CN109234396B - A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application - Google Patents
A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application Download PDFInfo
- Publication number
- CN109234396B CN109234396B CN201811177700.2A CN201811177700A CN109234396B CN 109234396 B CN109234396 B CN 109234396B CN 201811177700 A CN201811177700 A CN 201811177700A CN 109234396 B CN109234396 B CN 109234396B
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- brca2
- gene
- site
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application, belong to field of pharmaceutical biology.It goes out the primer sequence that can be expanded to the region comprising the target site with mutant gene sequence by PCR- specific primer Technology design, by gene amplification method to the regioselectivity of the target site comprising mutated gene specifically for the BRCA2 gene of specificity g.32336534T > mutational site C carries out PCR amplification detection.The present invention provides the new mutational sites that breast cancer is caused a disease, and can be used for early diagnosing breast cancer.
Description
Technical field
The present invention relates to field of pharmaceutical biology more particularly to a kind of sites breast cancer susceptibility gene BRCA2
G.32336534T > C mutant and its application.
Background technique
The morbidity and mortality of China's cancer are constantly soaring in recent years, and malignant tumour has become great public in China and defends
Raw problem.According to the publication in 2016 of tumour Register, China the results show that China's tumour neopathy number of cases 358.6 in 2012
Ten thousand, dead number of cases 218.7 ten thousand, thick disease incidence 2,65/,100,000, the death rate 161.5/10 ten thousand.In Incidence status
In, breast cancer is in first in female malignant, every year new hair about 27.3 ten thousand, and rejuvenation is constantly presented in age of onset
Trend is the first killer for seriously threatening women life.
Breast cancer is the malignant tumour with very strong genetic background, and the existing breast cancer researches show that 5-10% is by heredity
Factor causes.The genes such as BRCA1, BRCA2, TP53, PALB2, PTEN, CHEK2, ATM and RAD0 are identified as mammary gland at present
Cancer susceptibility gene, wherein BRCA and BRCA2 gene is the major susceptibility gene of hereditary breast cancer.Studies have shown that carrying
The probability of breast cancer occurs before 70 years old for the crowd of BCA1 and BRCA2 gene pathogenic mutation respectively up to 40-80% and 20-
85%, meanwhile, it is diagnosed as the patient of hereditary breast cancer, it is also a high possibility of generation relapse and metastasis in general population.
BRCA1 and BRCA2 belongs to tumor suppressor gene, is in autosomal dominant inheritance, and is mutated to be easy to cause and fall ill in one's early years.
BRCA2 gene is located at human chromosomal 13q12, includes 27 exons, coding BRCA2 albumen contains 3418 amino acid, to thin
The adjusting of intracellular growth plays an important role.The protein that BRCA2 gene is expressed after mutating loses the function of DNA plerosis damage
Can, cause chromosome instability fixed, promotes tumour.Male's BRCA2 carriers of mutation suffers from prostate cancer, breast cancer, pancreas throughout one's life
The probability of gland cancer is respectively 20%, 6% and 3%, and women BRCA2 carriers of mutation is suffered from breast cancer throughout one's life as 26%-84%, ovum
The probability of nest cancer is 20%.The relevant tumour of BRCA2 gene mutation often express ER (estrogen receptor) and PR (progestational hormone by
Body), similar feature is shown with sporadic breast cancer.It is existing it has been reported that BRCA2 mutation be mainly frameshift mutation, can also send out
Raw a large amount of missense mutation, but missense mutation belongs to the unknown variation of meaning mostly, consequently found that BRCA2 new pathogenic mutation, right
The molecular diagnosis for carrying out hereditary breast cancer is of great significance.
Summary of the invention
Goal of the invention: in order to overcome the deficiencies in the prior art, the present invention provides a kind of breast cancer susceptibility gene
The site BRCA2 g.32336534T > C mutant, the specific primer for detecting the mutant, the diagnosis comprising the specific primer
Kit and application of the mutant in Computer-aided Diagnosis of Breast Cancer, with for breast cancer screening and diagnosis support is provided.
Technical solution: to achieve the above object, the site a kind of breast cancer susceptibility gene BRCA2 of the invention
G.32336534T > C mutant, wild type BRCA2 gene DNA sequence is as shown in SEQ ID NO:1, mutant BRCA2 base
Because DNA sequence dna is as shown in SEQ ID NO:2.
Further, for detect the site a kind of breast cancer susceptibility gene BRCA2 g.32336534T > C mutant
Specific primer upstream primer sequence as shown in SEQ ID NO:3, downstream primer sequence is as shown in SEQ ID NO:4.
