is audited by Ethics Committee of Peking University and passes through.
Wherein, coronary heart disease case group sample inclusion criteria meets one of following three conditions:
(1) previously myocardial infarction (MI) medical history is had;
(2) previously skin intervention of coronary artery or artery bypass grafting in treatment of patients history is had;
(3) angiography of coronary arteries confirms that in three Major Coronaries, at least one tube chamber diameter stenosis is greater than 50%.
Control sample inclusion criteria is for meet following three conditions simultaneously:
(1) previously without familial history of coronary artery disease;
(2) without coronary heart disease clinical symptom (as pectoralgia, uncomfortable in chest, breathe suffering etc.);
(3) electrocardiogram(ECG is without exception.
(Hazard Factor comprise: be greater than the male sex of 45 years old or be greater than the women of 55 years old to have two or more Hazard Factor, hypertension, diabetes, hyperlipidemia and overweight) people will accept the inspection of exercise stress load test, normal ECG and can being selected in without clinical symptom person.In addition, the people of cerebral apoplexy or peripheral vascular disease is had to be left out.
Blood pressure is evaluated:
The clinician of specialty carries out blood pressure measurement to selected crowd.The mercury sphygmomanometer of employing standard measures blood pressure,right arm, and during measurement, all experimenters are all under rest state, and tests and within first 30 minutes, do not have smoking, have tea or coffee for drinking.
Meet one of following three conditions and be defined as hypertension:
(1) antihypertensive drugs is used;
(2) non-three blood pressure measurement on the same day, systolic pressure (SBP) >=140mmHg, or/and diastolic pressure (DBP) >=90mmHg;
(3) case mark has hypertension history.
Diabetes are evaluated:
Blood sample takes chemical examination after 12 hours in the morning on an empty stomach, meets one of following four conditions and is defined as diabetes:
(1) fasting plasma glucose >=7.0mmol/L;
(2) 2 hours blood glucoses >=11.1mmol/L after the meal;
(3) ofhypoglycemic medicine is applied at present;
(4) case mark has diabetic history.
If fasting plasma glucose 5.6-7.0mmol/L or after the meal 2 hours blood glucoses at 7.8-11.1mmol/L, so will judge according to carbohydrate tolerance test (OGTT).
Blood fat is evaluated:
Blood sample takes chemical examination after 12 hours in the morning on an empty stomach, and laboratory indexes comprises TG, TC, LDL-C, HDL-C.Whether, because nearly all patients with coronary artery disease is all accepting lipid-lowering therapy, its blood fat value measured can not himself blood fat situation of actual response, and therefore, in embodiments of the present invention, what show is its blood fat observed value, and illly not evaluate it.
Smoking is evaluated: according to selected crowd's readme.
Experiment reagent
In the present embodiment, it is as shown in table 1 that Affymetrix Genome-wide Human SNP 5.0 tests the reagent used:
Table 1 Affymetrix Genome-wide Human SNP 5.0 tests agents useful for same specification table
The veraCode GoldenGate SNP parting kit that Golden Gate typing assay uses is purchased from Ilumina company.
The reagent that specificity ligase chain reaction (Allele Specific Ligase Chain Reaction, ASLCR) typing assay uses is as follows:
Standard PCR reagent
Universal primer
Adaptive primer 1 (band T7m fluorescent mark), its DNA sequence dna is as shown in the SEQ ID NO:48 in sequence table: GGATACGACTCACTATAGGT
Adaptive primer 2 (band M13m fluorescent mark), its DNA sequence dna is as shown in the SEQ ID NO:49 in sequence table: GGTAAGGACGACGGTCCAGT
Plasmid amplification primer-F, its DNA sequence dna is as shown in the SEQ ID NO:50 in sequence table:
GGCTGCATACGCTTGAT
Plasmid amplification primer, its DNA sequence dna is as shown in the SEQ ID NO:51 in sequence table:
GGTAAGGACGACGGTCCAGTAGCCAACGCTATGTCCTGAT
The special primer (the prosperous bio tech ltd of Beijing AudioCodes) in site:
Rs9486729-f, its DNA sequence dna is as shown in the SEQ ID NO:52 in sequence table:
GCCTAA GAGAAATGTGCAGTGT
Rs9486729-r, its DNA sequence dna is as shown in the SEQ ID NO:53 in sequence table:
CACCCATTCTAACCATTGT
Rs9486729-a, its DNA sequence dna is as shown in the SEQ ID NO:54 in sequence table:
TACGACTCACTATAGGTGCAAGGTAATGACA
Rs9486729-g, its DNA sequence dna is as shown in the SEQ ID NO:55 in sequence table:
TACGACTCACTATAGGTTAAGCAAGGTAATGACG
Rs9486729, its DNA sequence dna is as shown in the SEQ ID NO:56 in sequence table:
CTTCTGCTTC TTTGGTAGTTGGAAAATGGCCGCTTT
Rs9486729-nt, its DNA sequence dna is as shown in the SEQ ID NO:57 in sequence table:
TGTCATTACCTTGC
Rs9486729-nc, its DNA sequence dna is as shown in the SEQ ID NO:58 in sequence table:
CGTCATTACCTTGC
Rs9486729-n, its DNA sequence dna is as shown in the SEQ ID NO:59 in sequence table:
ACTACCAAAGAAGCAGAAG
Wherein front two primers increase for the chromosomal region at SNP place, and rear several primers carry out allele-specific connection.Utilize these primers, by the method difference SNP somatotype of PCR.
Concrete operation step
One, Affymetrix Genome-wide Human SNP 5.0 tests
1) sample requirement and purifying
Sample for chip is higher for the specification of quality of original gene group DNA, as DNA needs to keep double chain form; Without PCR inhibition, as protoheme, EDTA etc.; Residual without RNA or albumen; Other people genomic dna or the DNA of other species can not be polluted; It can not be severely degrade.
2) Sty enzyme is cut
96 orifice plate samples, vortex mixing in 10 seconds, centrifugal 30 seconds of 2000rpm.Each sample gets 5 μ L to new 96 orifice plates, and centrifugal 30 seconds of 2000rpm, is placed on ice.Prepare Sty I enzyme according to table 2 and cut mixed system:
Table 2
| Reagent | Single sample/μ L | 48 samples (having more than needed)/μ L |
| AccuGENE water | 11.55 | 637.6 |
| NEB damping fluid 3 (10 ×) | 2 | 110.4 |
| BSA(100×；10mg/mL) | 0.2 | 11 |
| Sty I restriction enzyme (10U/ μ L) | 1 | 55.2 |
| Total amount | 14.75 | 814.2 |
Turn 67 μ L mixed systems with the 12 road P200 volley of rifle fires and enter 12 hole combs.From comb, getting 14.75 μ L mixtures with the 12 road P20 volley of rifle fires adds in each sample well, at this moment each hole cumulative volume 19.75 μ L.Sealer, compresses, and mixing is centrifugal.After determining polymerase chain reaction (Polymerase Chain Reaction, PCR) instrument being preheated, put into 96 orifice plates, carry out GW5.0/6.0 enzyme and cut program, carrying out practically condition is as shown in table 3:
Table 3
| Temperature | Time |
| 37℃ | 120 minutes |
| 65℃ | 20 minutes |
| 4℃ | Keep |
3) Sty connects
Prepare Sty I according to table 4 and connect mixed system:
Table 4
| Reagent | Single sample/μ L | 48 samples (having more than needed)/μ L |
| T4 ligase enzyme damping fluid (10 ×) | 2.5 | 150 |
| The adaptive thing (50 μMs) of Sty I | 0.75 | 45 |
| T4 DNA ligase (400U/ μ L) | 2 | 120 |
| Total amount | 5.25 | 315 |
With the mono-rifle of P100, packing 25 μ L Sty I enzyme is cut mixture and is entered each hole of comb.With the 12 road P20 volley of rifle fires, get 5.25 μ L Sty I enzymes from comb and cut mixture and enter Sty digestion products, each hole cumulative volume is 25 μ L.Sealer, compresses, and mixing is centrifugal.Guarantee PCR instrument preheating, 96 orifice plates are put into PCR instrument and run GW5.0/6.0 linker, carrying out practically condition is as shown in table 5:
Table 5
| Temperature | Time |
| 16℃ | 180 minutes |
| 70℃ | 20 minutes |
| 4℃ | Keep |
4) dilution of sample
Get 75 μ L water with the 12 road P200 volley of rifle fires, add in each connection Product samples hole, cumulative volume reaches 100 μ L.Sealer, compresses, and mixing is centrifugal.
5)Sty PCR
Get the sample after 10 μ L dilutions to corresponding position in corresponding PCR plate, each stock layout product does three PCR reactions repeated.50mL pipe is placed on ice, prepares Sty PCR mixture according to table 6:
Table 6
| Reagent | Single sample/μ L | 3PCR plate × 48 sample (having more than needed)/mL |
| Water | 39.5 | 6.541 |
| Taq PCR damping fluid (10 ×) | 10 | 1.656 |
| GC-additive (5M) | 20 | 3.321 |
| dNTPs(2.5mM each) | 14 | 2.318 |
| PCR primer 002 (100 μMs) | 4.5 | 0.745 |
| Taq polysaccharase (50 ×) | 2 | 0.331 |
| Total amount | 90 | 14.903 |
High speed vortex mixed thing 3 times, each 1 second, guarantees mixing.
Getting 90 μ L Sty PCR mixtures with the 12 road P200 volley of rifle fires joins in each sample, for avoiding polluting, changes rifle head after adding at every turn.Every hole cumulative volume is 100 μ L.Sealer, compresses, and mixing is centrifugal.GW5.0/6.0PCR program, carrying out practically parameter is as shown in table 7:
Table 7
Program takes out sample panel, centrifugal 30 seconds of 2000rpm after running.Carefully open sealer, draw samples sucking-off 1 μ L adds in sample-loading buffer and prepares electrophoresis, and principle is that each sample all will be taken a sample test, and each PCR plate all will be taken a sample test (as 3 96 orifice plate PCR, at least will take a sample test 96 sample electrophoresis).Sample panel sealer, compresses, centrifugal 30 seconds of 2000rpm ,-20 DEG C of preservations.Take a sample test sample electrophoresis: 2% agarose electrophoresis, 150V, 25 minutes, confirm that PCR primer size distribution is about 200bp to 1100bp.Abnormal sample is rejected, and does not carry out subsequent experimental.
6) Nsp enzyme is cut
To cut step basically identical with above-mentioned Sty enzyme, and difference is that Nsp I enzyme cuts mixture preparation.Prepare Nsp I enzyme according to table 8 and cut mixture:
Table 8
| Reagent | Single sample/μ L | 48 samples (having more than needed)/μ L |
| AccuGENE water | 11.55 | 637.6 |
| NEB damping fluid 2 (10 ×) | 2 | 110.4 |
| BSA(100×；10mg/mL) | 0.2 | 11 |
| Nsp I(10U/μL) | 1 | 55.2 |
| Total amount | 14.75 | 814.2 |
7) Nsp connects
Basically identical with above-mentioned Sty Connection Step, difference is that Nsp I connects mixture preparation.Prepare Nsp I according to table 9 and connect mixture:
Table 9
| Reagent | Single sample/μ L | 48 samples (having more than needed)/μ L |
| T4 ligase enzyme damping fluid (10 ×) | 2.5 | 150 |
| The adaptive thing (50 μMs) of Nsp I | 0.75 | 45 |
| T4DNA ligase enzyme (400U/ μ L) | 2 | 120 |
| Total amount | 5.25 | 315 |
8) Nsp connects the dilution of product
9)Nsp PCR
The operation of Nsp PCR is with reference to Sty PCR, and both difference is that the every stock layout product of template of Nsp will divide and take on 4 parts and carry out PCR (Sty is 3 parts).Because be a plate PCR than Sty, thus the preparation of Nsp PCR mixture also has more 1 plate than the corresponding of Sty more.
10) carry out PCR primer with Mi Libo (Millipore) screen plate to purify
By centrifugal for 7 plate PCR primer 2000rpm 30 seconds, gather into deep-well plates, at this moment each sample well has 700 μ L PCR primer (Sty:100 μ L × 3; Nsp:100 μ L × 4).Add 1.0mL magnetic bead with the 12 road P1200 volley of rifle fires at each sample well: slowly add, and blow more than 5 times with volley of rifle fire suction, mixing is in order to allow PCR primer be adsorbed on magnetic bead fully.Hide deep-well plates, incubated at room 10 minutes.
With the 12 road P1200 volley of rifle fires, sample in deep-well plates is transferred to screen plate, position is corresponding.By sealer, is obturaged in the hole of no sample in screen plate, to carry out negative pressure filtration below.
Connect vacuum apparatus, open vacuum pump, maintain the Hg post of 20-24, until all liquid filters (about 40-50 minute), close vacuum pump.Check each hole, the hole that whole liquid filters should be lacklustre, if certain some holes is glossy, shows to still have remaining liquid, can refilter and be less than 10 minutes (altogether not exceeding 60 minutes).
The 12 road P1200 volley of rifle fires are adjusted to 900 μ L, each hole adds 900 μ L 75% ethanol, open vacuum pump and maintain 20-24Hg, 1-2 minute after liquid level declines, add 900 μ L 75% ethanol (each hole is 1.8mL75% ethanol altogether) again, hide screen plate, treat that liquid all filters (10-15 minute), close vacuum pump.
Check each hole, if still have residual liquid, can refilter and be less than 5 minutes (being altogether no more than 20 minutes).Available clean paper handkerchief blots the unnecessary alcohol bottom screen plate.Refilter 10 minutes (not exceeding, if determine do not have unnecessary ethanol also can be less than 10 minutes).Close vacuum pump, bottom the checked filter plate of paper using, there is no unnecessary alcohol.
Receiver sheet is installed.3mlNEB damping fluid is poured in solution basin, in the every hole of screen plate, 55 μ L EB damping fluids are added with the 12 road P200 volley of rifle fires, notice that rifle head gos deep into screen plate, when enough close to be directly added to magnetic bead top, contact magnetic bead and also try not to be added on wall.Flick screen plate and guarantee that EB damping fluid all arrives on the magnetic bead of bottom.Be tamping screen plate by sealer, Jitterbug vibrates 10 minutes.
Check and guarantee that the magnetic bead in each hole is by fully resuspended, with the DNA on wash-out magnetic bead.Tear sealer, be installed on vacuum apparatus, maintain 20-24Hg 5-15 minute, guarantee that liquid all filters screen plate, close vacuum pump.Check each hole, still have remaining liquid, shinny etc. if show, vacuum filtration can be carried out again 15 minutes.Take off screen plate, sealer, centrifugal 5 minutes of 1400rcf room temperature.Take off dash receiver, shift 45 μ L eluting liquids in new PCR plate with the 12 road P200 volley of rifle fires, sealer, is placed in-20 DEG C of preservations, in order to next step fragmentation.
Get residue elutriant 1-2 μ L, dilute with water 100 times, mixing, surveys concentration.Normal value: measure concentration about 50 μ L/ μ L (had better not lower than 45 μ L/ μ L), OD260/OD280 1.8 to 2.0, OD320 close to 0 (0 ± 0.005).
11) fragmentation
This step experiment is a step the most key in whole experiment flow, and fragmentation reagents is extremely responsive for temperature, require operation rapidly accurately, between two operators, cooperation is good, whizzer 4 DEG C of precoolings and mark caveat such as " will carry out important experiment; please don't use ", do not allow other people take temporarily.Comb and sample are all placed on ice.In comb, each hole adds 28 μ L 10 × fragmentation buffer.Draw 5 μ L 10 × fragmentation buffer with the 12 road P20 volley of rifle fires to join in each sample well, make every sample well volume reach 50 μ L.The fragmentation reagents of prepared and diluted, the fragmentation reagents concentration difference to some extent of different batches, according to concrete batch of concentration, prepare 0.1U/ μ L fragmentation reagents according to table 10:
Table 10
The fragmentation reagents (avoid there is bubble at the bottom of pipe, affect the accuracy that next step moves liquid) that quick every hole packing 28 μ L has diluted in comb.With the 12 road P20 volley of rifle fires, in each sample, adding the fragmentation reagents that 5 μ L have diluted, rapidly, blowing work without repeatedly inhaling.At this moment each sample well volume is 55 μ L.Sealer immediately, compresses, guarantees to obturage, vortex 3 second.4 DEG C of centrifugal 30 seconds of 2000rpm (being all placed on ice in intermediate transfer process).Be placed in rapidly in preheated PCR instrument, carry out GW5.0/6.0 fragmentation program, carrying out practically parameter is as shown in table 11:
Table 11
| Temperature | Time |
| 37℃ | 35 minutes |
| 95℃ | 15 minutes |
| 4℃ | Hold |
Discard fragmentation reagents (not reproducible use) after unnecessary dilution.After fragmentation EP (end of program), centrifugal 30 seconds of 2000rpm, each sample is drawn 1.5 μ L and is added sample-loading buffer, and 4% agarose electrophoresis detects, and average fragment size should be less than 180bp.Accompanying drawing 1 carries out Affymetrix Genome-Wide HumanSNP 5.0 array experiment fragmentation rear electrophoresis figure for coronary heart disease sample.
12) mark
Labeled reactant mixture is prepared according to table 12:
Table 12
Add 89 μ L labeled reactant mixtures in each comb, in each sample, add 19.5 μ L labeled reactant mixtures with the 12 road P20 volley of rifle fires, cumulative volume is 73 μ L.Sealer, compresses.Vortex about 3 seconds.Centrifugal 30 seconds of 2000rpm.Put in preheated PCR instrument, run GW5.0/6.0 and mark program, carrying out practically parameter is as shown in table 13:
Table 13
| Temperature | Time |
| 37℃ | 4 hours |
| 95℃ | 15 minutes |
| 4℃ | Keep |
After EP (end of program), centrifugal 30 seconds of 2000rpm, product can be placed in-20 DEG C of preservations.
13) hybridize
According to table 14 preparing hybrid mixture:
Table 14
| Reagent | Individual chip/μ L | 48 chips (having more than needed)/μ L |
| MES(12×) | 12 | 660 |
| Denhardt’s(50×) | 13 | 715 |
| Ethylenediamine tetraacetic acid (EDTA) (0.5M) | 3 | 165 |
| HSDNA(10mg/mL) | 3 | 165 |
| OCR，0100 | 2 | 110 |
| People Cot-1DNA (1mg/mL) | 3 | 165 |
| Tween 20 (3%) | 1 | 55 |
| Dimethyl sulfoxide (DMSO) (100%) | 13 | 715 |
| TMACL(5M) | 140 | 7700 |
| Total amount | 190ml | 10.45ml |
High speed vortex, guarantee hybridization mixture homogeneous and without precipitation (about 5 minutes).In each sample after mark, add 190 μ L hybridization mixtures, cumulative volume is 263 μ L.Sealer, compresses.Vortex 30 seconds, guarantees mixing.Centrifugal 30 seconds of 2000rpm.When ensureing that sealer is obturaged, the sample that will carry out hybridizing cut by scissors, all the other-20 DEG C preservations.Run GW5.0/6.0 Hybridization samples denaturation program, 49 degree of maintenances after 95 degree of 10min.Sample is still placed in PCR instrument and keeps constant temperature, carefully throws off sealer.With 200 μ L rifles, the sample of change property is all injected chip fast.Obturaged by chip, be placed in rapidly 50 DEG C, in 60rpm hybrid heater, individual chip operation time, at about 1 minute, is no more than 1.5 minutes.After loading, check hybrid heater balance (once hybridizing 32 chips at most), keep 50 DEG C, 60rpm hybridization 16 to 18 hours.
14) dye and chip scanning is washed
Hybridize after 16 to 18 hours, the sample of hybridizing is transferred in the EP pipe of 1.5mL, be placed in-80 DEG C and preserve for a long time, fill chip in chip and preserve damping fluid.Wash dye before by chip constant temperature in room temperature.Fresh SAPE solution and antibody-solutions, packing 600 μ L is in 1.5mL pipe respectively; Packing 1mL chip preserves damping fluid in 1.5mL EP pipe.SAPE solution, antibody-solutions and chip are preserved damping fluid correspondence and are positioned over " 1 ", " 2 ", " 3 " position of washing dye workstation.
Corresponding chip selection " Genome Wide SNP5_450 " program carries out washing dye.Pre-heating scan instrument, selects corresponding chip type to scan.
Two, Affymetrix Genome-wide Human SNP 5.0 chip data analysis
1) utilization is held high and flown AGCC software to scanned dat file transform is cel file.
2) utilize and high fly gene type 4.0 software and carry out primary dcreening operation according to the Quality Control of often opening chip, standard is: SNP5.0 chip Quality Control site somatotype rate >86%.Chip lower than this standard is directly rejected, and does not participate in subsequent analysis.
3) use and high fly gene type 4.0 software and carry out preliminary somatotype, the sample meeting following standard carries out subsequent analysis: individual chip somatotype rate is not less than 95% and heterozygosity is normal.
4) reject to reuse after failed test sample and highly fly gene type 4.0 and carry out somatotype.
5) final genotyping result is with CHP file or TXT file output.
6) genotype and phenotypic data merge, and utilize Golden Helix SVS or Plink software to carry out subsequent analysis.
7) SNP filtering screening, retains the analysis that the SNP simultaneously meeting following condition enters next step.
I () control group is breathed out enlightening Weinberg and is checked P value >5 × 10
-3;
(ii) case group low frequency allele frequency >=2%;
(iii) control group low frequency allele frequency >=2%;
(iv) case group single SNP somatotype rate >95%;
(v) control group single SNP somatotype rate >95%.
8) principle component analysis, is completed by Plink software.
9) quantile plot is drawn, and is completed by R software.
10) polishing analysis, is completed by Plink software.
Three, GoldenGate typing assay and analytical procedure
GoldenGate typing assay completed by genome.It contains three primers, and a primer is the barcode analyzed, and another two are distinguished SNP.First, genomic dna and three primers, archaeal dna polymerase, ligase enzymes are hatched jointly, carry out primer extension reaction, obtain the template of PCR reaction.PCR primer increases with fluorescently-labeled allele specific oligonucleotide primer subsequently, hybridizes, and read result with the magnetic bead on solid phase carrier.Each sample can detect 384 SNP site simultaneously.The analysis and utilization IlluminaGenome Studio software of genotyping result carries out.
Four, ASLCR method
1) prepare PCR primer, this product is for the preparation of the long probe of ligation.Prepare following system:
PCR condition is as follows:
94 degree of 3min
94 degree of 20s
55 degree of 30s
72 degree of 45s step 2-4,35 circulations
72 degree of 5min
16 degree of 20s
Collection system, removes paraffin oil (in case later causing the problem of paraffin oil when system) as far as possible.
2) phosphorylated primers.Prepare following system:
37 degree 6 hours or spend the night.Add 5 μ L 50mM EDTA and 25 μ L ultrapure water stopped reactions (i.e. 30 μ L 8.33mM EDTA).-20 degree are preserved.
3) long probe is prepared: in six probe primers, one (rsX) is used for preparing long probe.Prepare following system:
PCR condition is as follows:
94 degree of 3min
94 degree of 20s
55 degree of 30s
72 degree of 1min step 2-4,50 circulations
72 degree of 5min
16 degree of 20s
Collection system, removes paraffin oil (in case later causing the problem of paraffin oil when system) as far as possible, or uses the method for sealer.
4) genomic dna PCR, prepares following system:
PCR condition is as follows:
94 degree of 3min
94 degree of 20s
55 degree of 30s
72 degree of 15s step 2-4,45-50 circulation
72 degree of 5min
16 degree of 20s
5) allele-specific ligation
Many the primers for a site design or preparation are blended together three groups: first group (A) in advance: primer name is the primer of rsX-N/A/T/G/C, each primer of final concentration 1 μM.Second group (B): primer name be rsX-NA/NT/NG/NC primer and with the process of T4 polynueleotide kinase, each primer of final concentration 1 μM.3rd group (C):, each primer 40nM of final concentration.
Prepare following system:
Reaction conditions is as follows:
94 degree of 20s
48 degree of 2.5min step 1-2,35 circulations,
16 degree of 20s
6) after product PCR is connected
LCR product is added 90 μ L ultrapure waters, mixing, prepares following system:
PCR condition is as follows:
94 degree of 3min
94 degree of 20s
55 degree of 30s
72 degree of 45s step 2-4,25 circulations
72 degree of 5min
16 degree of 20s
1 μ L system of getting joins 10 μ L height deionization (HiDi) methane amides.At 95 DEG C, sex change 3 minutes, is placed on ice, and centrifugal after cooling, upper machine carries out capillary electrophoresis.
Experimental result
One, crowd's information of obtaining of above-mentioned experiment is as shown in Table 15
Table 15 crowd information
Two, multistage the selection result
The present embodiment utilizes Affymetrix Genome-wide Human SNP 5.0 chip (comprising 443104 SNP site) to complete whole-genome association to about 650 samples.After Quality Control is carried out to sample, remain 280 coronary heart disease case samples and 350 normal control samples.After site Quality Control screening, remain 310,000 sites.By principle component analysis, 6 doubtful control samples having layering are deleted.Then carry out QQ-plot analysis by the data after screening, the coefficient of expansion is 1.02, shows that crowd does not have potential layering.On this basis, utilize Plink software, with 90 Chinese Hans in HapMap II and Japanese SNP data for reference data has carried out polishing analysis to the raw data of contriver.The data that the Quality Control parameter INFO value of polishing analysis is greater than 0.8 (PLINK software recommend) are retained.After polishing, site sum reaches 1,820,000.What Fig. 2 showed is be positioned at the association analysis Manhattan figure that does in 22 autosomal sites (wherein, each point in Fig. 2 represents a SNP site, x-axis is that SNP site is No. 1-22 chromosomal physical location distribution, wherein, the part between adjacent two lines represents item chromosome respectively; Y-axis be mononucleotide polymorphism site with coronary heart disease associate significance, represent with-log10 (p), this value is larger, and illustrate that P value is less, the dependency of this site and coronary heart disease is stronger).In chip data, contriver have selected 277 candidate locus and carry out next round screening in nearly 1000 routine case-control crowd.Result has 271 sites can by GoldernGate method success somatotype, and wherein 2 SNP are less than 0.01 and discarded because somatotype rate is less than 97 and 5 SNP owing to testing P value in the Sino-Kazakhstan temperature detector of contrast crowd.
By in the site of Quality Control, there are 16 SNP can the result of the last round of experiment of repeated authentication.After aforementioned two-wheeled checking, remaining 16 sites are shown in table 16.
Remaining 16 sites after the checking of table 16 two-wheeled
Next, utilize the method for LCR in 810 routine coronary heart disease case samples and 853 routine normal control samples, carried out the somatotype in these 16 sites.Through interpretation of result, rs9486729 (dangerous allelotrope the is G) pleomorphism site being positioned at SCML4 gene promoter area is still positive findings.
In order to confirm the dependency of rs9486729 and coronary disease susceptibility further, the present embodiment has also investigated the result of rs9486729 site in each screening stage crowd.Result is shown in table 17.
Table 17
As shown in Table 17, rs9486729 and coronary disease susceptibility have significant cognation.
In the polishing analytical results of the first round, contriver finds except rs9486729, and the following site chain with it being positioned at rs9486729 upstream and downstream also presents obvious dependency (P < 0.01):
Rs4945789 (dangerous allelotrope is C);
Rs872548 (dangerous allelotrope is A);
Rs9320237 (dangerous allelotrope is G);
Rs7773622 (dangerous allelotrope is T);
Rs6568503 (dangerous allelotrope is A);
Rs1878780 (dangerous allelotrope is A);
Rs12194084 (dangerous allelotrope is G);
Rs6568505 (dangerous allelotrope is A);
Rs12214724 (dangerous allelotrope is C);
Rs12214852 (dangerous allelotrope is A);
Rs10457173 (dangerous allelotrope is T);
Rs6568508 (dangerous allelotrope is C);
Rs7771956 (dangerous allelotrope is G);
Rs9400150 (dangerous allelotrope is A);
Rs4946871 (dangerous allelotrope is G);
Rs4946872 (dangerous allelotrope is A);
Rs12211874 (dangerous allelotrope is G);
Rs9400152 (dangerous allelotrope is G);
Rs9480807 (dangerous allelotrope is T);
Rs6915611 (dangerous allelotrope is G);
Rs7767848 (dangerous allelotrope is A);
Rs10782157 (dangerous allelotrope is G);
Rs9384663 (dangerous allelotrope is T);
Rs17530298 (dangerous allelotrope is C);
Rs9386677 (dangerous allelotrope is G);
Rs9398150 (dangerous allelotrope is G);
Rs17596103 (dangerous allelotrope is G);
Rs6931026 (dangerous allelotrope is T).
Contriver has carried out association analysis to the site that rs9486729 upstream and downstream is total to 500kb region, Fig. 3 is that rs9486729 upstream and downstream is total to the association analysis result in 500kb region (wherein, each point in figure represents a SNP, transverse axis illustrates the gene existed in this region, the left side longitudinal axis be mononucleotide polymorphism site with coronary heart disease associate significance, this value is larger, illustrates that the dependency of this site and coronary heart disease is stronger.Curve representation in figure be recombination fraction with this chromosomal region of north of China people and Japanese population data estimation in 1000 genome plans, unit (CM/Mb) the corresponding right side longitudinal axis; In region, rs9486729 is labeled as square, the linkage disequilibrium relation (r in other sites and this site
2) represent with shade.The tools of this figure are online tool SNAP (http://www.broadinstitute.org/mpg/snap/ldplot.php)).As shown in Figure 3, not only rs9486729 and coronary disease susceptibility present obvious dependency, and above-mentioned each site chain with rs9486729 also presents dependency with coronary disease susceptibility.
More specifically, the related locus that in chip data, other and rs9486729 are chain and the result of coronary heart disease association analysis shown in table 18, wherein case group MAF represents the low frequency allele frequency of case group, control group MAF represents the low frequency allele frequency of control group, OR represents odds ratio, if such as OR=1.5, it is higher by 50% than not carrying this allelotrope sickness rate that this allelotrope is carried in representative.
The result of related locus chain with rs9486729 in table 18 chip data and coronary heart disease association analysis
Wherein, the sequence in each site above-mentioned is specific as follows:
The DNA sequence dna of rs9486729 is as shown in the SEQ ID NO:1 in sequence table:
TCGACATGAGCTGCAAGGTAATGAC[A/G]CTTCTGCTTCTTTGGTAGTTACATC
The DNA sequence dna of rs4945789 is as shown in the SEQ ID NO:2 in sequence table:
GCAGTGTCCCTAAAGGCAACATAAA[C/G]ACAGATCATTTCTTTTTATTTGCCA
The DNA sequence dna of rs872548 is as shown in the SEQ ID NO:3 in sequence table:
ATAAAATAATATATGCATGTATGTA[C/T]GTTTTATTAATTCATTTATTCACCC
The DNA sequence dna of rs9320237 is as shown in the SEQ ID NO:4 in sequence table:
CTTCTTTGCCAGTTGGCTTAATGTT[A/G]GGTCCTGTCAATAGAGGGCATTGGA
The DNA sequence dna of rs7773622 is as shown in the SEQ ID NO:5 in sequence table:
TAAATTGAATTGTTCCCCCCAACCC[C/T]AAAAATCATATATTGAAGTCGTAAC
The DNA sequence dna of rs6568503 is as shown in the SEQ ID NO:6 in sequence table:
TAAGTAAGAGACATCAGGAGTGGAA[A/G]CATAACAAGGAAAGGCCACATAAGG
The DNA sequence dna of rs1878780 is as shown in the SEQ ID NO:7 in sequence table:
TCCCTGGTCTCTGCCCTCTAAGTGG[C/T]AGGAATGCCCACTCTGCCCCCAGCA
The DNA sequence dna of rs12194084 is as shown in the SEQ ID NO:8 in sequence table:
AAGAGAGGGCCCTAGAAAGAAAGAA[C/G]CAATCCTCTATACCATCATATCATT
The DNA sequence dna of rs6568505 is as shown in the SEQ ID NO:9 in sequence table:
ACCAGGGAAAAACATACTCCTTAGT[A/G]TTCAACCCTGGTTTTCTCATCAGAG
The DNA sequence dna of rs12214724 is as shown in the SEQ ID NO:10 in sequence table:
CATTCTTGAAAATCAGCAATGGTGG[C/G]TTGCATTTATCTGATCAAAAAATGC
The DNA sequence dna of rs12214852 is as shown in the SEQ ID NO:11 in sequence table:
AGTAAGAGGTGTTTTATCTCCTCCG[A/C]GGCAGCAAAGGGCTTCTCCTGATTG
The DNA sequence dna of rs10457173 is as shown in the SEQ ID NO:12 in sequence table:
TTGAAGGCAATGAAAACATTAAAAA[A/T]TGTGTAAATCTAAAACTAGCCTTTT
The DNA sequence dna of rs6568508 is as shown in the SEQ ID NO:13 in sequence table:
TAATTTTGGGGACACAGGGAAGAAA[C/T]GTAAACATGTTATACATGAAAGAAC
The DNA sequence dna of rs7771956 is as shown in the SEQ ID NO:14 in sequence table:
TATACCCCCCAGATAGTTTAACACA[C/G]TAAGAATTCCTTTGTAGTTATTTTT
The DNA sequence dna of rs9400150 is as shown in the SEQ ID NO:15 in sequence table:
AAAGCCACTGATTGTCTAACCCTCA[A/T]GAGTACCGTCATGGAATCTAGAGAC
The DNA sequence dna of rs4946871 is as shown in the SEQ ID NO:16 in sequence table:
TTTGGACAGCATCTCTGTCCCAGCG[A/G]CAGCGGTTATTATACTCACACCCGT
The DNA sequence dna of rs4946872 is as shown in the SEQ ID NO:17 in sequence table:
CATGCCACACTACACTGAGCTTAAA[A/G]CACCTGGAATGGGCTGAGACATTAG
The DNA sequence dna of rs12211874 is as shown in the SEQ ID NO:18 in sequence table:
TGGCAGGGAATAGGTCTTCTCCACT[A/G]TAACCCCAGTATGTAGTGCAGAGCC
The DNA sequence dna of rs9400152 is as shown in the SEQ ID NO:19 in sequence table:
GGAGAGGAAGTCCAGGCTTCCCCCA[A/G]TTTGTGAGAAAGGGCCCAGCTCAGA
The DNA sequence dna of rs9480807 is as shown in the SEQ ID NO:20 in sequence table:
AGGGCTCACCACACCTGGTCAGGGC[G/T]GTGGCTCTCCAGAGCCCCAGAGTAA
The DNA sequence dna of rs6915611 is as shown in the SEQ ID NO:21 in sequence table:
AACCAGATGCCGAGCTCTGGATGGG[C/G]CTTTCGTGAAGCTAAAGCACAGGAA
The DNA sequence dna of rs7767848 is as shown in the SEQ ID NO:22 in sequence table:
TTGGTTCTCTACCCCTGAGAATGAG[A/G]GAGCTCACAAGTACTATAAATATGA
The DNA sequence dna of rs10782157 is as shown in the SEQ ID NO:23 in sequence table:
ATTAATGATTGGGTTCTGGTCTGGG[A/G]TAAATGATGTGACCCACCAGGTGCC
The DNA sequence dna of rs9384663 is as shown in the SEQ ID NO:24 in sequence table:
GGGTTCTGGTCTGGGGTAAATGATG[G/T]GACCCACCAGGTGCCTGGCACACAC
The DNA sequence dna of rs17530298 is as shown in the SEQ ID NO:25 in sequence table:
TAAATCTCACAGATTCCTGAGTAGA[C/T]TGTCCTTCTAACCTATGATAGCTGA
The DNA sequence dna of rs9386677 is as shown in the SEQ ID NO:26 in sequence table:
AACACACCCAAATCTCTAGCCTCAC[A/G]GAGCTTAATTTCTACTGTAGGGAGA
The DNA sequence dna of rs9398150 is as shown in the SEQ ID NO:27 in sequence table:
TGTCAGAAATGTGATGAGGGGGAGA[A/G]GAGTTGCAATTCAAATTAGTCACCA
The DNA sequence dna of rs17596103 is as shown in the SEQ ID NO:28 in sequence table:
AGGGTCATTGGTATTGACCAACAGC[A/G]GTAACTTATAAACTGCTAAAAAAAA
The DNA sequence dna of rs6931026 is as shown in the SEQ ID NO:29 in sequence table:
CATCTGTAAATGTGAATTTGTCTTT[C/T]GTTCTAGCAGTTTTTGCTTCATGTT
The multicenter checking in embodiment 2 rs9486729 site
In order to verify the rs9486729 mononucleotide polymorphism site in embodiment 1 further, the present embodiment will carry out polycentric checking to above-mentioned site.Verify that method used remains LCR and direct Sequencing combines.Concrete operations are as follows:
Study population
For patients with coronary heart disease (coronary angiography positive) sample of testing and data from affiliated hospital of Harbin Medical University, China-Japan Friendship Hospital and Fuwai Hospital, affiliated hospital of Zhengzhou University first.Control sample and data are from the northeast of mating with case region and northern area MEC; The case sample of south crowd's checking and data are from First People's Hospital of Jiangsu Province, Ningbo City, Zhejiang Province First People's Hospital, affiliated hospital of Tongji Medical College, Huazhong Science and Technology Univ., Guangdong Province's hospital attached to a medical college, and control sample is from the MEC mated with case region.Amount to 7074 cases, 8689 contrasts.The all groups' sample participating in experiment is all notified in writing, and endorsed Informed Consent Form by he or she or family members.The ethic principle that experimental implementation specifies in accordance with " Declaration of Helsinki ", is audited by Ethics Committee of Peking University and passes through.
Experiment reagent and concrete operation step
In the present embodiment, the concrete operation method of ASLCR typing assay and agents useful for same the same with ASLCR method in embodiment 1 and reagent used.
Experimental result
One, crowd's information of obtaining of the present embodiment is shown in table 19:
Table 19 crowd information
As shown in Table 19, contriver have matched age and the sex of case and control group in each crowd as far as possible, to reduce the impact of population stratification on result to greatest extent.
Two, the result of rs9486729 site in each Qualify Phase crowd.
As shown in Table 20, rs9486729 site can be verified in 5 checking crowds.Merge the result of all groups, contriver finds, more significantly, P value reaches the threshold value of whole-genome association to the dependency of rs9486729 site and coronary heart disease, namely 1.0 × 10
-8.This result further demonstrate that mononucleotide polymorphism site rs9486729 and coronary disease susceptibility closely related.
The result of table 20 rs9486729 site in each Qualify Phase crowd
Embodiment 3 identifies tumor susceptibility gene
To be positioned at gene Desert Regions different from SNP site that a lot of GWAS finds, the rs9486729 site that the application identifies is positioned at SCML4 promoter region, and therefore contriver supposes that SCML4 gene may be the tumor susceptibility gene of coronary heart disease.And by the present embodiment, it is verified.
Study population
SCML4 gene eQTL analyzes crowd used from Beijing area MEC.The all groups' sample participating in experiment is all notified in writing, and endorsed Informed Consent Form by he or she or family members.The ethic principle that experimental implementation specifies in accordance with " Declaration of Helsinki ", is audited by Ethics Committee of Peking University and passes through.
Cell cultures
Human embryonic kidney cell system HEK293A, is preserved by this experiment; The primary huve cell HUVEC of people is separated voluntarily by this laboratory; People's primary aortic smooth muscle cell HASMC is purchased from the abundant Hengfeng Science and Technology Ltd. in Beijing; Other cells are all from Peking University molecular medicine institute teacher Liang Zicai laboratory.
Experiment reagent
One, express quantitative trait locus (eQTL) and test agents useful for same
Two, cell cultures agents useful for same
Three, destination gene expression spectrum test experience agents useful for same
Primer:
The DNA sequence dna of SCML4-RT-PF is as shown in the SEQ ID NO:30 in sequence table:
TCTGCCTGTGAGCGATTTGT
The DNA sequence dna of SCML4-RT-PR is as shown in the SEQ ID NO:31 in sequence table:
CATAGGCGTGGAGTGAAGTGA
The DNA sequence dna of 18S-SB-F is as shown in the SEQ ID NO:32 in sequence table:
CGGACAGGATTGACAGATTG
The DNA sequence dna of 18S-SB-R is as shown in the SEQ ID NO:33 in sequence table:
CAAATCGCTCCACCAACTAA
Four, endothelial cell inflammation developed by molecule experiment agents useful for same
Lipo2000 lipofectamine
SiRNA (purchased from Shanghai JiMa pharmacy Technology Co., Ltd):
SCML4-si-1, its DNA sequence dna is as shown in the SEQ ID NO:34 in sequence table:
GGUGAACAGCAUCGGCUAUTTAUAGCCGAUGCUGUUCACCTT
SCML4-si-2, its DNA sequence dna is as shown in the SEQ ID NO:35 in sequence table:
GGAAACAGAUGUGCCUCAATTUUGAGGCACAUCUGUUUCCTT
RT-PCR primer (the prosperous bio tech ltd of Beijing AudioCodes):
IL-6-F-1, its DNA sequence dna is as shown in the SEQ ID NO:36 in sequence table:
GTACATCCTCGACGGCATCT
IL-6-R-1, its DNA sequence dna is as shown in the SEQ ID NO:37 in sequence table:
CATCTTTGGAAGGTTCAGGTT
IL-8-F-4, its DNA sequence dna is as shown in the SEQ ID NO:38 in sequence table:
CACTGTGTGTAAACATGACTTC
IL-8-R-4, its DNA sequence dna is as shown in the SEQ ID NO:39 in sequence table:
ATGCACTGACATCTAAGTTCTT
ICAM-F-1, its DNA sequence dna is as shown in the SEQ ID NO:40 in sequence table:
CTGACGTGTGCAGTAATACT
ICAM-R-1, its DNA sequence dna is as shown in the SEQ ID NO:41 in sequence table:
GGCTTCGTCAGAATCACGT
VCAM-F-4, its DNA sequence dna is as shown in the SEQ ID NO:42 in sequence table:
GTGAAGGAATTAACCAGGCT
VCAM-R-4, its DNA sequence dna is as shown in the SEQ ID NO:43 in sequence table:
CAAGAGATGATGACAGTGTCT
SELE-F-2, its DNA sequence dna is as shown in the SEQ ID NO:44 in sequence table:
GGACACAGCAAATCCCAGTT
SELE-F-2, its DNA sequence dna is as shown in the SEQ ID NO:45 in sequence table:
CTGCCAGAAGCACTAGGAAG
Ccl2-F-1, its DNA sequence dna is as shown in the SEQ ID NO:46 in sequence table:
CTGCTCATAGCAGCCACCTT
Ccl2-R-1, its DNA sequence dna is as shown in the SEQ ID NO:47 in sequence table:
CAGGTGACTGGGGCATTGATT
Five, endothelial cell apoptosis experiment agents useful for same:
Annexin V-APC/PI apoptosis detection kit (Putin Kang Li scientific & technical corporation of Beijing)
Concrete operations:
One, quantitative trait locus (eQTL) experiment is expressed
1) for extracting the anticoagulation pre-treatment of RNA:
Anticoagulation 4ml pours 15ml centrifuge tube into, 4 degree of centrifugal 10min of 3000g.Bloodletting tube 4ml 2 × PBS rinses and washes rear reservation.Abandon blood plasma, remain about 2ml hemocyte and add 1 × PBS and mend to 4ml, 50ml centrifuge tube is poured in mixing of turning upside down into, then uses 2 × PBS in step 1 to rinse to pour 50ml centrifuge tube into after washing lotion rinses the centrifuge tube washing 15ml and be made into blood dilution liquid.
2) leukocytic separation:
Get 15ml centrifuge tube, add parting liquid 4ml (948 μ L water are mended to 4ml for 2ml18% ficoll, 840 μ L thypaque sodium and 212 μ L5 × PBS), abundant vortex, wink is from making liquid level smooth.8ml whole blood diluent 10ml transfer pipet is added on parting liquid gently along the centrifugal tube wall of 15ml, can not destroy the boundary of two liquid levels.After trim, centrifugal 1 hour of 25 degree of 700g.Careful taking-up centrifuge tube, notes keeping the separating interface between each layer.Between PBS layer and parting liquid, oyster white cloud layer is leukocytic cream, immediately by the rinse in the 8ml 1.5 × PBS of preparation of 3ml dropper, directly draw leukocytic cream to be again about 3ml and to add to bottom the 15ml centrifuge tube of a pipe pre-add 8ml 1.5 × PBS, rinse in dropper upper liquid at this moment and wash.Turn upside down (can not vortex) after mixing, 4 degree of centrifugal 10min of 3000g.White precipitate at the bottom of the visible pipe of naked eyes, inhales and abandons supernatant.Add 1ml 1.5 × PBS, 4 degree of centrifugal 3min of 3000g.Supernatant is abandoned in suction, and white precipitate is white corpuscle, can carry out next step RNA extraction.
3) Trizol method extracts RNA, is dissolved in deionized formamide ,-80 DEG C of preservations.
4) the RNA ethanol redeposition of methane amide is dissolved in.
5)RT-PCR。
6) blood sample for extracting whole blood DNA carries out whole blood DNA extraction.
7) gene type is carried out by the method for LCR.
Two, destination gene expression spectrum test experience
1) 12 kinds of cells culture medium culturing of each self application.
2) total serum IgE of often kind of cell is collected respectively; The expression of RT-PCR testing goal gene.
Three, endothelial cell inflammation developed by molecule level detection experiment
1) HUVEC is laid on 6 orifice plates, controls cell density about 50%.
2) according to lipo2000 transfection reagent specification sheets transfection siRNA.
3) after 24 hours, cell total rna is collected, the expression of RT-PCR testing goal gene.
Four, endothelial cell apoptosis experiment
1) collecting cell supernatant, PBS washes 2 times, and collects; 0.25% trypsinase+0.04%EDTA digests attached cell, merges with the cell of supernatant before.
2) 1200rpm 4 degree, centrifugal 5min, tipping supernatant.
3) 300 μ L binding buffer liquid are added.
4) after adding the Annexin5 mixing of 5 μ L, 10min under room temperature (or on ice 30min).
5) the binding buffer liquid of 200 μ L is added, mixing.
6) 5 μ L PI are added, room temperature 5min (being no more than 10min).
7) upper instrument detects.
Five, statistical analysis technique
Between two groups of data average difference adopt student t-distribution (student ' s) check, two-tailed test P<0.05 is for having significant difference.
Experimental result
One, the expression pattern of SCML4 gene in various kinds of cell
The cell of participation Atheromatosis reason process mainly comprises the monocyte etc. in vascular endothelial cell, vascular smooth muscle cell, blood, and target gene to express in the histocyte of disease-related be that it plays the prerequisite of function in disease incidence process, therefore, contriver's the first step detects target gene whether to have expression in these cells.Contriver have collected and comprises Human umbilical vein endothelial cells (HUVEC), human aortic smooth muscle cell (HASMC), and human monocyte cell line (THP-1) is at interior totally 12 kinds of cells.With the expression of SCML4 gene in 12 kinds of cells that RT-PCR detects, 18s is as internal reference.Wherein, HWB is people's blood leucocyte; A549 is human lung adenocarcinoma cell; HASMC is human aortic smooth muscle cell; HCT116 is human colon cancer cell; HEK is human embryonic kidney cell; Hela is human cervical carcinoma cell; HEPG2 is human liver cancer cell; HUVEC is Human umbilical vein endothelial cells; Jurket is Leukemia T cells; MCF-7 is human breast cancer cell; THP-1 is person monocytic cell; U251 is people's DBT cell.Fig. 4 is the schematic diagram of target gene express spectra, as shown in Figure 4, SCML4 gene manages the relevant cell type of process as endotheliocyte (HUVEC) at human blood white corpuscle and to Atheromatosis, expresses in arterial smooth muscle cell (HASMC) and monocyte (THP-1).
Two, SCML4 gene expression dose is associated with rs9486729 site genotyping result
EQTL experiment is the important channel of association susceptibility loci and tumor susceptibility gene.Contriver carries out eQTL analysis to SCML4 in white corpuscle.Contriver have collected nearly 300 parts of random crowd's blood samples, and every increment originally carries out DNA and RNA respectively and extracts.According to the genotyping result of DNA, according to whether carrying low frequency allele contriver, crowd is divided into two groups.Because the low frequency allele (MAF) of related locus is lower, so it is less to carry low frequency allele group people.In order to avoid the impact of two component layers factors, group more for number is mated less group by contriver.The priority orders of coupling index is sex, age, BMI.Afterwards, dependency between each sample rs9486729 somatotype and SCML4 genetic expression is examined, with testing goal gene expression dose by order-checking and PCR in real time.Fig. 5 is SCML4 gene eQTL result schematic diagram, and wherein, transverse axis is genotyping result, and the longitudinal axis is expression of results.Markization Ct is that standard substance Δ Ct value subtracts sample Δ Ct value, and larger then expression level is higher.As shown in Figure 5: it is lower to carry rs9486729 low frequency allele group SCML4 genetic expression, and P value is 0.047.
The expression of SCML4 gene in atherosclerosis relevant cell HUVEC and HASMC is higher.Inventors have investigated this gene and whether participate in this two kinds of cells function relevant to atherogenesis.Fig. 6 a, Fig. 6 b, Fig. 6 c show respectively the variation tendency detecting HUVEC expression of adhesion molecules and chemokine after the siRNA of transfection SCML4 by PCR in real time.(wherein, in Fig. 6 a-6d, NC is control group; SiSCML4-1 is first siRNA; SiSCML4-2 is second siRNA; Result is mean value and the standard deviation of three experiments; “ ﹡ " represent there is significant difference compared with NC group.) as shown in Fig. 6 a, Fig. 6 b, Fig. 6 c, strike low SCML4 gene and also can promote the activation process of endotheliocyte: in HUVEC, strike low SCML4 gene can increase IL6 in endotheliocyte, the expression of the adhesion molecules such as E-Selectin (E-selectin) and ICAM and chemokine, and then increase and the monocytic adhesion of THP-1 (as shown in fig 6d).
On the other hand, strike low SCML4 gene in HUVEC after, the ability that Serum-induced apoptosis is removed in HUVEC opposing reduces.Fig. 7, for after striking low SCML4 gene, removes serum after 18 hours with FCM analysis, the ratio schematic diagram of viable apoptotic cell.(wherein, in Fig. 7, NC is control group; SiSCML4-1 is first siRNA; SiSCML4-2 is second siRNA; Result is mean value and the standard deviation of three experiments; “ ﹡ " represent there is significant difference compared with NC group.) because endotheliocyte anti-apoptotic ability is very important for Ink vessel transfusing cortex integrity, the reduction of anti-apoptotic ability means that the incomplete chance of endothelium increases, and then promotes atherosclerotic generation.In sum, SCML4 gene is the tumor susceptibility gene of coronary heart disease.
The foregoing is only preferred embodiment of the present invention, not in order to limit the scope of the invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (17)
1. the nucleic acid molecule be separated, it represents single nucleotide polymorphism (SNP) the site rs9486729 on SCML4 gene, and DNA sequence dna is as shown in SEQ ID NO:1, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A.
2. the nucleic acid molecule be separated, it represents SNP site chain with SNP site rs9486729 on SCML4 gene, and described chain SNP site is selected from following any one:
(1) rs4945789, its DNA sequence dna is as shown in SEQ ID NO:2, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope G;
(2) rs872548, its DNA sequence dna is as shown in SEQ ID NO:3, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(3) rs9320237, its DNA sequence dna is as shown in SEQ ID NO:4, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(4) rs7773622, its DNA sequence dna is as shown in SEQ ID NO:5, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allele C;
(5) rs6568503, its DNA sequence dna is as shown in SEQ ID NO:6, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(6) rs1878780, its DNA sequence dna is as shown in SEQ ID NO:7, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(7) rs12194084, its DNA sequence dna is as shown in SEQ ID NO:8, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(8) rs6568505, its DNA sequence dna is as shown in SEQ ID NO:9, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(9) rs12214724, its DNA sequence dna is as shown in SEQ ID NO:10, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope G;
(10) rs12214852, its DNA sequence dna is as shown in SEQ ID NO:11, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allele C;
(11) rs10457173, its DNA sequence dna is as shown in SEQ ID NO:12, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope A;
(12) rs6568508, its DNA sequence dna is as shown in SEQ ID NO:13, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T;
(13) rs7771956, its DNA sequence dna is as shown in SEQ ID NO:14, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(14) rs9400150, its DNA sequence dna is as shown in SEQ ID NO:15, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope T;
(15) rs4946871, its DNA sequence dna is as shown in SEQ ID NO:16, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(16) rs4946872, its DNA sequence dna is as shown in SEQ ID NO:17, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(17) rs12211874, its DNA sequence dna is as shown in SEQ ID NO:18, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(18) rs9400152, its DNA sequence dna is as shown in SEQ ID NO:19, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(19) rs9480807, its DNA sequence dna is as shown in SEQ ID NO:20, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope G;
(20) rs6915611, its DNA sequence dna is as shown in SEQ ID NO:21, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C;
(21) rs7767848, its DNA sequence dna is as shown in SEQ ID NO:22, and wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G;
(22) rs10782157, its DNA sequence dna is as shown in SEQ ID NO:23, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(23) rs9384663, its DNA sequence dna is as shown in SEQ ID NO:24, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope G;
(24) rs17530298, its DNA sequence dna is as shown in SEQ ID NO:25, and wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T;
(25) rs9386677, its DNA sequence dna is as shown in SEQ ID NO:26, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(26) rs9398150, its DNA sequence dna is as shown in SEQ ID NO:27, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(27) rs17596103, its DNA sequence dna is as shown in SEQ ID NO:28, and wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A;
(28) rs6931026, its DNA sequence dna is as shown in SEQ ID NO:29, and wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allele C.
3. the combination of two or more nucleic acid molecule be separated described in claim 1 or 2.
4. the combination of claim 3, it comprises SEQ ID NO:1.
5. the combination of claim 3 or 4, it can also combine with extra SNP, and other suitable SNP of preferred coronary disease susceptibility combine.
6. for detecting, the composition of examination or prediction Chinese Han Population coronary disease susceptibility, described composition comprises the nucleic acid affinity ligand of one or more SNP site as any one of claim 1-5.
7. for detecting, the test kit of examination or prediction Chinese Han Population coronary disease susceptibility, it comprises the nucleic acid affinity ligand of one or more SNP site being specific to any one of claim 1-5, and optionally ancillary component, described ancillary component comprises: PCR damping fluid, dNTP, polysaccharase, ion are as divalent cation or monovalent cation, hybridization solution.
8. the nucleic acid affinity ligand of one or more SNP site of any one of claim 1-5 is in the application for the preparation of detecting, in the composition of examination or prediction Chinese Han Population coronary disease susceptibility.
9. the composition of claim 6-8, test kit or application, wherein said nucleic acid affinity ligand is the oligonucleotide or the probe that are specific to described SNP site.
10. the composition of claim 9, test kit or application, wherein said oligonucleotide or probe have the sequence with the nucleotide complementary of described SNP site.
11. compositions according to claim 10, test kit or application, wherein, the complementary sequence of the Nucleotide of described sequence and described SNP site has the homology of at least 60%.
12. for detecting, the composition of examination or prediction Chinese Han Population coronary disease susceptibility, described composition comprises the nucleic acid affinity ligand being specific to SCML4 gene.
13. for detecting, the test kit of examination or prediction Chinese Han Population coronary disease susceptibility, it comprises the nucleic acid affinity ligand being specific to SCML4 gene, and optionally ancillary component, described ancillary component comprises: PCR damping fluid, dNTP, polysaccharase, ion are as divalent cation or monovalent cation, hybridization solution.
The nucleic acid affinity ligand of 14.SCML4 gene is in the application for the preparation of detecting, in the composition of examination or prediction Chinese Han Population coronary disease susceptibility.
The composition of 15. claim 12-14, test kit or application, wherein said nucleic acid affinity ligand is the oligonucleotide or the probe that are specific to described SCML4 gene.
The composition of 16. claims 15, test kit or application, wherein said oligonucleotide or probe have the sequence with described SCML4 gene complementation.
17. compositions according to claim 16, test kit or application, wherein, the complementary sequence of described sequence and described SCML4 gene has the homology of at least 60%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510029012.1A CN104651354B (en) | 2015-01-21 | 2015-01-21 | SCML4 gene orders and expression change detection and its application in coronary disease disease forecasting |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510029012.1A CN104651354B (en) | 2015-01-21 | 2015-01-21 | SCML4 gene orders and expression change detection and its application in coronary disease disease forecasting |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651354A true CN104651354A (en) | 2015-05-27 |
| CN104651354B CN104651354B (en) | 2017-12-15 |
Family
ID=53243001
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510029012.1A Active CN104651354B (en) | 2015-01-21 | 2015-01-21 | SCML4 gene orders and expression change detection and its application in coronary disease disease forecasting |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651354B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104991073A (en) * | 2015-06-18 | 2015-10-21 | 南通大学附属医院 | Ready-to-use rapid enzyme immune tissue chemical reagent kit for detecting SCML2 |
| CN105132565A (en) * | 2015-09-18 | 2015-12-09 | 雷桅 | Ultrasensitive molecule marker for heart disease diagnosis and classification, as well as application of ultrasensitive molecule marker |
| CN113549688A (en) * | 2021-08-27 | 2021-10-26 | 河北医科大学第二医院 | Group of molecular markers for diagnosing coronary artery disease |
| CN113637738A (en) * | 2021-08-08 | 2021-11-12 | 华中科技大学同济医学院附属协和医院 | SNP (single nucleotide polymorphism) site related to coronary heart disease and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007128884A1 (en) * | 2006-05-09 | 2007-11-15 | Oy Jurilab Ltd | Novel genes and markers in type 2 diabetes and obesity |
| CN103890193A (en) * | 2011-08-29 | 2014-06-25 | 心脏Dx公司 | Methods and compositions for determining smoking status |
-
2015
- 2015-01-21 CN CN201510029012.1A patent/CN104651354B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007128884A1 (en) * | 2006-05-09 | 2007-11-15 | Oy Jurilab Ltd | Novel genes and markers in type 2 diabetes and obesity |
| CN103890193A (en) * | 2011-08-29 | 2014-06-25 | 心脏Dx公司 | Methods and compositions for determining smoking status |
Non-Patent Citations (6)
| Title |
|---|
| ID: RS9486729: "Reference SNP (refSNP) Cluster Report: rs9486729", 《NCBI DBSNP》 * |
| JIN GUO 等: "Association between 9p21.3 genomic markers and coronary artery disease in East Asians: a meta-analysis involving 9,813 cases and 10,710 controls", 《MOL BIOL REP》 * |
| 刘晓宇 等主编: "《遗传医学进展》", 31 May 2014 * |
| 孙汶生 等主编: "《基因工程学》", 31 August 2004 * |
| 郑维（芝加哥大学） 主编: "《汉英医学分子生物学实验方法》", 31 March 2005 * |
| 郭健: "中国汉人群全基因组关联分析发现两个新的冠心病易感位点", 《道客巴巴》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104991073A (en) * | 2015-06-18 | 2015-10-21 | 南通大学附属医院 | Ready-to-use rapid enzyme immune tissue chemical reagent kit for detecting SCML2 |
| CN105132565A (en) * | 2015-09-18 | 2015-12-09 | 雷桅 | Ultrasensitive molecule marker for heart disease diagnosis and classification, as well as application of ultrasensitive molecule marker |
| CN113637738A (en) * | 2021-08-08 | 2021-11-12 | 华中科技大学同济医学院附属协和医院 | SNP (single nucleotide polymorphism) site related to coronary heart disease and application thereof |
| CN113637738B (en) * | 2021-08-08 | 2023-07-28 | 华中科技大学同济医学院附属协和医院 | SNP locus related to coronary heart disease and application thereof |
| CN113549688A (en) * | 2021-08-27 | 2021-10-26 | 河北医科大学第二医院 | Group of molecular markers for diagnosing coronary artery disease |
| CN113549688B (en) * | 2021-08-27 | 2023-08-04 | 河北医科大学第二医院 | A set of molecular markers for diagnosing coronary artery disease |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651354B (en) | 2017-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101845520B (en) | HPA allelic gene typing detection reagent kit | |
| CN104651354B (en) | SCML4 gene orders and expression change detection and its application in coronary disease disease forecasting | |
| CN105567861B (en) | Purposes of the IFI27 as diagnosis of coronary heart disease marker | |
| CN106929568A (en) | Method for treating, diagnosing and monitor lupus | |
| CN105907870A (en) | Use of DHX36 as coronary heart disease diagnostic marker | |
| CN110387412A (en) | Primer combination and kit and method for instructing Rosuvastatin drug personalized medicine related gene to detect | |
| CN106755563A (en) | Application of the biomarker in Parkinson is diagnosed | |
| CN104711255B (en) | THSD7A gene orders and expression change detection and its application in coronary disease disease forecasting | |
| CN105969889B (en) | The purposes of MUC3B gene SNP site | |
| CN108624680A (en) | The application of RAE1 genes or albumen as the biomarker of diagnosing myocardial infarction | |
| CN103710447B (en) | Method and reagent for predicting susceptibility of ankylosing spondylitis | |
| CN103710448B (en) | Method and kit for predicting susceptibility of ankylosing spondylitis | |
| EP4036233A1 (en) | Method for detecting brain tumor | |
| CN105821152A (en) | Biological marker for coronary heart disease | |
| CN106520970B (en) | Marker for diagnosing cerebral apoplexy | |
| CN105039543B (en) | Available for the kit and its application for detecting the PTPN1 gene promoter zone methylation degree related to diabetes B | |
| CN103695549B (en) | Agent for predicting susceptibility to ankylosing spondylitis | |
| CN104293958B (en) | A kind of test kit predicting susceptibility of ankylosing spondylitis and method | |
| CN108796068A (en) | DOCK10 genes for early diagnosing myocardial infarction | |
| CN108796067A (en) | The diagnosis new function of MAEA genes in blood | |
| CN103882112B (en) | A kind of reagent and method predicting susceptibility of ankylosing spondylitis | |
| CN103882111B (en) | Reagent for predicting susceptibility of ankylosing spondylitis | |
| WO2015037681A1 (en) | Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit | |
| KR101772448B1 (en) | A composition for determining personality traits | |
| CN104293969B (en) | A kind of reagent predicting susceptibility of ankylosing spondylitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |