CN108949953A - Detect primer, method and kit that ABCG8 introne 9 is mutated - Google Patents

Abstract

The invention discloses primer, method and the kits of detection 9 region 35113delA deletion mutation of phytosterolemia related gene ABCG8 introne.Using Sanger sequencing technologies, the region mutagenesis site can be quickly found.The discovery in the mutational site generates whether ABCG8 gene mutation will cause phytosterolemia convenient for judgement and analysis, and auxiliary finds out the cause of disease for causing the disease.

Description

Detect primer, method and kit that ABCG8 introne 9 is mutated

Technical field

The invention belongs to life science and field of biotechnology, in particular to detection phytosterolemia ABCG8 gene includes The primer of 9 mutation of son can be used for quickly detecting the catastrophe of ABCG8 introne 9 using regular-PCR technology.

Background technique

Sitosterolemia is a kind of autosomal recessive disease, it is characterized in that plasma cholesterol levels height (compares normal person It is 10-25 times high).Other of the individual influenced by gastrointestinal tract sterol mass formed by blood stasis are characterized in tendon and xanthoma tuberosum, hemolytic breaking-out And arthritis, and accelerate atherosclerosis and coronary artery disease.High-caliber plant steroid in the individual of Sitosterolemia Alcohol is usually caused by being increased as intestinal absorption, because sitosterol ATP combination box (ABC) transporter ABCG5 or ABCG8 are in chromosome It works on 2Pi, this is normally, to work to the excretion of sterol.All Sitosterolemias are caused by ABCG8 mutation (about 74% case) or ABCG5 (about 26% case).

The purpose of detection ABCG8 gene mutation is: 1.Distinguish that hypercholesterolemia and high-level phytosterol occur for early stage The ABCG8 hereditary feature of mass formed by blood stasis patient.2.Familial is carried out to the asymptomatic family member of hypercholesterolemia family history early to send out The confirmation of property hypercholesterolemia and the suspected diagnosis of high-caliber phytosterol.

ABCG8 sequencing is carried out by expanding all exons and introne/exon boundary, is then carried out two-way Sanger sequencing.The mononucleotide replacement and/missing of the sensibility estimation about 99% of full genome sequencing.All nucleotide variations The prediction for analyzing current database and document is pathogenic.Sitosterolemia gene (ABCG8) can be individually or as a panel It is sequenced.

Summary of the invention

The object of the present invention is to provide a kind of primers that detection ABCG8 gene intron 9 is mutated can be used using round pcr In the catastrophe of quickly detection ABCG8 gene intron 9, and find the mutation type of phytosterolemia genetic correlation, from And to judge that phytosterolemia hereditary information provides foundation.

Detect the primer of 9 gene mutation of ABCG8 introne, which is characterized in that including expanding 9 sequence of ABCG8 gene intron The primer of column, base sequence are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA。

Further, the primer for detecting 9 gene mutation of ABCG8 introne further includes sequencing primer, base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG.

The present invention also provides the methods of detection 9 gene mutation of ABCG8 introne, comprising the following steps:

(1) genomic DNA in blood is extracted；

(2) with the DNA extracted in PCR amplification step 1；Wherein expand the primer base sequence of 9 sequence of ABCG8 gene intron It is classified as:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA；

(3) amplified production in step 2 is sequenced；Sequencing primer base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG；

(4) sequencing result is judged, determines whether 9 gene of ABCG8 introne mutates.

The present invention also provides a kind of kits that detection ABCG8 gene intron 9 is mutated, including

(i) blood DNA extraction agent；

(ii) detection architecture pcr amplification reaction liquid；Expand the primer base sequences of 9 sequence of ABCG8 gene intron are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA；

(iii) system reagent is sequenced；Sequencing primer base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG.

In recent years pertinent literature reports related mutation caused by phytosterolemia patient, and the present invention is in ABCG8 gene Deletion mutation point: 35113delA is had found on introne 9.And the mutational site all exists in phytosterolemia patient, This is not reported in other documents.For the newfound catastrophe point of introne 9, the present invention devises the amplification gene regions ABCG8 The primer in domain.Using round pcr, stable amplification system is constructed.Item is reacted by adjusting primer concentration, annealing temperature etc. Part can make amplification efficiency reach best.The present invention, can be with using the method in sequencing technologies detection 9 region of ABCG8 gene intron Once the new mutation type detection of ABCG8 gene intron 9 is come out, the fluorescence quantitative PCR method that compares reduce detection at Sheet and difficulty.Fluorescence quantitative PCR method will design 2 probes for different mutation types, and cannot detect in same pipe, At high cost, detection difficulty is big.

Detailed description of the invention

Fig. 1 is that the sequencer map of deletion mutation (35113delA) occurs for the introne 9 of an example ABCG8 gene.Pass through Mutaion Surveyor analyses and comparison data obtain figure clinical analysis such as and report, can clearly show that the position of missing.

Specific embodiment

Embodiment 1

Extract the DNA:1 in blood) 300 μ l blood, 900 μ l erythrocyte cracked liquids of addition are extracted, it is mixed by inversion, room temperature is put It sets 5 minutes, is during which mixed by inversion again several times.12,000rpm centrifugation 1min, suck supernatant, leave leukocyte cell pellet, add 200 μ l Buffer GA, oscillation are mixed to thorough.2) 20 μ l Proteinase K Solutions are added, mix.3) 200 μ l buffer GB are added, sufficiently run It mixes, 70 DEG C are placed 10 minutes, and solution strain is limpid, and brief centrifugation is to remove the droplet of cap wall.4) be added 200 μ l without Water-ethanol, sufficiently oscillation mix 15 seconds, and at this time it is possible that flocculent deposit, brief centrifugation is to remove the droplet of cap wall. 5) previous step acquired solution and flocculent deposit are all added in an adsorption column CB3 (adsorption column is put into collecting pipe), 12, 000rpm is centrifuged 30 seconds, outwells waste liquid, adsorption column CB3 is put back in collecting pipe.6) 500 μ l buffering is added into adsorption column CB3 Liquid GD (please first checks whether before use and dehydrated alcohol has been added), and 12,000rpm centrifugations 30 seconds outwell waste liquid, by adsorption column CB3 It is put into collecting pipe.7) 700 μ l rinsing liquid PW are added into adsorption column CB3 (please first to check whether before use and anhydrous second has been added Alcohol), 12,000rpm centrifugations 30 seconds outwell waste liquid, adsorption column CB3 are put into collecting pipe.8) 500 are added into adsorption column CB3 Waste liquid is outwelled in μ l rinsing liquid PW, 12,000rpm centrifugations 30 seconds.9) adsorption column CB3 is put back in collecting pipe, 12,000rpm centrifugations 2 minutes, outwell waste liquid.Adsorption column CB3 is placed in and is placed at room temperature for several minutes, thoroughly to dry rinsing remaining in adsorbent material Liquid.10) adsorption column CB3 is transferred in a clean centrifuge tube, it is slow that 100 μ l elution is vacantly added dropwise to the intermediate position of adsorbed film Fliud flushing TE is placed at room temperature for 2-5 minutes, and solution is collected into centrifuge tube by 12,000rpm centrifugations 2 minutes.

Wherein, 10 × erythrocyte splitting formula of liquid are as follows: NH₄Cl 82g, NaHCO₃8.4g, EDTA-Na₂3.72g adding ddH₂O is settled to 1000ml.

Embodiment 2

PCR amplification:

PCR amplification system preparation of reagents method is as follows:

Reaction condition is as follows:

Wherein, primer sequence are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA。

Embodiment 3

PCR product purifying: enzyme purification presses following system configurations: CIP (NEB company) 0.1 μ l, Exo I (NEB company) 0.5 μ L, 1.4 μ l of deionized water；It is eventually adding 9 μ l PCR products.It is as follows that it purifies response procedures: 37 DEG C of 50min, 95 DEG C of 5min.

Embodiment 4

Sanger sequencing reaction: every 5 μ l:Bigdye of reaction system adds 1 μ l, 3.2P primer to add 1 μ l, and template after purification adds 2 μ l are eventually adding 1 μ l ddH₂O.The of short duration centrifugation of lid upper tube cap low speed, vortex mix, the of short duration centrifugation of low speed again.Upper PCR instrument Sequencing reaction is carried out, following condition: 95 DEG C of initial denaturation 4min is pressed in reaction；95 DEG C of denaturation 15s, 50 DEG C of annealing 20s, 60 DEG C extend 2min, 25 circulations.The Sanger sequencing primer includes:

M13-F:5 '-TGTAAAACGACGGCCAGT-3 '

M13-R:5 '-AACAGCTATGACCATG-3 '.

Embodiment 5

Sequencing product purification: the EDTA of 2 μ l 125mmol being added into the product for completing sequencing reaction, stands 5min；Add Enter 15 μ l dehydrated alcohols, whirlpool mixes；3700rpm is centrifuged 30min；It is inverted centrifugation 15sec, 50 μ l, 70% ethyl alcohol, whirlpool is added It mixes；3700rpm is centrifuged 15min；It is inverted centrifugation 15sec, is stored at room temperature 30min, sufficiently volatilization ethyl alcohol；10 μ l are added in every hole Hi-Di, sealing plate are placed on 95 DEG C of initial denaturation 5min in PCR instrument, are put into -20 DEG C of refrigerators cooling 5min rapidly；Upper sequenator is surveyed Sequence.

The sequencing result of measuring samples is compared with wild type standard sequence, is open country if consistent with standard sequence Raw type, inconsistent with standard sequence is then mutation.

Embodiment 6

10 whole blood samples to be checked by the extraction for carrying out DNA described in embodiment 1-5, PCR amplification is sequenced, obtains 35113delA deletion mutation result is as follows:

Sample number	35113delA
		1S0228	Lack A
1S0229	Without missing
		1S0230	Lack A
1S0231	Without missing
		1S0232	Without missing
1S0233	Without missing
		1S0234	Lack A
1S0235	Lack A
		1S0236	Without missing
1S0237	Lack A

As can be seen from the above table, the primer and system that the present invention designs can accurately find the 9th introne this lack Mutation is lost, which was not yet reported by domestic and foreign literature.Detection method can specify in high cholesterol through the invention Deletion mutation can occur for ABCG8 related gene in compatriots' body, provide foundation for the research of mechanism.

Sequence table

<110>Co., Ltd of Nanchang Ai Dikang clinical examination institute

<120>primer, method and kit that detection ABCG8 introne 9 is mutated

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 41

<212> DNA

<213>artificial sequence ()

<400> 1

tgtaaaacga cggccagtaa atgaggctta tggagactgt g 41

<210> 2

<211> 38

<212> DNA

<213>artificial sequence ()

<400> 2

aacagctatg accatggtag ctcgtgttct gctgtcaa 38

<210> 3

<211> 18

<212> DNA

<213>artificial sequence ()

<400> 3

tgtaaaacga cggccagt 18

<210> 4

<211> 16

<212> DNA

<213>artificial sequence ()

<400> 4

aacagctatg accatg 16

Claims (6)

1. detecting the primer of 9 gene mutation of ABCG8 introne, which is characterized in that including expanding 9 sequence of ABCG8 gene intron Primer, base sequence are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA。

2. primer as described in claim 1, which is characterized in that further include sequencing primer, base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG.

3. primer as claimed in claim 2, which is characterized in that 9 gene mutation of ABCG8 introne includes 35113delA Deletion mutation.

4. the kit that ABCG8 gene intron 9 is mutated is detected, including

(i) blood DNA extraction agent；

(ii) detection architecture pcr amplification reaction liquid；Expand the primer base sequences of 9 sequence of ABCG8 gene intron are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA；

(iii) system reagent is sequenced；Sequencing primer base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG.

5. the method for detecting 9 genetic profile of ABCG8 introne, comprising the following steps:

(1) genomic DNA in blood is extracted；

(2) with the DNA extracted in PCR amplification step 1；Wherein expand the primer base sequences of 9 sequence of ABCG8 gene intron Are as follows:

ABCG8-intron9-F:TGTAAAACGACGGCCAGTAAATGAGGCTTATGGAGACTGTG

ABCG8-intron9-R:AACAGCTATGACCATGGTAGCTCGTGTTCTGCTGTCAA；

(3) amplified production in step 2 is sequenced；Sequencing primer base sequence are as follows:

M13-F:TGTAAAACGACGGCCAGT

M13-R:AACAGCTATGACCATG；

(4) sequencing result is judged, determines whether 9 gene loci of ABCG8 introne mutates.

6. method as claimed in claim 5, which is characterized in that described to sport the generation of phytosterolemia ABCG8 introne 9 35113delA deletion mutation.