Further, a kind of Computer-aided Diagnosis of Breast Cancer kit, including it is as claimed in claim 2 easy for detecting breast cancer
Feel the site gene BRCA2 g.32336534T > specific primer of C mutant.
A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > application of C mutant, it is characterised in that: utilize
Peripheral blood passes through a kind of Computer-aided Diagnosis of Breast Cancer kit detection site breast cancer susceptibility gene BRCA2 as claimed in claim 3
G.32336534T > C mutation, then auxiliary judgment breast cancer is composed by mutational site；
A kind of Computer-aided Diagnosis of Breast Cancer kit detection site breast cancer susceptibility gene BRCA2 g.32336534T > C
Specific step is as follows for mutation,
(1) Whole Blood Genomic DNA is extracted；
(2) using the site breast cancer susceptibility gene BRCA2 as claimed in claim 2 g.32336534T > spy of C mutant
Specific primer, and obtain pcr amplification product；
(3) detection BRCA2 gene whether there is g.32336534T > C mutated gene.
Further, the detection BRCA2 gene whether there is g.32336534T > C mutated gene specific steps such as
Under,
(1) pcr amplification product is subjected to electrophoresis using Ago-Gel；
(2) amplified production after electrophoresis is subjected to purification and recovery, to facilitate sequencing；
(3) amplified production after purification is sequenced in DNA sequencer, sequencing result and wild type BRCA2 is joined
Sequence NCBI Reference Sequence:NC_000013.11 is examined to be compared.
Further, the total volume of pcr amplification reaction be 50 μ L, the 10 μ L containing PCR5 × buffer, 5.0 μ L of DNA profiling,
Taq polymerase 1.0 μ L, MgCl2Final concentration 2.0mmol/L, dNTP final concentration 200nmol/L, and the upstream primer of specificity
With downstream primer final concentration 200nmol/L, and add disinfection distilled water to 50 μ L of total volume；Reaction condition is that 95 DEG C of initial denaturations 5 are divided
Clock, then successively 95 DEG C be denaturalized 30 seconds, then 62 DEG C anneal 30 seconds, 72 DEG C extend 30 seconds, totally 35 circulation.
The utility model has the advantages that beneficial effects of the present invention are as described below: a kind of Computer-aided Diagnosis of Breast Cancer kit only needs periphery
Blood detects mutational site with special primer pair without other tissue samples, by most simplifying, then is composed by mutational site
Auxiliary judgment breast cancer, it is not only stable, easy to detect and accurate, the sensibility and specificity of medical diagnosis on disease is greatly improved, therefore
This kit is put into and is practiced, can help to instruct diagnosis and more effective individualized treatment；Present invention obtains breast cancer hairs
Sick relevant mutational site spectrum and Specific marker.A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutation
The application of body may make the diagnosis of breast cancer more convenient and easy, quick and precisely grasp conditions of patients for clinician, for clinic
Treatment effectiveness evaluation lays the foundation, and provides help to be found to have the new small molecule drug targets of potential treatment value.
Detailed description of the invention
Attached drawing 1 be BRCA2 gene g.32336534T > C mutated gene detect gel electrophoresis figure；
Attached drawing 2 be BRCA2 gene g.32336534T > C mutated gene sequencer map.
Specific embodiment
The present invention will be further explained with reference to the accompanying drawing.
A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant, wild type BRCA2 gene DNA
Sequence is as shown in SEQ ID NO:1, and mutant BRCA2 gene DNA sequence is as shown in SEQ ID NO:2.
The BRCA2 gene g.32336534T > C site mutation refers to mutational site the of SEQ ID NO:1 sequence
165 bit base T sport C.
The present embodiment is using PCR amplification and Sanger sequencing technologies in 62 Chinese Han nationality female with family history of breast cancer
Property patient with breast cancer in, it has been found that with the presence of No. 13 chromosome of 1 patient BRCA2 genome 32336534 positions send out
The mutation of raw base T to C base, number of the gene in NCBl reference database GRCh38.p12 is NC_000013.11
(32315480-32399672).It then carries out verifying without family history breast cancer sample, at 1900 without Han nationality, family history China cream
In gland cancer Female breast cancer patients, there are 3 patients to carry the mutation；At 1900 without Family history of cancer, age-matched is just
In normal female control crowd, mutated individual is not found.To further increase the reliability that the mutation causes breast cancer, we are established
It is examined within women 3000 (- 65 years old 35 years old) in normal population queue (excluding any tumor patient, exclude family history of breast cancer patient)
The mutation is surveyed, discovery mutation is 1 positive (being 43 years old when baseline), 5 new breast cancer patients are found through follow-up study, wherein
Include the mutation positive.The mutational site is that this research is found in Chinese Han women patient with breast cancer for the first time, and just
The mutation is not present in ordinary person group, by being included in prospective cohort study, it was demonstrated that the patient for carrying the mutation is eventually developed to
Breast cancer, it was demonstrated that the site is the pathogenic factor of breast cancer.
Mutational site relevant to Computer-aided Diagnosis of Breast Cancer is g.32336534T > C, which betides No. 13 dyeing
32336534 positions of body, number of the gene in NCBl reference database GRCh38.p12 is NC_000013.11
(32315480-32399672), be listed in the database here include the site wild type number of base sequence for ginseng
It examines, as shown in SEQ ID NO:1；The corresponding sequence of BRCA2 gene mutation is as shown in SEQ ID NO:2；Wherein mutational site
The 165th in SEQ ID NO:1 sequence sports C by base T.
Wherein,
SEQ ID NO:1
GAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAG AAGCAAAATGTAA
TAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCT CTGTCATGCCTGCAGGAAGGACAGTGTGAAAA
TGATCCAAAAAGCAAAAAAGTT TCAGATATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTC
AA AAGTGGAATAC
SEQ ID NO:2
GAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAG AAGCAAAATGTAA
TAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCT CTGTCATGCCTGCAGGAAGGACAGTGTGAAAA
TGATCCAAAAAGCAAAAAAGTT CCAGATATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTC
AA AAGTGGAATAC
For detect the site a kind of breast cancer susceptibility gene BRCA2 g.32336534T > specificity of C mutant
The upstream primer sequence of primer is as shown in SEQ ID NO:3, and downstream primer sequence is as shown in SEQ ID NO:4.
A kind of Computer-aided Diagnosis of Breast Cancer kit, including it is as claimed in claim 2 for detecting breast cancer susceptibility gene
The site BRCA2 g.32336534T > specific primer of C mutant.
A kind of production of Computer-aided Diagnosis of Breast Cancer kit and operating process are based on PCR amplification and Sanger sequencing scanning
Detection technique.Kit contains a collection of specific primer on the mutated site (including following primer: g.32336534T > mutational site C
Primer sequence be SEQ ID NO:3 and SEQ ID NO:4), which can also include that PCR reacts common reagent, such as
Taq enzyme, dNTP mixed liquor, MgCl2 solution, deionized water etc.；These common agents be all it is well known to those skilled in the art, separately
Standard items and/or reference substance (such as determining standard items and the blank control of genotype) can also be contained outside.The valence of this kit
Value is only to need peripheral blood without other tissue samples, detects mutational site with special primer pair by most simplifying,
Auxiliary judgment breast cancer is composed by mutational site again, it is not only stable, easy to detect and accurate, greatly improve the quick of medical diagnosis on disease
Perception and specificity, therefore this kit is put into and is practiced, it can help to instruct diagnosis and more effective individualized treatment.
A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > application of C mutant, pass through power using peripheral blood
Benefit require 3 described in a kind of Computer-aided Diagnosis of Breast Cancer kit detection site breast cancer susceptibility gene BRCA2 g.32336534T >
C mutation, then auxiliary judgment breast cancer is composed by mutational site；
A kind of Computer-aided Diagnosis of Breast Cancer kit detection site breast cancer susceptibility gene BRCA2 g.32336534T > C
Specific step is as follows for mutation,
(1) Whole Blood Genomic DNA is extracted；
(2) using the site breast cancer susceptibility gene BRCA2 as claimed in claim 2 g.32336534T > spy of C mutant
Specific primer, and obtain pcr amplification product；
(3) detection BRCA2 gene whether there is g.32336534T > C mutated gene.
That specific step is as follows is described for the extraction whole blood DNA,
(1) sterile 2.0mL centrifuge tube one is taken, 1mL cell pyrolysis liquid is added；
(2) whole blood sample so anticoagulant through EDTA is gently shaken, until thoroughly mixing；Then the addition of 500 μ L sample of blood is drawn
In the above-mentioned centrifuge tube containing cell pyrolysis liquid, centrifuge tube 5-6 times mixing is gently toppled over；
(3) it is incubated at room temperature 10 minutes (period overturns 2-3 mixing of centrifuge tube)；
(4) 12000rpm room temperature is centrifuged 5 minutes；
(5) slowly supernatant is moved as far as possible with pipettor and is abandoned completely, paid attention to the whiteness of two-phase intersection not
It is sucked out；
(6) it is acutely mixed using turbula shaker (Votex), until (10-15 seconds) are resuspended in leucocyte；
(7) 300 μ L of karyorhexis liquid is added into resuspension cell solution.It is white thin that solution 5-6 times cracking is put with liquid transfer gun head suction
Born of the same parents.Solution should become very sticky at this time.If visible cell agglomerate after mixing, solution is placed in 37 DEG C and is incubated for until agglomerate disappears
It dissipates.If still visible cell agglomerate after being incubated for 1 hour, separately plus 100 μ L of karyorhexis liquid lays equal stress on resets and be incubated in 37 DEG C；
(8) 100 μ L of albumen precipitation liquid is added into karyorhexis object, is acutely shaken with turbula shaker 10-20 seconds；
(9) 12000rpm room temperature is centrifuged 5 minutes；
(10) its supernatant is gone into being added in the 2.0mL centrifuge tube of 300 μ L room temperature isopropanols of reference numeral；
(11) it gently overturns to mix solution, until white linear DNA forms precipitating；
(12) 12000rpm room temperature is centrifuged 1 minute；
(13) liquid, addition and isometric 70% ethyl alcohol of room temperature of sample size are discarded supernatant, gently overturns centrifuge tube for several times；
(14) slowly ethanol is moved as far as possible with pipettor and is abandoned completely.Centrifuge tube is placed in 50 DEG C of baking 5-10 points
Clock allows remaining ethanol volatilization clean as far as possible；
(15) the DNA lysate of 50-100 μ L is added into centrifuge tube, mixes gently；
(16) DNA extraction effect is assessed with 1% agarose gel electrophoresis, Nanodrop nucleic acid instrument detection level is quantitative
To 20-50ng/ μ L, -20 DEG C of preservations.
The detection BRCA2 gene with the presence or absence of g.32336534T > specific step is as follows for C mutated gene,
Instrument: 96 type PCR instrument of Veriti, BIO-RAD Gel Doc XR+ type gel imager (Bio Rad Laboratories),
Gel-electrophoretic apparatus (6 1 company of Beijing).
Reagent: QIAamp DNA extraction kit (German Qiagen company)；DNA Isolation Kit extracts kit
(Beijing PELFREEZ company)；PCR buffer, dNTP, Taq enzyme (American AB I company)；Primer is by the limited public affairs of the raw work biology in Shanghai
Department's synthesis.
(1) design of primers: the BRCA2 gene (sequence number: NC_ recorded according to American National Bioinformatics Institute (NCBI)
000013.11), by 6.0 primer software Design primers of Oligo, finally determine that 1 pair of specific oligonucleotide primer sequence is
F:5 '-CCAAAAAGCAAAAAAGTTC-3 ' (SEQ ID NO:3) and R:5 '-TTGCCTCTAGAAATCATGACTA-3 ' expands
Increasing product sheet segment length is 206bp；
(2) total volume: 50 μ L, the 10 μ L containing 5 × buffer of PCR, 5.0 μ L, Taq polymerase (1U/ μ L) of DNA profiling is reacted
1.0 μ L, MgCl2 final concentration 2.0mmol/L, dNTP final concentration 200nmol/L, and the upper and lower primer final concentration of specificity
200nmol/L, and add disinfection distilled water to 50 μ L of total volume；
Reaction condition: 95 DEG C initial denaturation 5 minutes, then successively 95 DEG C be denaturalized 30 seconds, then 62 DEG C anneal 30 seconds, 72 DEG C
Extend 30 second minute, totally 35 circulations；
(3) BRCA2 gene g.32336534T > detection of C mutated gene: with 1.5% Ago-Gel to by step (2) institute
Increasing expand production object carry out electrophoresis, to detect whether it has purpose segment.Result is observed by gel imager and is taken pictures, PCR
Product is shown as single band after electrophoresis, and no miscellaneous band then prompts PCR product single, no non-specific amplification.If pillar location position
It is then purpose segment in appropriately sized position.As shown in Figure 1, M:2000DNA Marker, 1: blank control, 2: wild type
Control, 3:BRCA2 gene g.32336534T > C sudden change sample；
(4) amplified production purifies: this research uses the Agarose Gel DNA Purification of Takara company
PCR product after agarose gel electrophoresis is carried out purification and recovery by Kit kit, prepares sequencing；
(5) Sanger sequencing and result judgement: PCR product carries out in the full-automatic DNA sequencer of ABI3730 type after purification
Sequencing.By sequencing result and BRCA2 wild-type reference sequence (NCBI Reference Sequence:NC_000013.11) into
Row compares, and is reported according to practical catastrophe result.Detection gained gene mutation sequencer map is as shown in Fig. 2, arrow in figure
Head show BRCA2 gene and shows g.32336534T > C site mutation.
Relevant mutational site Oligonucleolide primers sequence is as shown in table 1
Table 1
Wherein, F=upstream primer sequence；R=downstream primer sequence
The above is only a preferred embodiment of the present invention, it should be pointed out that: for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Claims (3)
1. a kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant, it is characterised in that: its wild type BRCA2
Gene DNA sequence is as shown in SEQ ID NO:1, and mutant BRCA2 gene DNA sequence is as shown in SEQ ID NO:2.
2. it is a kind of for detect the site a kind of breast cancer susceptibility gene BRCA2 described in claim 1 g.32336534T > C mutation
The specific primer of body, it is characterised in that: the upstream primer sequence of the specific primer is as shown in SEQ ID NO:3, downstream
Primer sequence is as shown in SEQ ID NO:4.
3. a kind of Computer-aided Diagnosis of Breast Cancer kit, it is characterised in that: including as claimed in claim 2 easy for detecting breast cancer
Feel the site gene BRCA2 g.32336534T > specific primer of C mutant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811177700.2A CN109234396B (en) | 2018-10-10 | 2018-10-10 | A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811177700.2A CN109234396B (en) | 2018-10-10 | 2018-10-10 | A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109234396A CN109234396A (en) | 2019-01-18 |
| CN109234396B true CN109234396B (en) | 2019-07-16 |
Family
ID=65054427
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811177700.2A Active CN109234396B (en) | 2018-10-10 | 2018-10-10 | A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109234396B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055258B (en) * | 2019-04-24 | 2020-04-03 | 无锡市第五人民医院 | Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof |
| CN111304332B (en) * | 2020-03-10 | 2020-12-25 | 无锡市第五人民医院 | Detection of breast cancer related gene BRCA2 site g.32336265G & gtT mutant |
| CN112941186B (en) * | 2021-04-02 | 2023-06-23 | 无锡市第五人民医院 | Breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966310A (en) * | 2014-01-27 | 2014-08-06 | 广州市体育科学研究所 | Rapid detection kit and detection method for breast cancer susceptibility genes |
| CN106676169B (en) * | 2016-11-15 | 2021-01-12 | 上海派森诺医学检验所有限公司 | Hybridization capture kit for detecting breast cancer susceptibility genes BRCA1 and BRCA2 mutation and method thereof |
-
2018
- 2018-10-10 CN CN201811177700.2A patent/CN109234396B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109234396A (en) | 2019-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102622305B1 (en) | Detection method using chromosomal interaction sites | |
| US6849403B1 (en) | Apparatus and method for drug screening | |
| CN109234396B (en) | A kind of site breast cancer susceptibility gene BRCA2 g.32336534T > C mutant and its application | |
| WO2023142619A1 (en) | Marker for dilated cardiomyopathy genetic detection and use thereof | |
| CN109913482A (en) | PIK3CA-I874R mutated gene and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN102776286A (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN109234282B (en) | BRCA1 gene g.43063754T > G mutant and its primer | |
| CN111304332B (en) | Detection of breast cancer related gene BRCA2 site g.32336265G & gtT mutant | |
| CN107312865B (en) | Purposes of the LOC100130111 in preparation osteosarcoma diagnostic products, therapeutic agent | |
| CN109457031A (en) | BRCA2 gene g.32338309A > G mutant and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN110029167A (en) | ERBB2-G519V mutated gene and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN107557468B (en) | Cancer-testis gene genetic marker related to auxiliary diagnosis of primary lung cancer and application thereof | |
| WO2001042503A2 (en) | Apparatus and methods for drug screening based on nucleic acid analysis | |
| CN109913481A (en) | PIK3CA gene g.1792224821G > A mutation and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN111154883B (en) | Breast cancer related gene PIK3CA site g.179220986A & gtT mutant and application thereof | |
| CN104962613B (en) | A kind of mutated gene and its application for Computer-aided Diagnosis of Breast Cancer | |
| CN110055258A (en) | A kind of site breast cancer related gene ERBB2 g.39717320G > A mutant and its application | |
| CN107312828A (en) | The mononucleotide polymorphism site related from different tumor growth rate liver cancer and its application | |
| CN107043770A (en) | The related PBLC miRNA of one group of tuberculosis and its application | |
| CN107365859B (en) | Molecular markers of the LncRNA as diagnosis and treatment osteosarcoma | |
| CN110004227A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| CN109609616B (en) | Application of HLA-A02: 01 and HLA-C01: 02 in drug eruption caused by tanshinone | |
| CN112941186B (en) | Breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof | |
| CN111518894B (en) | Reagent for detecting rs9273471 locus polymorphism and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |