CN107904293A - Detect the primer and method of GNAS gene point mutations - Google Patents
Detect the primer and method of GNAS gene point mutations Download PDFInfo
- Publication number
- CN107904293A CN107904293A CN201711429137.9A CN201711429137A CN107904293A CN 107904293 A CN107904293 A CN 107904293A CN 201711429137 A CN201711429137 A CN 201711429137A CN 107904293 A CN107904293 A CN 107904293A
- Authority
- CN
- China
- Prior art keywords
- gnas
- primer
- exon
- mutation
- genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer and method of detection GNAS base mutations, including 5 exon hot spot mutation region of GNAS genes；Using Sanger sequencing technologies, available for quickly detecting the mutational site.The testing result completed using the present invention is accurate, can be with the catastrophe of auxiliary diagnosis hot spot region.5 exon 12384GCC of GNAS genes is found that first using primer of the present invention and method>GCT and 12450ATC>Whether the mutation of ATT, the discovery in the mutational site can cause relevant disease, and auxiliary examination to cause the cause of disease of disease easy to the gene mutation judged and analysis produces.
Description
Technical field
The invention belongs to life science and biological technical field, more particularly to detects the primer of GNAS gene point mutations, adopts
With regular-PCR technology, the catastrophe available for quick detection GNAS sites.
Background technology
GNAS genes are located at No. 20 chromosomes, are made of 13 extrons and 12 intrones, encode guanylic acid
The α subunits (Gs α) of associated proteins (G-protein).Gs α form heterotrimeric G protein compound with β and γ subunits, mediate from big
Signal transduction of the transmembrane receptor that amount hormone and growth factor activate to signal path in various kinds of cell.The G-protein of ligand binding
Coupled receptor activates Gs albumen by promoting GDP of the Gs on Gs α to exchange, so as to cause the solution with acceptor and β γ-compound
From.Free Gs α subunits are interacted with adenyl cyclase to stimulate the synthesis of cAMP, until the hydrolysis of GTP is converted
For sluggish GDP combining forms, it is recombined into new circulation with β γ-compound.Gene mutation is to amino acid encoding
Caused by influence may destroy inherence hydrolysing activity, cause cAMP largely to synthesize.Adrenal hyperplasia and ovarian cyst with
And thyroid cancer (5%), adrenal cortex, hypophysis (22-40%), in kidney (17%) and leydig cell tumours (67%)
The activated mutant of GNAS is determined.These organs have endocrine or exocrine function, show that the GNAS of mutation should be with secreting work(
Can be related.Generally speaking, the activated mutant of GNAS can be grown with modified cells and be probably carcinogenic, however, GNAS conducts
The effect of oncogene is still unclear, therefore diagnosis, discrimination and prevention of the GNAS detection in Gene Mutation for tumour just seem
It is most important.
The content of the invention
The object of the present invention is to provide a kind of primer of detection GNAS gene point mutations, using round pcr, available for fast
The catastrophe of speed detection GNAS gene locis.The primer of the detection GNAS gene point mutation situations, including：Expand GNAS
The primer of 5 exon of gene, its base sequence are：
GNAS-EXON-5-F：TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
GNAS-EXON-5-R：AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT.
Further, sequencing primer is further included, its base sequence is：
M13F：TGTAAAACGACGGCCAGT
M13R：AACAGCTATGACCATG.
The 5th exon that the primer is used to expand includes 12384GCC>GCT and 12450ATC>ATT mutantional hotspots.
The present invention provides the method for detection GNAS gene point mutation situations, comprise the following steps：
(1) genomic DNA in blood is extracted；
(2) with the DNA extracted in PCR amplification step 1；
(3) amplified production in step 2 is sequenced；
(4) sequencing result is judged, determines whether GNAS sites undergo mutation.
The method is used to detect whether the 5th exon occurs 12384GCC>GCT and 12450ATC>ATT is mutated.
Present invention also offers a kind of kit of detection GNAS gene point mutations, including
(i) blood DNA extraction agent；
(ii) detection architecture pcr amplification reaction liquid；
(iii) system reagent is sequenced；
In recent years pertinent literature also reports related mutation produced by patient, and this research is in 5 exon of GNAS genes
It is found that new catastrophe point, is respectively 12384GCC>GCT and 12450ATC>ATT.But GNAS's do not caused in the mutational site
Activated mutant, this is not reported in other documents.For the newfound catastrophe point of 5 exons, the present invention devises amplification
The primer of 5 exons in GNAS gene hots region.Using round pcr, stable amplification system is constructed.By adjusting drawing
The reaction conditions such as thing concentration, annealing temperature, can make amplification efficiency reach optimal.The present invention utilizes sequencing technologies detection GNAS genes
The method of mutantional hotspot, once can detect GNAS gene mutation types, the fluorescence quantitative PCR method that compares reduces inspection
The cost and difficulty of survey.Fluorescence quantitative PCR method will be directed to different mutation types and design 3 probes, and cannot be in same pipe
In detect, of high cost, detection difficulty is big.
Brief description of the drawings
Fig. 1 is the positioning figure of GNAS genes on chromosome.
Fig. 2 is electrophoresis sectional drawing of the GNAS genes 1 to 1~No. 15 sample of primer.
Fig. 3 is the sequencing sectional drawing of the negative sample of 5 exon of GNAS genes, 12384 bit base.
Fig. 4 is the sequencing sectional drawing of the positive sample of 5 exon of GNAS genes, 12384 bit base.
Fig. 5 is the sequencing sectional drawing of the negative sample of 5 exon of GNAS genes, 12450 bit base.
Fig. 6 is the sequencing sectional drawing of the positive sample of 5 exon of GNAS genes, 12450 bit base.
Embodiment
Embodiment 1
With reference to specific embodiments and the drawings, the present invention is further explained.It should be noted that do not specified in embodiment
Normal condition and method, usually routinely use method according to fields experimenter：For example, Ao Sibai and James Kingston chief editor
's《Fine works molecular biology experiment guide》Fourth edition, or according to the step and condition proposed by manufacturer.
A kind of primer of detection GNAS gene point mutations, the design of the primer are to be directed to 5 exon 12384GCC>
GCT and 12450ATC>ATT site mutation hot spots, including：
The primer of GNAS gene mutations hot spot region is expanded, its base sequence is：
GNAS-EXON-5-F：TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
GNAS-EXON-5-R：AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT
A kind of kit of detection GNAS gene point mutations, including
(i) blood DNA extraction agent；
(ii) detection architecture PCR reaction solution；
(iii) system reagent is sequenced；
(iv) positive reference substance and negative controls.
Wherein, blood DNA extraction agent is purchased from the commercial reagents such as Tiangeng DNA extraction agent boxes.
Detection architecture pcr amplification reaction liquid includes：2×PCR Buffer；2mM dNTPs；KOD FX DNA
Polymerase(1U/μl)；GNAS gene extrons upstream and downstream primer (10 μM).
Sequencing system reagent includes：Refined solution (ExoI is sequenced:0.6U, CIP:1.2U), EDTA (125mmol), anhydrous second
Alcohol, 75% ethanol, HIDI (height deionized formamide), sequencing primer：M13F and M13R (3.2 μm).
Embodiment 2
The operating process of poba gene group DNA extraction agents box (Tiangeng biology)：
(1) genomic DNA in blood is extracted
1) 300 μ l blood are extracted and adds 900 μ l erythrocyte cracked liquids, overturned and mix, room temperature is placed 5 minutes, is during which run again
Mix several times.12,000rpm centrifugation 1min, suck supernatant, leave leukocyte cell pellet, add 200 μ l buffer solution GA, vibrate to thorough
Bottom mixes.
2) 20 μ l Proteinase K Solutions are added, are mixed.
3) 200 μ l buffer solution GB are added, fully reverse to mix, 70 DEG C are placed 10 minutes, and solution strains limpid, brief centrifugation
To remove the droplet of cap wall.
4) 200 μ l absolute ethyl alcohols are added, fully vibration mixes 15 seconds, at this time it is possible that flocculent deposit, brief centrifugation
To remove the droplet of cap wall.
5) previous step resulting solution and flocculent deposit all add in an adsorption column CB3 to (adsorption column is put into collecting pipe
In), 12,000rpm centrifugations 30 seconds, outwell waste liquid, adsorption column CB3 are put back in collecting pipe.
6) 500 μ l buffer solutions GD (please first checked whether before use and added absolute ethyl alcohol) are added into adsorption column CB3,
12,000rpm centrifugations 30 seconds, outwell waste liquid, adsorption column CB3 are put into collecting pipe.
7) 700 μ l rinsing liquids PW (please first checked whether before use and added absolute ethyl alcohol) are added into adsorption column CB3,
12,000rpm centrifugations 30 seconds, outwell waste liquid, adsorption column CB3 are put into collecting pipe.
8) 500 μ l rinsing liquids PW are added into adsorption column CB3,12,000rpm centrifugations 30 seconds, outwell waste liquid.
9) adsorption column CB3 is put back in collecting pipe, 12,000rpm centrifugations 2 minutes, outwell waste liquid.Adsorption column CB3 is placed in
Room temperature is placed several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.
10) adsorption column CB3 is transferred in a clean centrifuge tube, 100 μ l is vacantly added dropwise to the middle part of adsorbed film
Elution buffer TE, room temperature are placed 2-5 minutes, and 12,000rpm centrifugations 2 minutes, solution is collected into centrifuge tube.
(2) reagent configures：By detection people's number configuration each X μ l of detection architecture PCR reaction solution, per 18 μ l of person-portion packing：
X=19 μ l reaction solutions × (+1 part of blank control of n parts of+1 part of sample+1 part of positive control negative controls)
N is detection number of samples.
(3) it is loaded：Add 1 μ l DNA in detection architecture PCR reaction solution；Positive control and negative control directly add 1 μ l sun
Property reference substance and negative controls；Blank control adds 1 μ l physiological saline or is not added with any material.
(4) expand：Detection carries out on Standard PCR instrument, can include ABI veriti (U.S. Applied with instrument
Biosystems companies) etc..Reaction condition is as follows：
PCR amplification system preparation of reagents method is as follows：
Wherein, primer sequence is：
GNAS-EXON-5-F：TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
GNAS-EXON-5-R：AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT (5) Sanger is sequenced：
Take 9 μ l PCR products and 2 μ l purification systems.Purified according to following procedure
1 μ l purified products are mixed with upper and lower sequencing primer according to following system respectively
Sequencing reaction program：
Precipitate link：
The EDTA of 2 μ l 125mmol is added into the product for completing sequencing reaction, stands 5min；Add the 15 anhydrous second of μ l
Alcohol, whirlpool mix；3700rpm centrifuges 30min；Centrifugation 15sec is inverted, adds 50ml70% ethanol, whirlpool mixes；3700rpm
Centrifuge 15min；Centrifugation 15sec is inverted, is placed on 95 DEG C of metal baths；Denaturation 5min is carried out after adding 10 μ l CBL, it is -20 DEG C last
The upper sequenators of 2min (ABI3730) are sequenced.
(7) result judges：Respectively by sequencing result and GNAS (Genbank accn：NC_000020.11) negative reference sequence
Row are compared, and result is reported according to actual catastrophe.
Embodiment 3
15 clinical samples are taken, by Examples 1 and 2 the method extraction genome, reagent preparation and are detected.Sample adds
1 μ l in detection architecture PCR reaction solution.Electrophoresis result is as shown in Fig. 2, show that primer pair blood sample of the present invention can effectively expand
Increase, and band is single.
The testing result of sample is as shown in Figure 3 and Figure 4.Fig. 3 and Fig. 4 is 5 exon of GNAS genes, 12384 bit base
Negative and positive sample sequencing sectional drawing.Fig. 5 and Fig. 6 is the feminine gender of 5 exon of GNAS genes, 12450 bit base and positive sample
This sequencing sectional drawing.
From testing result as can be seen that primer of the present invention is included hot spot region sequence, and can
Amplify 5 exon of GNAS genes, and sequencing result entirely accurate.Wherein there are Positive mutants on 5 exons, be respectively
12384GCC>GCT and 12450ATC>ATT, orresponding amino acid are A108 and I131.And the two point mutation are in known references
Do not report, by it is that multiple samples are sequenced the results show that this sport GNAS genes it is now discovered that new point mutation because
The result of point mutation is same sense mutation, so the coding of amino acid is not had an impact, but easy to judge and analyze what is produced
Whether gene mutation can cause relevant disease and auxiliary examination to cause the cause of disease of disease.
Sequence table
<110>Nanchang Ai Dikang Laboratory of medical test Co., Ltd
<120>Detect the primer and method of GNAS gene point mutations
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tgtaaaacga cggccagtgc agtgagaagg caaccaa 37
<210> 2
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
aacagctatg accatgggct gtcactcatg ttcctat 37
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tgtaaaacga cggccagt 18
<210> 4
<211> 16
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
aacagctatg accatg 16
Claims (6)
1. detect the primer of GNAS gene mutation situations, it is characterised in that including amplification the 5th exon sequence of GNAS genes
Primer, its base sequence are：
GNAS-EXON-5-F：TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
GNAS-EXON-5-R：AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT.
2. primer as claimed in claim 1, it is characterised in that further include sequencing primer, its base sequence is：
M13F：TGTAAAACGACGGCCAGT
M13R：AACAGCTATGACCATG.
3. primer as claimed in claim 2, it is characterised in that the 5th exon of the primer amplification includes 12384GCC>
GCT and 12450ATC>ATT mutantional hotspots.
4. detecting the method for GNAS gene point mutation situations, comprise the following steps：
(1) genomic DNA in blood is extracted；
(2) with the DNA extracted in PCR amplification step 1；
(3) amplified production in step 2 is sequenced；
(4) sequencing result is judged, determines whether GNAS gene locis undergo mutation；
PCR amplification primer in step 2 includes the primer of the 5th exon sequence of amplification GNAS genes, its base sequence is：
GNAS-EXON-5-F：TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
GNAS-EXON-5-R：AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT.
5. method as claimed in claim 4, it is characterised in that further include sequencing primer, its base sequence is：
M13F：TGTAAAACGACGGCCAGT
M13R：AACAGCTATGACCATG.
6. method as claimed in claim 4, it is characterised in that the method detects whether the 5th exon occurs
12384GCC>GCT and 12450ATC>ATT is mutated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429137.9A CN107904293A (en) | 2017-12-26 | 2017-12-26 | Detect the primer and method of GNAS gene point mutations |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429137.9A CN107904293A (en) | 2017-12-26 | 2017-12-26 | Detect the primer and method of GNAS gene point mutations |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107904293A true CN107904293A (en) | 2018-04-13 |
Family
ID=61871168
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711429137.9A Pending CN107904293A (en) | 2017-12-26 | 2017-12-26 | Detect the primer and method of GNAS gene point mutations |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107904293A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949953A (en) * | 2018-06-15 | 2018-12-07 | 南昌艾迪康临床检验所有限公司 | Detect primer, method and kit that ABCG8 introne 9 is mutated |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001007660A1 (en) * | 1999-07-23 | 2001-02-01 | The Regents Of The University Of California | Methods for detection of ataxia telangiectasia mutations |
| CN101824413A (en) * | 2009-03-04 | 2010-09-08 | 上海交通大学医学院附属第九人民医院 | GNAS mutant gene and application thereof |
| CN103555826A (en) * | 2013-09-27 | 2014-02-05 | 合肥艾迪康临床检验所有限公司 | Primer, method and kit for detecting mutation of MLH1 gene's 12th exon |
| WO2016190897A1 (en) * | 2015-05-27 | 2016-12-01 | Quest Diagnostics Investments Incorporated | Compositions and methods for screening solid tumors |
| CN106480046A (en) * | 2016-10-30 | 2017-03-08 | 浙江大学 | GNAS gene mutation body and its application |
-
2017
- 2017-12-26 CN CN201711429137.9A patent/CN107904293A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001007660A1 (en) * | 1999-07-23 | 2001-02-01 | The Regents Of The University Of California | Methods for detection of ataxia telangiectasia mutations |
| CN101824413A (en) * | 2009-03-04 | 2010-09-08 | 上海交通大学医学院附属第九人民医院 | GNAS mutant gene and application thereof |
| CN103555826A (en) * | 2013-09-27 | 2014-02-05 | 合肥艾迪康临床检验所有限公司 | Primer, method and kit for detecting mutation of MLH1 gene's 12th exon |
| WO2016190897A1 (en) * | 2015-05-27 | 2016-12-01 | Quest Diagnostics Investments Incorporated | Compositions and methods for screening solid tumors |
| CN106480046A (en) * | 2016-10-30 | 2017-03-08 | 浙江大学 | GNAS gene mutation body and its application |
Non-Patent Citations (7)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949953A (en) * | 2018-06-15 | 2018-12-07 | 南昌艾迪康临床检验所有限公司 | Detect primer, method and kit that ABCG8 introne 9 is mutated |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107190064B (en) | SnaPshot kit for detecting polymorphism of 22-site deafness genes | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN112538528A (en) | Primer group and kit for detecting ALDH2 gene polymorphism | |
| CN109593841A (en) | Detect method, kit, oligonucleotides and its application of F13A1 gene mutation | |
| CN109486938A (en) | Detect method, primer and the application of SMN1 and SMN2 gene mutation | |
| CN106987642A (en) | Detect the kit and method of the full extron of MPL genes | |
| CN103555826A (en) | Primer, method and kit for detecting mutation of MLH1 gene's 12th exon | |
| CN104862407A (en) | Primer and method for detecting EZH2 genes | |
| CN110358820A (en) | Detect method, primer and the kit of LDLR gene mutation | |
| CN110358821A (en) | Detect primer, kit and the method for glucose 6 phosphate dehydrogenase deficiency G6PD gene mutation | |
| CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN106399567A (en) | Primer for detecting WRAP53 gene mutation and application of primer | |
| CN109321638A (en) | Detect primer, method and the kit of the 15th exon site mutation of TSC1 | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN108531574A (en) | It detects alcohol dehydrogenase ADH1B and ethyl alcohol takes off the primer and method of acetaldehyde dehydrogenase ALDH2 gene pleiomorphisms | |
| CN107904293A (en) | Detect the primer and method of GNAS gene point mutations | |
| CN109628576A (en) | Detect the primer and method of FGD1 gene mutation | |
| CN103131776A (en) | A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C | |
| CN104498592A (en) | Human CYP3A5 gene detection kit and detection method thereof | |
| CN109628563A (en) | Detect primer, kit and the method in the mutational site PIGA gene promoter region 4972A > G | |
| CN110564826A (en) | Primer, method and kit for detecting AVPR 2gene mutation of congenital renal diabetes insipidus | |
| CN105442053A (en) | DNA library for detecting and diagnosing pathogenic genes of ion channel disease and application thereof | |
| CN110656171A (en) | Application of small nucleolus ribonucleic acid SNORD33 as biomarker for preparing detection kit | |
| CN107058531A (en) | A kind of kit and method for detecting Niemann-Pick disease SMPD1 gene mutations | |
| CN109777868A (en) | A kind of primer and method detecting 2 gene mutation of JAK3 gene intron |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180413 |
|
| RJ01 | Rejection of invention patent application after publication |