CN116287423A - SNP molecular marker related to corn kernel oil content and application thereof - Google Patents
SNP molecular marker related to corn kernel oil content and application thereof Download PDFInfo
- Publication number
- CN116287423A CN116287423A CN202310553132.6A CN202310553132A CN116287423A CN 116287423 A CN116287423 A CN 116287423A CN 202310553132 A CN202310553132 A CN 202310553132A CN 116287423 A CN116287423 A CN 116287423A
- Authority
- CN
- China
- Prior art keywords
- oil content
- corn
- molecular marker
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The invention relates to the technical field of plant molecular markers, in particular to an SNP molecular marker related to corn kernel oil content and application thereof. The nucleotide sequence of the SNP molecular marker related to the oil content of corn kernels is shown as SEQ ID NO.1, the polymorphic site is positioned at 150 th site of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T. The molecular marker and the corn kernel oil content QTLqOC‑1‑3Tight linkage, can accurately track and identify oil content QTL in different genetic backgroundsqOC‑1‑3Carrying QTLqOC‑1‑3The oil content of the corn strain is obviously higher than that of the corn strain without carrying QTLqOC‑1‑3The corn strain of the (2) can realize the identification of the oil content of corn kernels by using the molecular marker ZMOC8, and has high identification efficiency and high success rate.
Description
Technical Field
The invention relates to the technical field of plant molecular markers, in particular to an SNP molecular marker related to corn kernel oil content and application thereof.
Background
Corn is one of the three major crops in the world. Corn kernels accumulate a large amount of stored materials including starch, oil and protein. The corn oil is rich in unsaturated fatty acid, lysine and other amino acids, and has relatively high content of fat-soluble vitamin A and vitamin E, so that the corn oil is healthy edible oil.
Along with the continuous improvement of the living standard of people, the demands of people for vegetable edible oil are increasing. The corn is used as the first large grain crop in China, has the characteristics of wide adaptability and high yield, and has great potential for grease excavation. Therefore, on the premise of considering important agronomic characters such as yield, stress resistance and the like, improving the oil content of corn kernels becomes one of important directions of corn breeding, and the excavation and application of genes, quantitative trait loci (Quantitative Trait Locus, QTL) and molecular markers related to controlling the oil content of the corn kernels have important significance and application prospect for cultivating high-oil special-purpose corn.
The corn oil property is a complex quantitative property, is controlled by micro-effect polygene and has high generalized genetic transmission. Linkage analysis is one of the classical research methods for analyzing the genetic basis of complex traits. Previous studies mostly constructed population F 2 Populations or derived F 2:3 Population, RIL population, etc. The former is simple to construct, can be completed without a long time, belongs to a temporary positioning group, can be used once, and is F 2 The genotypes of the individual plants in the population are different, the quantitative character reliability is poor, and F is needed 2:3 Or other individual derived families. The latter is to F 2 Different individuals of the population are continuously selfed or copulated to lead the genotypes of the individuals in the family to be towards homozygosity. The RIL population is constructed by selfing the separated offspring for 6-7 generations at least, the construction time is long, and the workload is high. By F compared to RIL population 1 The genes in the lines of Double Haploid (DH) groups formed by doubling after Haploid induction are completely pure, the construction time is short, and the method is one of ideal groups for quantitative trait positioning analysis and new gene new marker mining, so that the DH groups are more and more widely applied to quantitative trait positioning. In addition, genetic studies on the oil content of corn kernels are limited at present, and new genes, QTL and molecular markers still remain to be discovered. In order to meet the great demands of people on vegetable oil, the improvement of the oil content in the seeds is a main goal in the world agricultural field. In order to increase the oil content of the kernels, an effective corn breeding method is required, so that the genetic mechanism of the character needs to be known, more new sites are further excavated, and molecular markers of the new sites are developed, so that the breeding efficiency of high-oil corn can be improved.
Disclosure of Invention
One of the purposes of the invention is to provide a corn kernel oil content QTLqOC-1-3。
Another object of the present invention is to provide SNP molecular markers related to the oil content of corn kernels and uses thereof.
The invention utilizes the oil content to haveTwo maize inbred lines K71701 and K51909, which are significantly different, are used as parents to construct a double-monomer (DH) linkage segregating population comprising 123 lines. Genotyping the two parents and 123 DH lines using a GenoBaits Maize 1K liquid phase chip; genetic linkage maps were constructed using the functions est.rf and est.map through the R/qtl software package. Measuring the oil content of seeds by a near infrared method, carrying out QTL positioning analysis on the oil content of seeds by a composite interval mapping model (Composite Interval Mapping) of Windows QTL Cartographer 2.5 in combination with a genetic map, positioning a main effect QTL capable of explaining the variation degree of 30.8% on chromosome 9, and naming the main effect QTL as the QTLqOC-1-3. Further, a closely linked SNP (Single Nucleotide Polymorphism, SNP) marker is developed aiming at the QTL, and a detection primer of the SNP molecular marker is developed by combining with a KASP technology, so that the locus can improve the kernel oil content in other corn inbred lines by verification, and an important basis is provided for the auxiliary selection of the molecular marker of high-oil corn and cloning of related genes of the kernel oil content of corn.
Specifically, the invention provides the following technical scheme:
in a first aspect, the invention provides an SNP molecular marker related to the oil content of corn kernels, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is positioned at 150 th position of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T.
The polymorphic site of the SNP molecular marker described above is located at position 125242833 of chromosome 9 of the B73 RefGen_v4 reference genome.
The SNP molecular marker and the corn kernel oil content QTLqOC-1-3The close linkage has obvious correlation with the oil content of the corn seeds, and can accurately track the QTL of the oil content of the corn seeds under different genetic backgroundsqOC-1-3The corn kernel oil content characteristic is predicted, and the method can be used for identifying corn with high kernel oil content and corn with low kernel oil content, and improving the efficiency of molecular design breeding.
Corn kernel oil content related QTLqOC-1-3From parent K71701, which is capable of interpreting 30.8% of the phenotypic variation, positionBetween 113850895-143024206 bp on chromosome 9 of the B73 refgen_v4 reference genome.
The invention is on QTLqOC-1-3The nucleotide sequences of the closely linked SNP markers ZMOC8 and ZMOC8 markers of front 149 bp and rear 150 bp and 300 bp are shown in SEQ ID NO.1, wherein Y is a SNP variation site, Y=C or T, C is the genotype of the parent K51909, and T is the genotype of the parent K71701.
SEQ ID NO.1：
CTTCTACAGCATGACGCTGACATTGTTTTCAACTGAAATGTTCCAGAGAAGCGACGGAGGCGGGGCCTTCCAGGCCACGGACTTGCTCAATGGTAGACTGTTATGCGGGTGCCAGGACATCAGGGCATGCTCGGTGAGACAAGATCTGTYTTCTCCGCTTGTGGTGATATACTAATTAACCGCTATATGAATTCACCCCCTTTATTGTTTTGTCCATTTGCAGCAAGGTTCCGGTGTAGTATGTTCTGCATAAGTCCATAACAAATAGAGATCAATTTGATTGGAGTGGCGAAAGAAGAC。
Specifically, the SNP molecular marker is obtained by taking a corn genome as a template and amplifying a primer with a sequence shown as SEQ ID NO. 2-4.
The genotype of the polymorphic site of the SNP molecular marker is CC, which corresponds to low grain oil content, and the genotype is TT, which corresponds to Gao Zi grain oil content.
In a second aspect, the invention provides a set of primer pairs for detecting the oil content of corn kernels, wherein the primer pairs are used for detecting the SNP molecular markers.
Based on the location of the genome of the SNP molecular marker provided above and the sequence upstream and downstream thereof, one skilled in the art can develop various types of primers for amplifying the SNP molecular marker.
The above primer may be any type of primer that can be used to detect the genotype of a SNP molecular marker.
KASP is a genotyping technology for identifying Single Nucleotide Polymorphism (SNP) and Insertion-Deletion (InDel) by using competitive allele-specific PCR technology (Kompetitive Allele Specific PCR, KASP) and combining fluorescent markers, and is widely applied to molecular marker-assisted selection of crops such as corn, rice, wheat, soybean and the like by accurately performing double allele typing on SNP and InDel sites through specific matching of primer terminal bases.
The invention develops a KASP amplification primer pair aiming at the SNP molecular marker.
Preferably, the primer pair comprises primers with sequences shown as SEQ ID NO.2-4, wherein SEQ ID NO.2-3 is an upstream primer and SEQ ID NO.4 is a reverse universal primer.
SEQ ID NO.2（ZMOC8-FAM-C）：
5’-GAAGGTGACCAAGTTCATGCTATGCTCGGTGAGACAAGATCTGTC-3’；
SEQ ID NO.3（ZMOC8-HEX-T）：
5’-GAAGGTCGGAGTCAACGGATTATGCTCGGTGAGACAAGATCTGTT-3’；
SEQ ID NO.4（ZMOC8-R）：
5’-ACTACACCGGAACCTTGCTGC-3’；
Wherein the thickening sequence is a fluorescent binding group, and R is a reverse universal primer.
The primer pair can realize efficient amplification and genotyping aiming at the SNP molecular markers.
In a third aspect, the invention provides a kit for detecting the oil content of corn kernels, the kit comprising a primer pair as described above.
The kits described above may also contain reagents for PCR amplification including, but not limited to, DNA polymerase, PCR reaction buffers, probes, dNTPs, mg 2+ Water, etc.
The above reagents may be packaged individually or may be provided as a premix after mixing.
In a fourth aspect, the present invention provides the use of any one of the following 1) to 6) of a SNP molecular marker or a detection reagent thereof:
1) The method is applied to detecting or assisting in detecting the oil content of the corn kernels;
2) Application in screening or identifying high kernel oil content corn;
3) Application in early prediction of oil content of corn kernels;
4) The application in corn kernel oil content molecular marker assisted breeding;
5) Application in the improvement of germplasm resources of corn kernel oil content;
6) Identification of corn kernel oil content QTLqOC-1-3In (3), the QTLqOC-1-3Located between 113850895-143024206 bp of chromosome 9 of the B73 refgen_v4 reference genome;
the polymorphism site of the SNP molecular marker is positioned at 125242833 of chromosome 9 of a B73 RefGen_v4 reference genome, and the polymorphism is C/T.
The detection reagent is the primer pair or the kit.
Preferably, in the application, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is positioned at 150 th position of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T.
Specifically, the SNP molecular marker is obtained by taking a corn genome as a template and amplifying a primer with a sequence shown as SEQ ID NO. 2-4.
The genotype of the polymorphic site of the SNP molecular marker is CC, which corresponds to low grain oil content, and the genotype is TT, which corresponds to Gao Zi grain oil content.
Preferably, the primer pair comprises primers with sequences shown as SEQ ID NO.2-4, wherein SEQ ID NO.2-3 is an upstream primer and SEQ ID NO.4 is a reverse universal primer.
In some embodiments of the invention, the above application comprises the steps of:
1) Extracting genome DNA of corn to be detected;
2) Using the genomic DNA of step 1) as a template, a primer pair for amplifying the SNP molecular markers (e.g.: primers with sequences shown as SEQ ID NO. 2-4) for PCR amplification and fluorescence detection;
3) Genotyping is carried out according to the fluorescence detection result, and the oil content of the corn kernels is judged according to the genotyping result.
In the above step 2), the 10. Mu.L reaction system for PCR amplification comprises: template DNA 20 ng, primer mix 0.14. Mu.L, 2 Xenzyme and probe super mix 5. Mu.L, deionized water was added to a total of 10. Mu.L.
100. mu.L of primer mix was composed as follows: 12. mu.L of primer ZMOC8-FAM-C, 12. Mu.L of primer ZMOC8-HEX-T, 30. Mu.L of primer ZMOC8-R and 46. Mu.L of pure water were mixed well.
To increase the accuracy of the KASP marker detection, 2 blank controls without DNA template can be added per detection.
The reaction procedure of PCR includes: 95. pre-denaturing at a temperature of 10 min; 95. denaturation at 20℃ 20 s, annealing at 61℃40 s (0.6℃decrease per cycle) for 10 cycles; 95. denaturation at 20℃ 20 s, annealing at 55℃for 40 s,34 cycles; fluorescent signals are then collected.
In the step 3), genotyping is performed according to the collected fluorescence signal after PCR amplification, and if the FAM fluorescence signal is strong, the homozygous C allele (CC) is judged, namely the DNA fragment which is the same as the parent K51909 is contained, and the low kernel oil content is expressed; if the HEX fluorescent signal is strong, it is judged that the homozygous T allele (TT), namely the DNA fragment which is the same as the parent K71701, is high in kernel oil content.
In a fifth aspect, the present invention provides a method of identifying high kernel oil corn comprising: detecting the genotype of SNP molecular markers related to the oil content of corn kernels; the polymorphism site of the SNP molecular marker is positioned at 125242833 position of chromosome 9 of a B73 RefGen_v4 reference genome, and the polymorphism is C/T;
the genotype of the polymorphic locus of the SNP molecular marker is CC, which corresponds to low grain oil content, and the genotype is TT, which corresponds to Gao Zi grain oil content.
Preferably, in the method, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is positioned at 150 th position of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T.
Specifically, the SNP molecular marker is obtained by taking a corn genome as a template and amplifying a primer with a sequence shown as SEQ ID NO. 2-4.
In the above method, the genotype of SNP molecular marker is preferably detected by the following method: and (3) taking genomic DNA of corn to be identified as a template, carrying out PCR amplification by adopting a primer with a sequence shown as SEQ ID NO.2-4, and detecting the genotype of a PCR amplification product.
In some embodiments of the invention, the method of identifying high kernel oil corn comprises the steps of:
1) Extracting genome DNA of corn to be detected;
2) Using the genomic DNA of step 1) as a template, a primer pair for amplifying the SNP molecular markers (e.g.: primers with sequences shown as SEQ ID NO. 2-4) for PCR amplification and fluorescence detection;
3) Genotyping is carried out according to the fluorescence detection result, and the oil content of the corn kernels is judged according to the genotyping result.
In the step 2), the reaction procedure of the PCR amplification includes: 95. pre-denaturing at a temperature of 10 min; 95. denaturation at 20℃ 20 s, annealing at 61℃40 s (0.6℃decrease per cycle) for 10 cycles; 95. denaturation at 20℃ 20 s, annealing at 55℃for 40 s,34 cycles; then collecting fluorescent signals;
in the above step 2), 10. Mu.L of the reaction system for PCR amplification was as follows: template DNA 20 ng, primer mix 0.14. Mu.L, 2 Xenzyme and probe super mix 5. Mu.L, deionized water was added to a total of 10. Mu.L.
100. mu.L of primer mix was composed as follows: 12. mu.L of primer ZMOC8-FAM-C, 12. Mu.L of primer ZMOC8-HEX-T, 30. Mu.L of primer ZMOC8-R and 46. Mu.L of pure water were mixed well.
In the step 3), genotyping is performed based on the collected fluorescence signal after PCR amplification, and if the FAM fluorescence signal is strong, it is judged that the genotype C allele (CC) is homozygous, that is, the DNA fragment same as the parent K51909 is contained, and the corn kernel oil content QTL is not containedqOC-1-3The low grain oil content is expressed; if HEX fluorescent signal is strong, it is judged as homozygous T allele (TT), namely the DNA fragment which contains the same DNA fragment as parent K71701 and contains corn kernel oil content QTLqOC-1-3The appearance is high in oil content of the seeds.
The invention also provides a QTL for identifying the oil content of the corn kernelsqOC-1-3The method comprising: using corn genome DNA to be detected as a template, and adopting the method for amplifying the corn genome DNAPCR amplification and fluorescence detection are carried out on primer pairs (for example, primers with sequences shown as SEQ ID NO. 2-4) of SNP molecular markers, genotyping is carried out on corn to be detected according to the PCR amplification result, and whether the corn contains QTL is judged according to the genotyping resultqOC-1-3。
The invention has the beneficial effects that:
the invention discloses a corn kernel oil content QTL for the first timeqOC-1-3The QTL is located on chromosome 9 of corn, which can remarkably increase the oil content of corn kernels; the QTL has higher application value in high-quality corn breeding (screening of reasonable oil content).
The invention discloses a corn kernel oil content QTL for the first timeqOC-1-3SNP molecular marker ZMOC8 of (1), the molecular marker and QTLqOC-1-3Closely interlocked, KASP mark amplification is convenient and stable, and detection is accurate and efficient. The molecular marker ZMOC8 can accurately track and identify oil content QTL in different genetic backgroundsqOC-1-3Carrying QTLqOC-1-3The oil content of the corn strain is obviously higher than that of the corn strain without carrying QTLqOC-1-3The corn strain of the (2) can realize the identification of the oil content of corn kernels by using the molecular marker ZMOC8, and has high identification efficiency and high success rate.
Drawings
FIG. 1 is a graph showing the phenotype profile of oil content in DH isolates of constructed K71701X K51909.
FIG. 2 is a corn kernel oil content QTLqOC-1-3And QTL localization LOD map of molecular marker ZMOC8 on chromosome 9 of DH isolate population genetic linkage map of K71701 ×k 51909.
FIG. 3 is a graph showing the genotyping results of the DH isolates of maize K71701X K51909 parent and offspring using the KASP molecular marker ZMOC 8.
FIG. 4 is a graph showing the genotyping results of DH isolates of maize K71701X K71910 parent and offspring using the KASP molecular marker ZMOC 8.
FIG. 5 is a graph showing the statistical results of oil content of two genotype-corresponding strains detected by molecular marker ZMOC8 on DH segregating population offspring of maize K71701 XK 71910.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
In the invention, the corn kernel oil content QTLqOC-1-3The general flow of the process and method for obtaining the molecular marker ZMOC8 closely linked with the molecular marker ZMOC8 is as follows:
1. hybridization is carried out by taking corn K71701 as female parent and K51909 as male parent, obtaining hybrid F 1 Corresponding F 1 DH segregating populations were generated by haploid induction method, comprising 123 families, constituting a population of genetic maps.
2. Extracting DNA of each strain of the genetic mapping population in the step 1 by using a CTAB method, and carrying out genotype identification on two parents and 123 DH lines by using a GenoBaits Maize 1K liquid phase chip to obtain genotype data of the DH isolated population.
3. The obtained DH segregating population genotype data is imported into R software, and a genetic linkage map is constructed through R/qtl software package functions est.rf and est.map.
4. And (5) identifying the seed oil content of the DH segregating group plants after corn harvesting.
5. Introducing DH segregating population phenotype data and constructed genetic linkage map data into QTL positioning software Windows QTL Cartographer 2.5.5, performing QTL positioning analysis by using a composite interval mapping model (Composite Interval Mapping, CIM), and positioning an oil related major QTL on chromosome 9qOC-1-3。QTL qOC-1-3The QTL was able to account for 30.8% of the phenotypic variation, located between 113850895-143024206 bp on chromosome 9 of the B73 refgen_v4 reference genome (fig. 2), from parent K71701.
6. Sequence analysis is carried out by taking the sequence in the interval, and the sequence analysis is carried out on QTLqOC-1-3Confidence interval inward openingAnd a tightly linked SNP marker ZMOC8 is developed, the sequence of the marker is shown as SEQ ID NO.1, wherein Y is a SNP variation site, Y=C or T, C is the genotype of a parent K51909, and T is the genotype of the parent K71701.
7. And designing a specific primer pair for amplifying the molecular marker KASP-ZMOC8 according to the sequence before and after the molecular marker, wherein the sequence of the primer pair is shown as SEQ ID NO. 2-4.
8. KASP genotyping
1) Selecting the primer pair designed above, and carrying out PCR amplification by taking genomic DNA of the parent K71701, K51909 and the corn kernels of the segregating population strains as templates; reaction system for PCR amplification: template DNA 20 ng, primer mix 0.14. Mu.L, 2 Xenzyme and probe supermix 5. Mu.L, deionized water to a total of 10. Mu.L; reaction procedure for PCR amplification: 95. pre-denaturing at a temperature of 10 min; 95. denaturation at 20℃ 20 s, annealing at 61℃40 s (0.6℃decrease per cycle) for 10 cycles; 95. denaturation at 20℃ 20 s, annealing at 55℃for 40 s,34 cycles. Fluorescent signals are then collected.
2) Genotyping was performed according to the fluorescence signal, if the FAM fluorescence signal was strong, it was homozygous C allele, i.e. the same DNA fragment as the parent K51909, and if the HEX fluorescence signal was strong, it was T allele, i.e. the same DNA fragment as the parent K71701.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 corn kernel oil content QTLqOC-1-3Obtaining of molecular marker ZMOC8 closely linked to the orientation of (C)
1. Test materials: two maize inbred lines K71701 and K51909 with obvious difference of oil content are taken as parents, wherein K71701 is a variety with larger seed oil content, and K51909 is a variety with smaller seed oil content. Hybridization is carried out by taking corn K71701 as female parent and corn K51909 as male parent, obtaining hybrid F 1 Corresponding F 1 Generating DH segregating population comprising 123 families by haploid induction method to formGenetic mapping isolates the population. The oil content of the seeds in DH segregating group is normally distributed as shown in figure 1.
2. Extracting genome DNA of each strain of corn of a genetic mapping population by using a CTAB method, and carrying out genotype identification on two parents and 123 DH lines by using a corn GenoBaits Maize 1K SNP liquid phase chip to obtain genotype data of the DH separation population. The obtained DH segregating population genotype data is imported into R software, and a genetic linkage map is constructed through R/qtl software package functions est.rf and est.map.
3. The oil content of the seeds was measured by scanning using a Perten (Botong) DA7250 type near infrared analyzer (Sweden). At least 50 kernels per sample were plated in sample trays, oil content measurement standard curve scan was selected, and reflectance spectra were collected at intervals of 10 nm in the range of 400 to 2500 nm. The measurements were repeated three times for each sample and the phenotype data was obtained after averaging.
4. Introducing DH segregating population phenotype data and constructed genetic linkage map data into QTL positioning software Windows QTL Cartographer 2.5.5, performing QTL positioning analysis by using a composite interval mapping model (Composite Interval Mapping, CIM), and positioning an oil related major QTL on chromosome 9qOC-1-3。QTL qOC-1-3The QTL was able to account for 30.8% of the phenotypic variation, located between 113850895-143024206 bp on chromosome 9 of the B73 refgen_v4 reference genome (fig. 2), from parent K71701.
5. Sequence analysis is carried out by taking the sequence in the interval, and the sequence analysis is carried out on QTLqOC-1-3The sequence of the closely linked SNP marker ZMOC8 is shown as SEQ ID NO.1 in the confidence interval, wherein Y is a SNP variation site, Y=C or T, C is the genotype of the parent K51909, and T is the genotype of the parent K71701.
SEQ ID NO.1：
CTTCTACAGCATGACGCTGACATTGTTTTCAACTGAAATGTTCCAGAGAAGCGACGGAGGCGGGGCCTTCCAGGCCACGGACTTGCTCAATGGTAGACTGTTATGCGGGTGCCAGGACATCAGGGCATGCTCGGTGAGACAAGATCTGTYTTCTCCGCTTGTGGTGATATACTAATTAACCGCTATATGAATTCACCCCCTTTATTGTTTTGTCCATTTGCAGCAAGGTTCCGGTGTAGTATGTTCTGCATAAGTCCATAACAAATAGAGATCAATTTGATTGGAGTGGCGAAAGAAGAC。
6. According to the sequence before and after the molecular marker, a specific primer pair for amplifying the molecular marker KASP-ZMOC8 is designed, wherein the sequence of the primer pair is as follows, SEQ ID NO.2-3 is an upstream primer, and SEQ ID NO.4 is a reverse universal primer:
SEQ ID NO.2（ZMOC8-FAM-C）：
5’-GAAGGTGACCAAGTTCATGCTATGCTCGGTGAGACAAGATCTGTC-3’；
SEQ ID NO.3（ZMOC8-HEX-T）：
5’-GAAGGTCGGAGTCAACGGATTATGCTCGGTGAGACAAGATCTGTT-3’；
SEQ ID NO.4（ZMOC8-R）：
5’-ACTACACCGGAACCTTGCTGC-3’。
wherein the bolded sequence is a fluorescent binding group.
7. KASP genotyping
1) Extracting parent and isolated group seed DNA by using a CTAB method;
2) Preparing a primer mixed solution: in a centrifuge tube, 12. Mu.L of primer ZMOC8-FAM-C, 12. Mu.L of primer ZMOC8-HEX-T, 30. Mu.L of primer ZMOC8-R and 46. Mu.L of pure water were respectively taken and uniformly mixed to prepare 100. Mu.L of primer mixture.
3) Preparing a 10 mu L fluorescent quantitative PCR amplification reaction system: template DNA 20 ng, primer mix 0.14. Mu.L, 2 Xenzyme and probe super mix 5. Mu.L, deionized water was added to a total of 10. Mu.L. To increase the accuracy of the detection of the KASP markers, 2 empty controls without DNA template were added.
4) The PCR reaction procedure was: 95. pre-denaturing at a temperature of 10 min; 95. denaturation at 20℃ 20 s, annealing at 61℃40 s (0.6℃decrease per cycle) for 10 cycles; 95. denaturation at 20℃ 20 s, annealing at 55℃for 40 s,34 cycles. Fluorescent signals are then collected.
5) Genotyping was performed according to the fluorescence signal, with the FAM fluorescence signal being strongly homozygous C allele, i.e. having the same DNA fragment as the parent K51909, and the HEX fluorescence signal being strongly T allele, i.e. having the same DNA fragment as the parent K71701.
As shown in fig. 3, 2 parental samples, 123 population samples and 2 negative blank controls were classified into three types altogether after KASP typing, the sample marked with a triangle symbol in the upper left corner was a sample with SNP genotype T, and the allele was from female parent K71701; the sample marked with a dot symbol at the lower right corner is a sample with SNP genotype C, and the allele is from male parent K51909; the samples marked by square symbols at the lower left corner are 2 negative blank controls, the positions of the three types of samples on the drawing are clear and distinguishable, the negative controls are distinguished to be normal, the test operation is normal, and the genotype of the samples can be distinguished clearly by utilizing the molecular marker developed by the invention.
Example 2 application of SNP molecular marker ZMOC8
1. Acquisition for validation of population
For detecting QTL of oil content carried by K71701qOC-1-3Whether or not the oil content can be increased in other inbred lines, another maize inbred line K71910 (genotype C at SNP site ZMOC8, genotype of non-elite allele) was used, and DH isolates comprising 129 families were generated by haploid induction and doubling using K71701 and K71910 as parents for verificationqOC-1-3Is a genetic effect of (a).
2. Genotyping with molecular marker ZMOC8
1) performing fluorescent quantitative PCR amplification and genotyping by using the genomic DNAs of 129 strains of the parent and DH isolates obtained in the step 1 as templates and ZMOC8-FAM-C (SEQ ID NO. 2), ZMOC8-HEX-T (SEQ ID NO. 3) and ZMOC8-R (SEQ ID NO. 4) as primers.
Reaction system for PCR amplification: template DNA 20 ng, primer mix 0.14. Mu.L, 2 Xenzyme and probe super mix 5. Mu.L, deionized water was added to a total of 10. Mu.L. To increase the accuracy of the detection of the KASP markers, 2 empty controls without DNA template were added.
Reaction procedure for PCR amplification: 95. pre-denaturing at a temperature of 10 min; 95. denaturation at 20℃ 20 s, annealing at 61℃40 s (0.6℃decrease per cycle) for 10 cycles; 95. denaturation at 20℃ 20 s, annealing at 55℃for 40 s,34 cycles. Fluorescent signals are then collected.
2) Genotyping was performed according to the fluorescence signal, with the FAM fluorescence signal being strongly homozygous C allele, i.e. having the same DNA fragment as the parent K71910, and the HEX fluorescence signal being strongly T allele, i.e. having the same DNA fragment as the parent K71701.
As shown in fig. 4, 2 parental samples, 129 population samples and 2 negative blank controls were classified into three types altogether after KASP typing, the sample marked with a triangle symbol in the upper left corner was a sample with SNP genotype T, and the allele was derived from female parent K71701; the sample marked with the dot symbol at the lower right corner is the sample with SNP genotype C, and the allele is from male parent K71910; the samples marked by square symbols at the lower left corner are 2 negative blank controls, the positions of the three types of samples on the drawing are clear and distinguishable, the negative controls are distinguished to be normal, the test operation is normal, and the genotype of the samples can be distinguished clearly by utilizing the molecular marker developed by the invention.
3. After corn harvesting, 96 lines of the DH population are randomly selected, and the oil content of the seeds, namely the phenotype, is measured. The phenotype data were classified into two categories according to the molecular marker ZMOC8, and statistical analysis was performed using independent sample t-test, and the results are shown in fig. 5. The average oil content of the seed grain sample with the same type as K71701 is 4.90 percent, which is extremely obviously higher than the average oil content (average 4.31 percent) of the seed grain sample with the type K71910P<0.01 The oil content can be increased by 0.59 percent, and the oil content can be relatively increased by 13.7 percent. Description of the oil content QTL of the present inventionqOC-1-3Does have the effect of obviously increasing the oil content, and the molecular marker ZMOC8 can be used for tracking and identifying the QTL of the oil content under different populations and different genetic backgroundsqOC-1-3Can assist in screening corn varieties with ideal seed oil content in breeding.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims (10)
1. The SNP molecular marker related to the oil content of corn kernels is characterized in that the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is positioned at 150 th site of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T.
2. The SNP molecular marker according to claim 1, wherein the SNP molecular marker is amplified by a primer with a sequence shown as SEQ ID NO.2-4 by taking a corn genome as a template.
3. The SNP molecular marker according to claim 1 or 2, wherein the polymorphic site of the SNP molecular marker has a genotype of CC corresponding to low grain oil content and a genotype of TT corresponding to Gao Zi grain oil content.
4. A set of primer pairs for detecting the oil content of corn kernels, which is characterized in that the primer pairs are used for detecting the SNP molecular markers according to any one of claims 1 to 3.
5. The primer pair of claim 4, wherein the primer pair comprises a primer having a sequence as set forth in SEQ ID NO.2-4, wherein SEQ ID NO.2-3 is an upstream primer and SEQ ID NO.4 is a reverse universal primer.
6. A kit for detecting the oil content of corn kernels, comprising the primer pair of claim 4 or 5.
7. Use of the SNP molecular marker of any one of claims 1-3 or the primer pair of claim 4 or any one of the following 1) -6) of the kit of claim 6:
1) The method is applied to detecting or assisting in detecting the oil content of the corn kernels;
2) Application in screening or identifying high kernel oil content corn;
3) Application in early prediction of oil content of corn kernels;
4) The application in corn kernel oil content molecular marker assisted breeding;
5) Application in the improvement of germplasm resources of corn kernel oil content;
6) Identification of corn kernel oil content QTL qOC-1-3In (3), the QTLqOC-1-3Located between 113850895-143024206 bp of chromosome 9 of the B73 refgen_v4 reference genome.
8. The use according to claim 7, wherein the SNP molecular marker has a nucleotide sequence shown as SEQ ID NO.1, the polymorphic site is located at position 150 of the sequence shown as SEQ ID NO.1, and the polymorphism is C/T.
9. The use according to claim 7, wherein the primer pair comprises a primer having the sequence shown in SEQ ID No.2-4, wherein SEQ ID No.2-3 is the upstream primer and SEQ ID No.4 is the reverse universal primer.
10. A method for identifying high kernel oil corn, said method comprising: detecting the genotype of SNP molecular markers related to the oil content of corn kernels; the polymorphism site of the SNP molecular marker is positioned at 125242833 position of chromosome 9 of a B73 RefGen_v4 reference genome, and the polymorphism is C/T;
the genotype of the polymorphic locus of the SNP molecular marker is CC, which corresponds to low grain oil content, and the genotype is TT, which corresponds to Gao Zi grain oil content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310553132.6A CN116287423B (en) | 2023-05-17 | 2023-05-17 | SNP molecular marker related to corn kernel oil content and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310553132.6A CN116287423B (en) | 2023-05-17 | 2023-05-17 | SNP molecular marker related to corn kernel oil content and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116287423A true CN116287423A (en) | 2023-06-23 |
| CN116287423B CN116287423B (en) | 2023-08-04 |
Family
ID=86801671
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310553132.6A Active CN116287423B (en) | 2023-05-17 | 2023-05-17 | SNP molecular marker related to corn kernel oil content and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116287423B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117512196A (en) * | 2023-12-13 | 2024-02-06 | 江苏省农业科学院 | Molecular marker and KASP primer combination obviously related to soybean vitamin E content and application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040025202A1 (en) * | 2002-03-15 | 2004-02-05 | Laurie Cathy C. | Nucleic acid molecules associated with oil in plants |
| CN102911949A (en) * | 2012-11-09 | 2013-02-06 | 华中农业大学 | LACS (long chain acyl-coenzyme A synthetase) gene locus related to maize oil content and application thereof |
| CN102925457A (en) * | 2012-11-09 | 2013-02-13 | 华中农业大学 | Application of molecular marker of maize oil content related genes |
| CN107090504A (en) * | 2017-05-03 | 2017-08-25 | 袁隆平农业高科技股份有限公司 | SNP marker combination and its application for corn gene parting |
| CN113322339A (en) * | 2021-05-27 | 2021-08-31 | 东北农业大学 | Molecular marker related to high protein content of soybean and method for identifying soybean with high protein content |
-
2023
- 2023-05-17 CN CN202310553132.6A patent/CN116287423B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040025202A1 (en) * | 2002-03-15 | 2004-02-05 | Laurie Cathy C. | Nucleic acid molecules associated with oil in plants |
| CN102911949A (en) * | 2012-11-09 | 2013-02-06 | 华中农业大学 | LACS (long chain acyl-coenzyme A synthetase) gene locus related to maize oil content and application thereof |
| CN102925457A (en) * | 2012-11-09 | 2013-02-13 | 华中农业大学 | Application of molecular marker of maize oil content related genes |
| CN107090504A (en) * | 2017-05-03 | 2017-08-25 | 袁隆平农业高科技股份有限公司 | SNP marker combination and its application for corn gene parting |
| CN113322339A (en) * | 2021-05-27 | 2021-08-31 | 东北农业大学 | Molecular marker related to high protein content of soybean and method for identifying soybean with high protein content |
Non-Patent Citations (3)
| Title |
|---|
| HUI FANG等: ""Genetic basis of maize kernel oil-related traits revealed by high-density SNP markers in a recombinant inbred line population"", 《BMC PLANT BIOLOGY》, vol. 21, pages 1 - 12 * |
| 董青松等: ""玉米子粒脂肪含量的全基因组关联分析"", 《玉米科学》, vol. 26, no. 2, pages 58 - 63 * |
| 郭晋杰等: ""基于4个测交群体玉米籽粒品质相关性状关联分析"", 《农业生物技术学报》, vol. 27, no. 5, pages 809 - 824 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117512196A (en) * | 2023-12-13 | 2024-02-06 | 江苏省农业科学院 | Molecular marker and KASP primer combination obviously related to soybean vitamin E content and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116287423B (en) | 2023-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438252B (en) | Molecular marker closely linked with male and female sex of spinach and application thereof | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN116287423B (en) | SNP molecular marker related to corn kernel oil content and application thereof | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN105256031B (en) | Utilize the method and its primer special of high-throughput molecular labeling transformation muskmelon female series | |
| CN114427007A (en) | KASP molecular marker related to bitter gourd whole female and application thereof | |
| CN110157833B (en) | Method for detecting high-lysine corn and special molecular marker thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN110157834B (en) | SNP site OE2-5 related to high lysine character of corn and application thereof | |
| CN112266975A (en) | Primer group and kit for detecting KASP (Kaempferi-N-linked immunosorbent assay) marker related to POD (peroxidase) activity of wheat grains and application of primer group and kit | |
| CN114606332A (en) | SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN113151541B (en) | SNP molecular marker for predicting low-fructose peaches and detection method | |
| CN111647677B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-6D and application | |
| CN114606339A (en) | KASP molecular marker linked with pumpkin inositol content major QTL and application thereof | |
| WO2023236840A1 (en) | Snp site closely associated with anthocyanin content in vigna unguiculata, kasp molecular marker primer, and use thereof | |
| CN116814841B (en) | Primer group for identifying rice black brown glume gene HK4, and method and application thereof | |
| CN114457178B (en) | KASP molecular marker for predicting soluble solids of waxberry fruits and application thereof | |
| CN116411118B (en) | KASP molecular marker linked with pumpkin sucrose content major QTL and application thereof | |
| CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN115341047B (en) | Molecular marker related to asexual shape of trilobatin of Malus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |