CN113637738A

CN113637738A - SNP (single nucleotide polymorphism) site related to coronary heart disease and application thereof

Info

Publication number: CN113637738A
Application number: CN202110905130.XA
Authority: CN
Inventors: 程翔; 查灵凤
Original assignee: Tongji Medical College of Huazhong University of Science and Technology
Current assignee: Tongji Medical College of Huazhong University of Science and Technology
Priority date: 2021-08-08
Filing date: 2021-08-08
Publication date: 2021-11-12
Anticipated expiration: 2041-08-08
Also published as: CN113637738B; CN117757914A

Abstract

The invention belongs to the field of biotechnology research, and discloses an SNP locus related to coronary heart disease and application thereof. In particular to the application of the rs2069812 site of IL5 gene or the rs2057687 site of IL5 gene in the preparation of a coronary heart disease examination and screening medicament, wherein the coronary heart disease comprises myocardial infarction and angina; the application of the detection reagent of the rs2069812 site of the IL5 gene and/or the rs2057687 site of the IL5 gene in the preparation of the coronary heart disease examination screening medicine; the application of the allele type which is obviously related to the susceptibility of the coronary heart disease in the preparation of the coronary heart disease examination and screening medicine; application of low-risk allele of coronary heart disease in preparation of coronary heart disease examination and screening drugs. The invention discovers a new coronary heart disease detection site, discovers different risk levels aiming at different alleles, and provides a new scheme for diagnosis, prevention and the like of subsequent coronary heart disease.

Description

SNP (single nucleotide polymorphism) site related to coronary heart disease and application thereof

Technical Field

The invention belongs to the field of biotechnology research, and particularly relates to an SNP (single nucleotide polymorphism) site related to coronary heart disease and application thereof.

Background

Coronary heart disease (CAD) is a complex Cardiovascular disease (CVD) caused by the combined action of genetic and environmental factors, and the pathological basis of the CAD is Atherosclerosis (AS) or (and) Coronary spasm, when Atherosclerosis occurs in Coronary artery, the Coronary artery lumen is narrowed or blocked, resulting in insufficient blood supply to heart, and is also called Ischemic Heart Disease (IHD). CAD is one of ten killers that endanger human health and is one of the leading causes of death in the population worldwide. The 2016 world health organization WHO statistics show that worldwide mortality caused by IHD is the first to occur worldwide, placing a tremendous economic and medical burden on society and reducing the quality of life of people. The chinese cardiovascular disease report in 2017 showed that the prevalence of chinese CVD was in a continuously rising stage from 1995 to 2015. At present, the number of CVD patients in China is as high as 2.9 hundred million, and the number of CAD patients reaches 1100 million.

Third generation genetic markers are Single Nucleotide Polymorphisms (SNPs), which often refer to single base changes on DNA sequences in the genome. SNPs are spread throughout the human genome, with one SNP for every 1000 nucleotides in the human genome, and over 300 million SNPs in a total of 30 hundred million bases in humans. SNP is currently the most common and effective genetic marker for disease research. In recent years, the prediction of the occurrence and development of diseases by using SNP has become a hot spot of clinical and scientific researchers, and the application value of the SNP in the prediction of important diseases such as tumors, cardiovascular and cerebrovascular diseases and the like is very early seen.

Although a large number of susceptibility genes of coronary heart disease have been discovered through genetic research, the susceptibility genes can only explain about 28% of the inheritance degree of coronary heart disease, and the inheritance degree of coronary heart disease is found to be more than 40% through family aggregation research and twin research, so that a considerable part of the genetic basis of coronary heart disease is not clearly explained, and further research is still needed on the genetic basis of coronary heart disease and susceptibility genes of coronary heart disease.

Disclosure of Invention

Aiming at the problems, the invention provides the SNP locus related to the coronary heart disease and the application thereof, and mainly provides a new detection locus and a new detection reagent for the coronary heart disease.

In order to solve the problems, the invention adopts the following technical scheme:

an application of an IL5 gene rs2069812 site or an IL5 gene rs2057687 site in preparation of a coronary heart disease screening and/or preventing and treating medicine. Coronary heart disease includes myocardial infarction and angina pectoris.

Application of a detection reagent of IL5 gene rs2069812 site and/or IL5 gene rs2057687 site in preparation of a coronary heart disease examination and screening medicine.

The IL5 gene sequence can be shown as SEQ ID NO.1, is a common sequence, when the mononucleotide of other sites of the IL5 gene is mutated, the protection of the detection site related to the invention is not influenced, and when other sites are changed relative to the SEQ ID NO.1, the invention also falls within the scope of the invention.

In some embodiments, the IL5 gene rs2069812 site detection reagent comprises a primer pair or a nucleic acid probe for amplifying the IL5 gene rs2069812 site, and/or the IL5 gene rs2057687 site detection reagent comprises a primer pair or a nucleic acid probe for amplifying the IL5 gene rs2057687 site.

In some modes, the amplified IL5 gene rs2069812 site comprises a primer pair of the following sequences

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

the rs2057687 site of the amplified IL5 gene comprises a primer pair with the following sequence

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.

The application of the allele which is obviously related to the susceptibility of the coronary heart disease in the preparation of the drugs for screening, preventing and treating the coronary heart disease, wherein the mononucleotides of the allele at the sites of IL5 gene rs2069812 and IL5 gene rs2057687 are A, C respectively.

The application of the coronary heart disease low-risk allele in the preparation of a coronary heart disease examination screening medicine is that the mononucleotides of the allele at the IL5 gene rs2069812 and the IL5 gene rs2057687 are G, T respectively.

The coronary heart disease examination screening medicine comprises a detection reagent of an IL5 gene rs2069812 site and/or an IL5 gene rs2057687 site.

Some methods include a primer pair for amplifying rs2069812 site of IL5 gene, and/or a primer pair for amplifying rs2057687 site of IL5 gene;

preferably, the coronary heart disease examination and screening medicine is a coronary heart disease susceptibility examination and screening medicine, at least comprises one of an A allele detection agent as the mononucleotide at rs2069812 site of IL5 gene and a C allele detection agent as the mononucleotide at rs2057687 site of IL5 gene, or

The coronary heart disease examination and screening medicine is a coronary heart disease low-risk examination and screening medicine, and at least comprises one of G allele detection agent as the mononucleotide at rs2069812 site of IL5 gene and T allele detection agent as the mononucleotide at rs2057687 site of IL5 gene.

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.

The PCR primer reagent for detecting coronary heart disease susceptibility comprises a primer pair with the following sequence

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

and/or

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.

The method for screening the biological sample susceptible to the coronary heart disease comprises the following steps:

extracting a nucleic acid sample from a biological sample to be detected;

specifically amplifying an IL5 gene by taking the extracted nucleic acid sample as a template, recovering and purifying an amplification product, and determining the nucleic acid sequence of the amplification product;

judging whether the mononucleotide at the rs2069812 site of the determined nucleic acid sequence is A, if so, determining that the biological sample to be detected is a biological sample susceptible to coronary heart disease, and/or

And judging whether the single nucleotide at the site rs2057687 of the determined nucleic acid sequence is C, if so, determining that the biological sample to be detected is a biological sample susceptible to coronary heart disease.

The application of the gene segment in preparing the medicine for preventing and treating coronary heart disease is that the gene segment containing rs2069812 site mononucleotide G in IL5 gene or the gene segment containing rs2057687 site mononucleotide T in IL5 gene. The purposes of subsequent treatment or prevention and treatment of relapse and the like are realized by replacing the gene segments.

The medicine for preventing and treating coronary heart disease includes gene carrier containing

A gene fragment capable of replacing the mononucleotide A at the rs2069812 site in the IL5 gene with the mononucleotide G and expressing, or

A gene segment capable of replacing the single nucleotide C at the rs2057687 site in the IL5 gene with the single nucleotide T and expressing;

some expression forms of the gene vector are plasmid and adenovirus vectors. On the premise of not violating the scientific ethics and relevant legal provisions, the existing or subsequent means for achieving the above purpose shall be within the scope of the present invention, and the requirements are that the gene segments or their similar substances can be carried and replaced, and the specific type of the gene vector is not particularly limited.

The invention has the beneficial effects that:

a new coronary heart disease detection site is discovered, different risk grades are discovered aiming at different alleles, and a new scheme is provided for subsequent diagnosis, prevention and treatment of coronary heart disease and the like.

Drawings

FIG. 1 is a diagram of a PCR amplification program;

FIG. 2 is a graph of the results of rs2069812 typing;

FIG. 3 is a graph of the results of rs2057687 typing.

Detailed Description

The invention is further illustrated below:

the application of the rs2069812 site of the IL5 gene or the rs2057687 site of the IL5 gene in the preparation of drugs for coronary heart disease examination, screening and/or prevention and treatment.

In some cases of high association detection of coronary heart disease, the mononucleotide of the allele at the rs2069812 site of IL5 gene and the rs2057687 site of IL5 gene is A, C respectively; for low risk screening, the mononucleotide was G, T, respectively.

The foregoing specific embodiments are described in detail with reference to the accompanying drawings, and all such modifications are intended to be included within the scope of the invention. When the gene fragment is used as a preventive and therapeutic drug, the gene fragment can be used as a therapeutic target point and the like in the preparation process of the drug, or the related gene fragment containing the site can be used as auxiliary reagents in the preparation process of the coronary heart disease preventive and therapeutic drug, for example, the gene fragment can be used in the steps of testing, extracting and the like in the preparation process of the biological drug.

In some embodiments, the IL5 gene rs2069812 site detection reagent comprises a primer pair for amplifying the IL5 gene rs2069812 site, and/or the IL5 gene rs2057687 site detection reagent comprises a primer pair for amplifying the IL5 gene rs2057687 site.

In some embodiments, the primer pair for amplifying the rs2069812 site of the IL5 gene comprises an upstream primer 5'-CCTGCTGCTCATGAACAGAATA-3',

a downstream primer 5'-AGTGACTCTTCCTTGACTCCA-3';

the primer pair for amplifying rs2057687 site of IL5 gene comprises

The upstream primer 5'-TTTTCCCATCAGCTCAGGGT-3' is the primer that is used,

the downstream primer 5'-ATAGTCCCAGTCTGCGTGTG-3'.

Application of coronary heart disease susceptibility related allele in preparation of coronary heart disease examination, screening, prevention and treatment medicines is characterized in that the mononucleotides of the allele at IL5 gene rs2069812 and IL5 gene rs2057687 are A, C respectively. In the preparation of the prevention and treatment medicine, the medicine is mainly used as an action target in the research and development preparation process of the medicine.

The application of the coronary heart disease low-risk allele in the preparation of the coronary heart disease examination screening medicine is characterized in that the mononucleotides of the allele at the IL5 gene rs2069812 and the IL5 gene rs2057687 are G, T respectively. However, the allele has a certain reference significance for coronary heart disease detection.

In some embodiments, the kit comprises a primer pair or a nucleic acid probe for amplifying rs2069812 site of IL5 gene, and/or a primer pair or a nucleic acid probe for amplifying rs2057687 site of IL5 gene;

the nucleic acid probe may be a proximal gene detection probe, and is not particularly limited as long as it is possible.

Preferably, the coronary heart disease examination and screening medicine is a coronary heart disease susceptibility (susceptibility indicates susceptibility to coronary heart disease, high risk, and the risk judgment standard can refer to other detection means in some modes) examination and screening medicine, and at least comprises one of an A allele detection agent as the mononucleotide at rs2069812 site of IL5 gene, a C allele detection agent as the mononucleotide at rs2057687 site of IL5 gene, or

a downstream primer 5'-AGTGACTCTTCCTTGACTCCA-3';

the primer pair for amplifying rs2057687 site of IL5 gene comprises

The upstream primer 5'-TTTTCCCATCAGCTCAGGGT-3' is the primer that is used,

the downstream primer 5'-ATAGTCCCAGTCTGCGTGTG-3'.

PCR primer for detecting coronary heart disease susceptibility, wherein the PCR primer at least comprises one of the following primers

In some embodiments with better detection effect, the mononucleotide of the rs2069812 of the IL5 gene and the rs2057687 site of the IL5 gene related to detection by the primer and the probe is A, C respectively.

extracting a nucleic acid sample from a biological sample to be detected;

The application of the gene segment in preparing the medicine for preventing and treating coronary heart disease is that the gene segment of the IL5 gene containing the mononucleotide at the rs2069812 site as G or the gene segment of the IL5 gene containing the mononucleotide at the rs2057687 site as T.

A mononucleotide G gene segment (comprising an allele segment) at the rs2069812 site of the IL5 gene, and can replace a mononucleotide A gene segment at the rs2069812 site of the IL5 gene at the corresponding position and express (the core purpose is to replace the mononucleotide A with the mononucleotide G); or, IL5 gene rs2057687 site mononucleotide T gene segment (containing allele segment) and can replace corresponding position IL5 gene rs2057687 site mononucleotide C gene segment and express (the core purpose is to replace mononucleotide C with mononucleotide T); some expression forms of the gene vector are plasmid and adenovirus vectors. Such as the transcription activator-like effector protein nucleases and the like are techniques which have been proven in practice. The gene vector can introduce any one of the two gene segments into a human body to replace the defective IL5 gene rs2069812 site mononucleotide A or IL5 gene rs2057687 site mononucleotide C, so that the risk of coronary heart disease in the human body is reduced, and the coronary heart disease is even treated. The mutant gene is replaced to restore the normal gene sequence to realize treatment, thereby achieving the purposes of prevention and treatment. At present, the gene vector preferably considers known and mature vectors, but does not exclude other vectors with similar functions, and of course, the new emergence in the future is recognized and should be within the scope of the present invention.

The following is described in detail with reference to some specific experiments:

1. human peripheral blood whole genome DNA extraction

Human peripheral blood whole genome DNA was extracted using Bloodgen Mini Kit blood gene column type miniprep Kit (CW 2087) available from Kangji. The operation steps are according to the kit use instruction.

2. Primer design

After the gene IL5 is input into Ensemble, all gene sequences are obtained, all variation sites are displayed, the position of each SNP is found, primers are designed by using Primer and Genetool software, electronic PCR is carried out on a UCSC website after the primers are obtained, the PCR result shows that no special structure exists and the PCR target band is single, and the synthetic primers can be customized. The primers used in the research are synthesized and prepared by Tianyihui company, and each primer is synthesized to 4OD and is subpackaged in two tubes.

The IL5 gene locus information is shown in the following table:

the genotyping primers designed for the SNPs are shown in the following table:

PCR amplification

The amplification system and procedure were as follows:

amplification system (25 μ L):

the coronary heart disease susceptibility gene PCR amplification method comprises the following steps

Constructing an amplification system: mixing the upstream primer, the downstream primer, the DNA to be detected, Taq DNA polymerase and nucleic acid dye,

DNA denaturation: in the environment of 90-96 ℃, double-stranded DNA is subjected to thermal action, hydrogen bonds are broken to form single-stranded DNA,

annealing: in the SNP optimal Tm environment, the primer is combined with a DNA template to form a local double strand,

extension: at 70-72 deg.C, under the action of Taq DNA polymerase, using dNTP as raw material, extending from 5 '-3' end to synthesize template complementary DNA chain,

DNA denaturation, annealing and extension are circulated for several times, and finally the temperature is recovered.

The amplification procedure is shown in FIG. 1. Wherein the optimal Tm of rs2069812 is 55 ℃, and the optimal Tm of rs2057687 is 58 ℃.

SNP typing

The high-resolution melting curve is a new real-time quantitative technology developed on the basis of real-time fluorescent PCR, and gene mutation scanning and genotyping are carried out by monitoring the combination condition of double-stranded DNA fluorescent dye and PCR amplification products in the heating process in real time. If the double-stranded DNA fragment has the SNP sites, the SNP sites are sequentially melted down due to different single bases in the temperature rising process, so that whether the SNP exists in the DNA fragment can be judged according to the melting curve and the melting temperature. Because different SNP sites and genotypes can generate different melting curve peak shapes, different SNP sites and genotypes can be effectively distinguished according to the melting curves. According to the curve of the detection sample and the curve of the positive control sample, the wild type, heterozygous mutation, pure mutation and mutation can be accurately distinguished, and corresponding software can be used for rapid typing. And putting 36 (3 genotype samples containing 3 SNPs as positive control samples) PCR amplification products into a Rotor-Gene 6000 fluorescent quantitative PCR instrument for typing detection, and reading the result. The nucleic acid dye used in the experiment was SYTO 9 fluorescent dye, and the HRM instrument used was Rotor-Gene 6000. By using the method for typing, the typing result of the sample can be quickly and accurately obtained, and 36 samples can be detected in 8 minutes on average. The results of the method were verified by Sanger sequencing, all positive samples were correctly detected with 100% accuracy. Fig. 2 is the typing result of rs2069812, and fig. 3 is the typing result of rs 2057687.

Example of the implementation

Two newly found SNP sites on IL5 gene were associated with coronary heart disease susceptibility (case-control analysis): 1863 Chinese Han nationality coronary heart disease population samples and 1920 healthy control population samples were selected for research, clinical data were collected, peripheral blood samples were collected, and whole genome DNA was extracted using the BloodGenMini Kit blood gene column type quantitative extraction Kit provided by Kangji century.

The SNP sites rs2057687 and rs2069812 of the above-mentioned case and control population were genotyped. After obtaining the genotype of each sample, Hadi-Winberg equilibrium detection is firstly carried out on the two SNPs.

The specific analysis is as follows: if p represents the frequency of the A allele; q represents the allele frequency of the gene a, the frequency of genotype AA is p2, the frequency of genotype AA is 2pq, and the frequency of genotype AA is q 2. The sum of the genotype frequencies should equal 1, i.e. p2+2pq + q2 equals 1. In case and control correlation studies, the detected variation requires a Hardy-Weinberg equilibrium test in the control population, and the variation from this test indicates that the variation is not shifted in the population studied and represents the genetic profile of the entire population.

The sites that meet the Hardy-Weinberg equilibrium are further subjected to association analysis, and whether the alleles of the SNP sites are related to the case-control group is tested by using the chi-square, wherein the specific analysis is as follows: chi-square test is a common hypothesis test method based on chi-2 distribution, and its invalid hypothesis H0 means that the observed frequency is not different from the expected frequency. The basic idea of this test is: first, assuming that H0 holds, the χ 2 value, which is the degree of deviation between the observation frequency and the theoretical frequency, is calculated. The probability P value, under the current statistics or more extreme, is then determined from the χ 2 distribution and degrees of freedom, assuming that H0 holds true. If the value of P is small, the deviation degree of the observation frequency and the theoretical frequency is large, and the H0 assumption should be rejected, namely that the researched data have a significant difference; otherwise the H0 hypothesis cannot be rejected, i.e. differences between the samples studied cannot be considered. In this study, the difference in the distribution of the smoking rate, male and female rate, hypertension rate and diabetes rate in the clinical data of the comparative case group and the control group was examined using a 2X 2 List chi Fang. When the association analysis of SNP locus and coronary heart disease is carried out, 2 x 2 tabulated chi-square is used for testing whether the distribution of SNP allele is obviously different in case group and control group. Logistic regression is commonly used in case-control association analysis studies to assess the independent relationship between genotype and disease. In the study, the dependent variables are disease states and are divided into two types including coronary heart disease and coronary heart disease, and the independent variables comprise SNP genotypes and 10 independent risk factors of the coronary heart disease: gender, age, hypertension, diabetes, smoking, BMI and four-item blood lipids. And taking 10 risk factors as covariates during Logistic regression calculation, taking the SNP genotype as independent variables, and obtaining P values and OR values associated with diseases and corresponding 95% positional intervals of the independent variables through SPSS calculation. When the calculated P value of the genotype is less than 0.05, the genotype is independently and obviously related to the disease and has statistical significance, and when the calculated P value is more than 0.05, the genotype is not related to the disease.

The results are shown in the following table.

Table 1: result of allele association analysis of SNP on IL5 with CAD

Note: through analysis, the genotype frequencies of the two SNPs in the total population both accord with the genetic Hardy-Weinberg balance (P is more than 0.05), and the research object is considered to have good representativeness. OR (95% CI) indicates the odds ratio (95% confidence interval), the OR value for different genotypes is an estimate of the relative risk of the gene causing disease for disease incidence, when the OR value is 1, the factor is not effective for disease occurrence, when the OR value is greater than 1, the factor is a risk factor, and when the OR value is less than 1, the factor is a protective factor; the P value represents the statistical significance, when P is less than 0.05, the comparative samples have significant difference, Pobs represents the P value without common risk factors for correcting the coronary heart disease, and Padj represents the P value after common risk factors for correcting the coronary heart disease comprise sex, age, hypertension, diabetes, smoking, blood fat and the like.

The results in table 1 show that the difference between the allele C at the SNP site rs2057687 and the allele T between the case and the control group is significant (P < 0.05 after correction), which indicates that the allele C and the allele T at the SNP site rs2057687 are associated with coronary heart disease susceptibility, and the number of people with C at the allele in the coronary heart disease population is significantly higher than that in the control group, i.e., the allele C at the SNP site rs2057687 is determined to be a coronary heart disease susceptibility allele, and the allele T is a coronary heart disease low risk allele.

Similarly, the difference between the allele G at the SNP locus rs2069812 and the allele A between the case and the control group is significant (P < 0.05 after correction), which indicates that the allele G and the allele A at the SNP locus rs2069812 are related to coronary heart disease susceptibility, and the number of people with the allele A at the position in the coronary heart disease population is obviously higher than that in the control group, namely, the A at the SNP locus rs2069812 is judged to be the coronary heart disease susceptibility allele, and the G is the coronary heart disease low-risk allele.

It will be apparent to those skilled in the art that various modifications may be made to the above embodiments without departing from the general spirit and concept of the invention. All falling within the scope of protection of the present invention. The protection scheme of the invention is subject to the appended claims.

Sequence listing

<110> affiliated cooperation hospital of college of Tongji medical college of Huazhong university of science and technology

<120> coronary heart disease-related SNP site and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 2

<211> 2078

<212> DNA

<213> person (Huma)

<400> 2

atgcactttc tttgccaaag gcaaacgcag aacgtttcag agccatgagg atgcttctgc 60

atttgagttt gctagctctt ggagctgcct acgtgtatgc catccccaca gaaattccca 120

caagtgcatt ggtgaaagag accttggcac tgctttctac tcatcgaact ctgctgatag 180

ccaatgaggt aattttcttt atgattccta cagtctgtaa agtgcatagg taatcatttg 240

tgatggttcc tttactatat atagagatct gttataaata ataagattct gagcacatta 300

gtacatgggt gataactaca tcaccagcaa acattctgtt aaaagttatg aatgctggtg 360

tgctgtaaaa atgattgtat ttcctttcct ctccagactc tgaggattcc tgttcctgta 420

cataaaaatg taagttaaat tatgattcag taaaatgatg gcatgaataa gtaaatttcc 480

tgttttaagc tgtaaatcat tagttatcat tggaactatt taattttcta tattttgttt 540

tcatatgggt ggctgtgaat gtctgtactt ataaatatga ggaatgactt tttatcaagt 600

agaatccttt aaacaagtgg attaggctct ttggtgatgt tgttagtttg cctcccaaag 660

agcatcgtgt cagggattct ttccagaagg attccacact gagtgagagg tgcgtgctag 720

tctccgtgca gttctgactc tttctcactc taacgtgttt ctgaaagtat tagcaactca 780

gaattatatt tttagaacca tgatcagtag acattaaaat atataacaaa tgccctatat 840

taataatttc tgcatactta aataattatg actatatgat ggtgttgtat gcatttgaat 900

atgtcctggt catattaaaa tgtaaaatat atagttttat tagtctaaat agaataaaac 960

taccagctag aactgtagaa acacattgat atgagtttaa tgtataatgc attacacttc 1020

caaaacattt ttttccagtt acataattaa gttatatcct ttataaaact cctcagtaat 1080

catataagct tcatctactt tttgaaaatt ttatcttaat atgtggtggt ttgttgccta 1140

gaaaacaaac aaaaaactct ttggagaagg gaactcatgt aaataccaca aaacaaagcc 1200

taactttgtg gaccaaaatt gttttaataa ttatttttta attgatgaat taaaaagtat 1260

atatatttat tgtgtacaat atgatgtttt gaagtatgta tacattgcag aatggacaat 1320

ggaccaaatt tttatacctt gtcttgatta tttgcatttt aaaaattttc ctcatttagc 1380

accaactgtg cactgaagaa atctttcagg gaataggcac actggagagt caaactgtgc 1440

aagggggtac tgtggaaaga ctattcaaaa acttgtcctt aataaagaaa tacattgacg 1500

gccaaaaagt aagttacaca cattcaatgg aagctatatt tgtctggctg tgcctatttc 1560

tatggaattg acagtttcct gtaataccta ttgtcatttt tcttttttca cagaaaaagt 1620

gtggagaaga aagacggaga gtaaaccaat tcctagacta cctgcaagag tttcttggtg 1680

taatgaacac cgagtggata atagaaagtt gagactaaac tggtttgttg cagccaaaga 1740

ttttggagga gaaggacatt ttactgcagt gagaatgagg gccaagaaag agtcaggcct 1800

taattttcag tataatttaa cttcagaggg aaagtaaata tttcaggcat actgacactt 1860

tgccagaaag cataaaattc ttaaaatata tttcagatat cagaatcatt gaagtatttt 1920

cctccaggca aaattgatat acttttttct tatttaactt aacattctgt aaaatgtctg 1980

ttaacttaat agtatttatg aaatggttaa gaatttggta aattagtatt tatttaatgt 2040

tatgttgtgt tctaataaaa caaaaataga caactgtt 2078

Claims

Application of an IL5 gene rs2069812 site or an IL5 gene rs2057687 site in preparation of drugs for screening, preventing and treating coronary heart disease.
Application of a detection reagent of an IL5 gene rs2069812 site and/or an IL5 gene rs2057687 site in preparation of a coronary heart disease examination and screening medicine.
3. The use according to claim 1 or 2, wherein the detection reagent for the rs2069812 site of the IL5 gene comprises a primer pair for amplifying the rs2069812 site of the IL5 gene, and/or the detection reagent for the rs2057687 site of the IL5 gene comprises a primer pair for amplifying the rs2057687 site of the IL5 gene; preferably, the mononucleotide of the allele at the IL5 gene rs2069812 and the IL5 gene rs2057687 is A, C.
4. The use according to claim 3, wherein the primer pair for amplifying the rs2069812 site of the IL5 gene comprises the following sequence

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

the rs2057687 site of the amplified IL5 gene comprises a primer pair with the following sequence

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.
5. The application of the allele which is obviously related to the susceptibility of the coronary heart disease in the preparation of the drugs for screening, preventing and treating the coronary heart disease is characterized in that the mononucleotides of the allele at the sites of IL5 gene rs2069812 and IL5 gene rs2057687 are A, C respectively.
6. The application of the coronary heart disease low-risk allele in the preparation of the coronary heart disease examination screening medicine is characterized in that the mononucleotides of the allele at the IL5 gene rs2069812 and the IL5 gene rs2057687 are G, T respectively.
7. The coronary heart disease examination screening medicine is characterized by comprising a detection reagent of an IL5 gene rs2069812 site and/or an IL5 gene rs2057687 site.
8. The screening drug for coronary heart disease examination according to claim 7, which comprises a primer pair or a nucleic acid probe for amplifying the rs2069812 site of IL5 gene, and/or a primer pair or a nucleic acid probe for amplifying the rs2057687 site of IL5 gene;

preferably, the coronary heart disease examination and screening medicine is a coronary heart disease susceptibility examination and screening medicine, at least comprises one of an A allele detection agent as the mononucleotide at rs2069812 site of IL5 gene and a C allele detection agent as the mononucleotide at rs2057687 site of IL5 gene, or

The coronary heart disease examination and screening medicine is a coronary heart disease low-risk examination and screening medicine, and at least comprises one of G allele detection agent as the mononucleotide at rs2069812 site of IL5 gene and T allele detection agent as the mononucleotide at rs2057687 site of IL5 gene;

preferably, the amplified IL5 gene rs2069812 site comprises the following sequence primer pair

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

the rs2057687 site of the amplified IL5 gene comprises a primer pair with the following sequence

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.
9. The PCR primer reagent for detecting coronary heart disease susceptibility is characterized in that the PCR primer reagent comprises a primer pair with the following sequence

The sequence of the upstream primer CCTGCTGCTCATGAACAGAATA is shown,

a downstream primer sequence AGTGACTCTTCCTTGACTCCA;

and/or

The sequence of the upstream primer TTTTCCCATCAGCTCAGGGT is shown,

the downstream primer sequence ATAGTCCCAGTCTGCGTGTG.
10. A method for screening a biological sample susceptible to coronary heart disease,

extracting a nucleic acid sample from a biological sample to be detected;

specifically amplifying an IL5 gene by taking the extracted nucleic acid sample as a template, recovering and purifying an amplification product, and determining the nucleic acid sequence of the amplification product;

judging whether the mononucleotide at the rs2069812 site of the determined nucleic acid sequence is A, if so, determining that the biological sample to be detected is a biological sample susceptible to coronary heart disease, and/or

And judging whether the single nucleotide at the site rs2057687 of the determined nucleic acid sequence is C, if so, determining that the biological sample to be detected is a biological sample susceptible to coronary heart disease.

The application of the gene fragment in preparing the medicine for preventing and treating coronary heart disease is characterized in that the gene fragment is a gene fragment containing the single nucleotide at the rs2069812 site in the IL5 gene as G or a gene fragment containing the single nucleotide at the rs2057687 site in the IL5 gene as T.

The medicine for preventing and treating coronary heart disease is characterized by comprising a gene vector containing

A gene fragment capable of replacing the mononucleotide A at the rs2069812 site in the IL5 gene with the mononucleotide G and expressing, or

The gene segment can replace the mononucleotide C at the rs2057687 site in the IL5 gene with the mononucleotide T and express the mononucleotide T.