CN107090504A - SNP marker combination and its application for corn gene parting - Google Patents

Abstract

The present invention is provided to the combination of the SNP marker of corn gene parting, it is made up of 448 SNP markers, the numbering of the SNP marker is respectively ZmSNP001~ZmSNP448, their nucleotide sequence is respectively such as SEQ ID NO:Shown in 1 448.Molecular labeling fingerprint analysis can be carried out to corn variety resource, genotype identification is carried out to hybrid Population offspring, variety authentication is identified, breeding material genetic background is analyzed and screened, analysis is associated to economical character by being combined using the SNP marker of the present invention, be had broad application prospects.

Description

SNP marker combination and its application for corn gene parting

Technical field

The present invention relates to genomics, molecular biology, bioinformatics and Molecular Plant Breeding field, specifically, It is related to a kind of SNP marker combination for corn gene parting and its applies.

Background technology

Sequencing of extron group (whole exome sequencing, WES) associates site sequencing with restriction enzyme (RADseq) it is the gene order-checking method that SNP is excavated that is used in complex genome species using more high performance-price ratio.

Molecular marking technique (Molecular marker technologies) is the important tool in molecular breeding.Pass System molecular marking technique, such as RFLP (Restriction Fragment Length Polymorphism, Restriction Fragment Length Polymorphism) and the once performance in functional genome research of SSR (Simple Sequence Repeat, simple sequence repeats) technology Important function.But, there are many limitations in traditional molecular marking technique, such as flux is low, quantity is few, operating process is numerous It is trivial, it is impossible to meet the demand of large-scale commercial breeding.In order to accurately be controlled target gene, have to genetic background Effect selection, carries out accurately analyzing and identifying, it is necessary to development and utilization high flux molecular marking technique to breeding kind.At present, it is high Flux molecular marking technique platform mainly includes：Second generation sequencing technologies, biochip technology, and the detection of single SNP marker System, such as Taqman and KASP are marked.

The content of the invention

It is an object of the invention to provide the combination of the SNP marker for corn gene parting.

It is a further object of the present invention to provide the application that the SNP marker for corn gene parting is combined.

In order to realize the object of the invention, the present invention is provided to the combination of the SNP marker of corn gene parting, by 448 Individual SNP marker composition, the numbering of the SNP marker is respectively ZmSNP001~ZmSNP448, and nucleotide sequence is respectively such as SEQ ID NO:Shown in 1-448, their information is as shown in table 1.Every sequence is deposited by 101 base compositions, and at the 51st In nucleotide variation.

The extron group of 276 parts of corn materials is sequenced the present invention, and other 206 parts of corn materials are carried out (have 85 parts of materials to be identical in two groups of materials, therefore have 397 parts of different corn materials) is sequenced in RADseq, by 482 Part sequencing data carries out initial analysis, obtains a large amount of high-quality SNP (SNP) information.Based on these SNP Information, integrates the public SNP data of corn and 397 parts of materials has been carried out with clustering and group structure analysis；Also, for 397 64656 shared high-quality SNP sites of part material do further screening, select 448 core SNP sites, are based on These SNP genetic distance dendrogram shows, is only enough to distinguish above-mentioned 397 parts with the genotype information of this 448 SNP sites Corn germ plasm resource.(Fig. 1)

The present invention also provides the SNP marker and combines the application in corn molecular mark.

The present invention also provides the SNP marker and combines the application in corn full-length genome breeding chip is prepared.

The present invention also provides the method using KASP technology for detection maize genotypes, comprises the following steps：

1) KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence；

2) representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result reacted according to PCR Verify the availability of KASP primers；

3) genotype point is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment Type, so as to identify the genotype of corn to be measured.

The present invention also provides application of the above method in corn variety identification.

The present invention also provides application of the above method in detection corn breeding material.

The present invention also provides application of the above method in corn whole-genome association.

The present invention also provides application of the above method in corn molecular mark.

The present invention is compared with other Markers for Detection systems, with advantages below and effect：

(1) compared with conventional molecular mark is such as SSR marker, with flux height, the low advantage of single marking data cost.

(2) genotype data accurately and reliably, genetic stability and reproducible.

(3) automatic detection is easily realized, human cost is reduced.

(4) integration of multiple genotype data result can be met.

Brief description of the drawings

Fig. 1 is distribution maps of the 448 core SNP identified from 397 parts of corn materials on genome.

Fig. 2 is 64656 shared high-quality SNP sites of 397 parts of corn materials in the embodiment of the present invention 1 on genome Distribution map.

Fig. 3 is the Dendrogram of 276 parts of corn materials in the embodiment of the present invention 1.

Fig. 4 is the Dendrogram of 206 parts of corn materials in the embodiment of the present invention 1.

Fig. 5 be the embodiment of the present invention 2 in using KASP primers ZmSNP278 to corn sample to be measured progress quantitative fluorescent PCR The result of detection.

Fig. 6 is the PCA analysis results of 448 SNP markers in the embodiment of the present invention 3.

Embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Unless otherwise specified, embodiment According to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual (Sambrook J＆Russell DW, Molecular Cloning:A Laboratory Manual, 2001), or according to the condition of manufacturer's specification suggestion.

Embodiment 1 is used for the exploitation that the SNP marker of corn gene parting is combined

Genome sequencing has been carried out to 276 parts of corn varieties using sequencing of extron group technology.Meanwhile, using restricted Restriction endonuclease association site sequencing technologies have carried out genome sequencing to 206 parts of corn varieties, and 397 parts of corn materials are obtained altogether Gene order-checking data.With reference to other corn varieties weight sequencing data in public database, (including Central China, agricultural university is tight Build the SNP information of (2014) 503 parts of materials of SNP information and Hirsch et al. of 540 parts of corn materials of soldier professor), with jade Rice B73 genomes AGPv3 is reference sequences, analyzes and identifies SNP site, selects representative, 397 parts of corn materials Expect unique SNP marker totally 64656.Core SNP is identified and screened according to following steps.

1st, the comparison of sequencing Reads and corn B73 reference gene groups

Compare software:BWA mem

Reference gene group：B73 reference gene groups AGPv3

Input:The reads (paired-end and single end) of pretreatment

Parameter setting：-M

2nd, identify and screen SNP site

By using instruments such as picard, GATK and VCFtools, since the bam files after sequence merges, enter one by one Row following analysis works, and finally gives original SNP.

(1)picard tools:MarkDuplicates

For WES sequencing datas, this step is required.And to RADseq data, this step need to be skipped.

(2)GATK:RealignerTargetCreator and IndelRealigner

The comparison again that local fine is carried out to the reads in known indel regions is arrived by comparing, the accuracy compared is improved.

(3)GATK:BaseRecalibrator

For each sample, on the basis of known SNP site, calibration model is set up by machine learning, then be based on The model corrects base quality.

(4)GATK:HaplotypeCaller and CombineGVCFs

For each sample, nucleotide diversity therein (Variant calling), generation .g.vcf texts are found one by one Part.And merging comes from 276 parts of WES corn materials and 206 parts of RAD corn materials respectively, obtains final two .g.vcf files.

(5)GATK:GenotypeGVCFs

Polymorphism parting (Joint genotyping), based on the variation information comprising all group member's samples .g.vcf file, obtains the original SNP and indel information of each member each organized.

(6)GATK:VariantRecalibrator and ApplyRecalibration

Using known corn SNP data (maize.AGPv3.22.hmp.vcf), quality is carried out to original SNP site Correction.Obtain vcf file of the quality re-graduation containing each SNP on the occasion of VQRS.

(7) VCFtools screens high-quality SNP

The SNP of the PASS after GATK is corrected is screened, by further selecting all samples missing in MAF >=0.05, group The SNP of rate≤20%, constitutes high-quality SNP site collection, is used as next step analysis.

3rd, the signature analysis of high-quality SNP site

Two sets of corn sequencing datas are analyzed by above step, 1,173,946 (206 parts are identified respectively RADseq materials) and 1,014,332 (276 parts of WES materials) high-quality SNP site.To these sites, we are further Calculate SNP allele frequency, π values with VCFtools, heterozygosity, the relationship degree of correlation of sample, and according to SNP Allele frequency calculate the PIC values of each SNP site.The Hardy- of each SNP site is also examined with plink Weinberg balances.

4th, clustering

It is far and near for the affiliation between clear and definite different corn materials, these corn materials are carried out using SNPhylo softwares Clustering.Successively the material that the corn material and 206 parts of RAD of 276 parts of WES sequencings are sequenced is clustered respectively, used The shared SNP (64,656SNP) of two groups of materials is carried out to all 397 parts of materials (having 85 parts of materials to be identical in two groups of materials) Clustering.

Fig. 2 illustrates distribution situation of 64,656 SNP sites for coming from 397 parts of corn materials on genome.From Fig. 2 can be seen that SNP to be distributed in chromosome two ends density high, and the density near centromere is then relatively low, this trend with The distribution trend of corn gene on chromosome is closely similar.

5th, public SNP data clusters analysis is integrated

To further appreciate that this 397 parts of corn materials genetic diversity in a wider context and group structure, Wo Menshou The public SNP data of two batches are collected, including Central China agricultural university professor Yan Jianbing to from 540 parts of corn germplasms all over the world The SNP chip Genotyping (containing 2,649,403 SNP sites) of resource and (2014) 503 parts of materials of Hirsch et al. 485,179 SNP site data.By the way that grand flat data are integrated with the Yan Jianbing data taught, we are extracted two The genotype information of 34,324 shared SNP sites of partial data, and clustering has been carried out with these data, build tree-shaped Figure.From the point of view of dendrogram, generally this 397 parts of materials and the extent of polymerization from the public corn resources such as CIMMYT be not high, says The genetic diversity of this bright 397 parts of breeding materials has larger room for promotion.The Dendrogram of 276 parts of corn materials is shown in Fig. 3, The Dendrogram of 206 parts of corn materials is shown in Fig. 4.

6th, core SNP collection (core SNP set)

Carry out further screening for 64656 high-quality SNP sites that 397 parts of materials have, it is a collection of to pick out Core SNP site is used for marker development, and these materials are distinguished for later molecular breeding laboratory stable detection.Screen principle and Process is as follows：

1. according to the PIC values of SNP site, the SNP of PIC≤0.37 is rejected.

2. .vcf files are converted into .map and .ped files, bed files is further converted into using plink.

3. plink arrange parameters -- indep-pairwise 100 10 0.5 is utilized, it is step screening that SNP, which is carried out,：With Every 100 SNP are a window, and 10 SNP are step-length, calculate the linkage disequilibrium LD values between each pair SNP in each window, If LD is more than 0.2, one of SNP is removed.

4. operated more than repeating, it is ensured that the SNP retained is not in same linkage disequilibrium is interval.

Screened by above step, finally obtain 448 core SNP sites, Fig. 1 shows these sites on genome Distribution, overall trend coincide with the SNP distribution trends (Fig. 2) before screening, and site distribution is substantially uniform, and in centromere or LD The selected SNP in longer region is less.Genetic distance dendrogram based on these SNP shows the base only with this 448 SNP sites Because type information is enough to distinguish this 397 parts of corn germ plasm resources.All 448 core SNP sites are shown in SEQ ID NO:1-448.

The method that embodiment 2 utilizes KASP technology for detection maize genotypes

According to the core SNP sequences obtained in embodiment 1, the detection of maize genotype is carried out with reference to KASP technologies.Specifically Method is as follows：

1st, KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence；

2nd, representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result reacted according to PCR Verify the availability of KASP primers；

3rd, genotype point is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment Type, so as to identify the genotype of corn to be measured.

Part primer sequence used is shown in Table 2.

The part primer sequence (5 ' -3 ') of table 2

Step 3 is specific as follows：

(1) genomic DNA of corn sample to be measured is extracted；

(2) corn sample to be measured needed for PCR is reacted using LGC companies production IntelliQube SNP detecting systems DNA, KASP primer, Mastermix carry out high-throughout packing mixing；

(3) the Hydrocycler water-baths PCR instrument produced using LGC companies carries out high flux PCR amplifications；

(4) detection of fluorescence signal is carried out to PCR primer using IntelliQube, according to each corn sample DNA to be measured Fluorescence signal determine its genotype.

The method that genotype to corn to be measured is made a concrete analysis of is as follows：

The DNA of corn sample to be measured will produce fluorescence signal in each cyclic process that PCR is expanded, a certain The different corn sample DNA of SNP site genotype can produce different fluorescence signals.After PCR amplifications terminate, IntelliQube Different fluorescence signal information will be collected and sorted out.

Fig. 5 is to utilize KASP primers ZmSNP278 (Primer_Allele FAM:CACCATCTTGCTCTCCTTCTGCA, Primer_AlleleHEX:ACCATCTTGCTCTCCTTCTGCG,Primer_Common: GAGTCAAAAGCTGAGGCGGAGGAA) the result detected to corn sample to be measured.Fig. 5 show IntelliQube receipts The result of the fluorescence signal of collection, different fluorescence signal represents different SNP genotype, and each point represents different jade to be measured Rice sample.Upper left corner blue-fluorescence signaling point represents that these corn testing samples are homozygosis GG in the genotype of corresponding SNP site, Lower right corner red fluorescent point represents that these corn testing samples are homozygosis AA in the genotype of corresponding SNP site, middle purple Color fluorescence signal point represents that these corn testing samples are heterozygosis AG in the genotype of corresponding SNP site.

The PCA analyses of 3 448 SNP markers of embodiment

The PCA analysis results of 448 SNP markers are shown in Fig. 6, can clearly demarcate male parent colony and maternal colony, with gathering Class, group structure analysis result are consistent.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

Sequence table

<110>Yuanlongping Agricultural Hi-Tech Co., Ltd.

<120>SNP marker combination and its application for corn gene parting

<130> KHP161117561.5Q

<160> 448

<170> PatentIn version 3.3

<210> 1

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 1

ggaaatggaa catcaatcaa agagcagctc atgagacaga aacataaaga ncggcatctg 60

agattcygag ttaccattac cagccaatat cwwatataca g 101

<210> 2

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 2

ctccttcctg actctctatt cttttgtaga acaatttctc ggagttttca ntagaaagag 60

gttttaatct ataaacctcy tctactttag tgacaacccc g 101

<210> 3

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 3

gaatgctcta tgcyacaaga gtaataggta tcctccaagr ccattattwt ntgattcatc 60

taggcatcaa ggcgaaartg acttccakaa gccatttgtt g 101

<210> 4

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 4

ttgttatcgt cagatgttga tgtcccattg acgrcatacc aaatggtggt ntgttccgct 60

caatggcagt ctctctcaat ctatctgatt tgttrggatc t 101

<210> 5

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 5

tttgcgcaac gacgtaattt ttgtttttca atgaagacta gatgagtagt ntccataaaa 60

cttatgctgg tacagtgttg catatccttg agcaatcgtg g 101

<210> 6

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 6

tccatccgca ggacgagaca atttacgaac aaccragcat tcgycaccgg nccttctcgg 60

attcygaatt cgcrggctgy gcaacaaggg tgcgccagag g 101

<210> 7

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 7

atcctttatt gtcagattcc cactggtggc tttcctctcc ctgagaaaac ngaccctctt 60

ggcacmattt ctgctgctcc atggggatct gctttgattc t 101

<210> 8

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 8

tccacgatct cgtcgcagac cgcgcggagg tcggccaggc arctcttaag ncggcggcgg 60

aggccagtga cggtgctrgc gacaggctcg agctccggga a 101

<210> 9

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 9

gcaagcttcg aaaaagaatg gggtggcgag ctgatgtcaa cgacagcaac nggtgcratg 60

cattccatta cattacatta catgcagaag acaatagcaa t 101

<210> 10

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 10

atgacagaga tatacgcaga catcatggtg gagcatcagt aagaattttg naacattctt 60

agaaatacct ctcttatggc aaaacaaata acatkcacac a 101

<210> 11

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 11

agtgtgacaa ctgctccatt ttgctgagga gaataaggag cagttgtata ntgcttaata 60

cattcttcat tgcagaacac agtgaatgaa atggaattga a 101

<210> 12

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 12

aaccattcct tccggccgtg gctgacgagt ggtcccctac accaccccct ntatctgaat 60

ggcaaacacc accacastcc cagacaccgt cyccttccct c 101

<210> 13

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 13

cagggattgg aacaacgacg tggagggttc tcaccggcgg cayggcagta ncccaggcgg 60

cgcaactktt gctatgcggc aagggaaaag ggaaatagtg g 101

<210> 14

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 14

cccactcctg aattcctcct ctgttctgtt aatagaattt gtgctcagat naatgaaaat 60

cagaagctat gtacgtccta tagagatcca tgtgatatga g 101

<210> 15

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 15

tcaataatag tgtatacata tggagaaaaa caaacaaaaa tgttatgctt naaccacagc 60

tcgttctacc aaaagyagtt gtccagatga atctcctcca t 101

<210> 16

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 16

ttttggttgg atcggagata gaagaactta ccgtgctctt tcaggccttg ngcgaccctg 60

tccccggtca cccggcgccg tcccccggcg ccggcggctg c 101

<210> 17

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 17

tatttttgcg ggtccttttg ccaggttcac tacaagtttg aactgatgga ngagacgcta 60

tttcttacgg taaacgtaat agatagattc ttggaaaagg a 101

<210> 18

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 18

tgrctttttg aagatgttgc ttrtagatat ttggattcta attttggcat nctttgcagg 60

tatgatccta gtagatatgc aggcagagat gaagatgtca g 101

<210> 19

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 19

ctctacctcc tgctgaactc cgscgcggcg caggagatgc tcgagacgtc ngcggcgcag 60

ggctacaagg ccccggagct gatgaagatg agggacgcca c 101

<210> 20

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 20

ggtgttgtta ggatctgyct aaaaacaaca cgcgaggccc tctcctcatc ngtcaattcc 60

ctggctggtt ccgcaggaag ccaatccctc acrgaagaag t 101

<210> 21

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 21

tgccatgatg aaaatgccaa ttggccctca gatcgagctt ttgcaggtga ngtcggacca 60

gataagaact tgggagaggg tgggccagtt gaataagctc g 101

<210> 22

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 22

gaggctaacc gtatcagaga gaagtaccct gacagaattc cagtaagctt ntaccctcct 60

gcatgcactg ttcrtttctt catgattgct ttsatccaat t 101

<210> 23

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 23

ttgattgcct gwatkatgtt ctctgcttcc tctactactg ttwtgtctcc ntttgcagta 60

ctgcgtgcgg caataaacgc ctcaacawcm tgttgcagtc t 101

<210> 24

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 24

tttcacctca gtatgtgccg tctgtaagtg cttcgatcta ttcttatgtg nttttgattg 60

tttcatttrt ttcgccttca ttggataata ctatattatc c 101

<210> 25

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 25

ttttktatgt ttcctgtttc atcttattag gttgaaatta aaagggacaa ncattacaag 60

gaggttcgts tgttttcaga tgcagggcga atcctcagac c 101

<210> 26

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 26

aaatgtttga tgtgttactt acaactggca ggtcctttaa aatactggaa ngaggaacca 60

tcagagatgc taaggcaaca gaccaattga tgttatctcg c 101

<210> 27

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 27

gcatgctgca gaagcaactt gagattcgaa gcgaagaaag gaaatttagt ntcaaatctg 60

ctgacgctgc acacaagcag catcttgaga aygtaaggaa g 101

<210> 28

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 28

cagcaatcca gcgtcttgaa tggaatttag aacaacacrt cmattttaat natctgagca 60

acaagtagag caaccaatcc atctgcargt ctaggagagg a 101

<210> 29

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 29

aactcacgtg ccaacaagcg caagaaaacg aaggaygttt ctgaatctga ntccgaagag 60

gatgatgatg atgatgagga tgaaagcgga gacgatgaaa a 101

<210> 30

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 30

tggagaaggc cggtcccaac ggccgaagca caccrgagaa aggrcagasa ncctsaacya 60

gaaaatactt catttctagg aracacrgwt tgcgtagcta a 101

<210> 31

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 31

tcgatgagat gaagcagaaa tctgcggcca gagaattcca ggtgatcgct nactgtttct 60

gtcttctccg ttgttcgtct gaaactgaca cgaccgaamr c 101

<210> 32

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 32

aaggrgagag ggttcaakca ttgcttagct ggagggaccc tcgggccaca ncagtctttg 60

tcctattttg tttgatagca gcaatagtcc tctatgttac a 101

<210> 33

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 33

gccacggcac cttggataca tacactatgt gaattcacag attctcaatt natttgtttc 60

aggtggacga gatatttgtt cagtctatta aagacgcagg c 101

<210> 34

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 34

aawargaagg gctgagtyga gagtgctgca gaatacatga ttrttrttgc ntgaaaagra 60

acatgmatgt cactacagmt agctatacac ttactggctg t 101

<210> 35

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 35

tcctattcag tatagaaaga wttcayaata ccatgaccac agaggttaca naccaascag 60

gtctacyagg gttgtgtcta tttttaagat actgaggacc a 101

<210> 36

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 36

gttcctaaca ckctgtaact ttggcctttg aatagattct agagagcctc naagaaaacc 60

actggctggt gctacttttt cttacgggac aaragagcct c 101

<210> 37

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 37

caatcctgtg aaacaggtaa acagaaayta aatgtacaaa caggtagcac ncaaggatca 60

taccgtttcc aatcttctcc aactttgaac atgctatggt a 101

<210> 38

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 38

ttctttaact ccgtatgtcg agcagggttg tttacatctt gctttcgttt ntgttcttca 60

atatttcagg cataaatgac agaactcggt gctagaagca g 101

<210> 39

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 39

ttcagctcat tatacacatg gttaccttct tgatartagt ccttcctgtg ncacatgaaa 60

tctgccatca gtgtttaagc aagaatgaaa tsgagatgct t 101

<210> 40

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 40

cagcctgtta aaagttttgc taaaccaaac atggtaccac caccaatrtg ngtcccagtt 60

accctttcaa actttctrtt tccagtaacc tacattatac t 101

<210> 41

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 41

agratatatg magatttggg atacaagcag tcaagctcca taatattctc nttctccaca 60

agtttattta gggtcattta akttggayat atgaagatgt g 101

<210> 42

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 42

tggttctaga acgtsctagg gagtagggag tgygcttgaa agggccrgac nagtgacgay 60

accgttggca ttgtgatktg tgcattttct gacgtgacta a 101

<210> 43

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 43

aaggtattma ttcttatgtt atgygcctca aatttatgty ctgaytttga ngtttttgtg 60

twcataactt aataaaattt gtatttcagc aaaagtacaa a 101

<210> 44

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 44

atttaatgag taactacatt taataatgag tacaacgttg agartgacgt naaccagcgg 60

ctccggaatc cggatctccc cacacggmca cacggacacg g 101

<210> 45

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 45

gctaaaaaca aactaaataa actagttggc aacaaatatt cgagaactga natactacat 60

aggaaaakaa tgaaaaactg gcaatgttga catccacaaa a 101

<210> 46

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 46

tagagaaggg atstgatgta tacttgtata gtgatacacc atgtaaaagt naagttccaa 60

cttgtacatc acccttggct gagaccccat cggtggtggt a 101

<210> 47

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 47

ccaatcaaac gtaagaactg cacccagggc aatgcaatag ccaagattca ncagttcttg 60

gaatcgacak gttccaagaa caagaacaat gttccgtcca a 101

<210> 48

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 48

gtagattatt ttacatagaa aaaaggtttc atgtagcact tattgccata ncattcaact 60

ggaacacctg taatctataa agtaagctga agaagcccaa t 101

<210> 49

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 49

tcragtccat acccgttrga agcataacct ataagcattg agttccacag nacttcrtct 60

ggattagcaa taccactgaa gatcctgcrt ccattggcca a 101

<210> 50

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 50

tctcaatctg gtattcatag caattataya ttgccacaaa gaaaaaagac nagagattat 60

actacgttgc aagccaggtc cttccaaatc tccaagtagc t 101

<210> 51

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 51

aatcgamtgc agggctgtga cgcgtctgtg ctcctcaact ccaccgcggg naaccgcctg 60

tctgagatgg acgccactcc saacaggagc ctgcgaggct t 101

<210> 52

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 52

agaccctgac gaggctgtat atatggtctg aactatagat acatatacat ncatattcat 60

acactaatgt rctagaatwc acgccctgct gtctatcacg g 101

<210> 53

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 53

tgacagaata gccgctaagt agtgacaaac acaggtgaat agtgaagtag nggtacaggc 60

ttaccacgta gagtgaattc tcgatgcggt cgccgcggag c 101

<210> 54

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 54

gtgatgcaag gaaattgcta agagatattc cagaaacata ttcttcttga naaaaagcaa 60

ggaagcatac atgactagga ggaatgtgtt ttccgctcaa a 101

<210> 55

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 55

carwaaaggg ggtgaattca trtagcggtt aattrgtata tcaccacaag nggagaarac 60

agatcttgtc tcaccgagca wgccctgatg tcctggcacc c 101

<210> 56

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 56

ttaactctgt aatttgtggt tataaactag tcatattcga gtaaatcttg ntagtgggaa 60

gacacctctt acacttgtca tttgtacacc agagcactga a 101

<210> 57

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 57

tttgggctgg aagtagtccc agaagtgtag cctagggcga tgctctgcca ntcrtccttc 60

ggtggcttcc aactgaactc cgggtcaccr gttttcagaa a 101

<210> 58

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 58

aatcctaatt cacttgtgat tcctgtcttc ctgatctatr wtgttgttta naaacatgtg 60

attcctgata ttatgatcag gcgtgtgtaa aaatatgaca a 101

<210> 59

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 59

gtgaaatcta gtaacttcta gcccaccctg gggcacacaa gacgagaaac ntccggaagc 60

ccacaggcca caggcaggcc ctcccaycgc tygttataaa t 101

<210> 60

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 60

gyggcagcar agaccttagg garggatggg ccgcaggaag agaragacgg ncgacmgtca 60

tggaagggtc aagccatcag tggagctgga aggaagcgaa g 101

<210> 61

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 61

atgaagtcct gctgccycat cttgtgcctt tgattttgtg gagcgacyta ntttaaaagt 60

attcgttgtc tgacttttgt tgtttgtttc atcttgtttt g 101

<210> 62

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 62

gtccacattg agtatttgct tgcttgggtc atactactca gcactgctcg ntacaggcta 60

ctgggccaat caatgatcat gtgggcttat gggcgggcct a 101

<210> 63

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 63

gacacaggrc tkgcagcaga tttcaacaag tacaggaggg agaagctaac ngagaggcgc 60

tcatcgccct gaattctgag acacatttca caatcacatc c 101

<210> 64

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 64

atgttccaaa tttaatatcc tkrtgtttgt agccatatga ttaagcacta ngaccagtta 60

agaagaaaag gtgactcagc aagtaccagc agtggygagg t 101

<210> 65

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 65

tgccatatat cacagttggt aggctctrtc acaatggrta catcttttca naagaattgt 60

ctgttgctaa cccattgacc aagayccggt atctattgca g 101

<210> 66

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 66

caaacttttg aaggattagt acaatctcca tatacaaatt ggatggatcc ngcgtctgaa 60

atattctggc ttgctgtgat atcaggttcc ttaactgcta g 101

<210> 67

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 67

ttgagtacat gtttaatgat cttgaattgg ccttttgctt tattagcttc ntcacctgtt 60

cagaaacaag atattgacat ttcagartgt agaagggaat a 101

<210> 68

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 68

gttggcgtga attaaatatg ygtacccatg cagaccaacc gcacaacggc naggatcttc 60

cctgctgtcc tagacgtcga gaacccagag ttcaagagga a 101

<210> 69

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 69

gcttgttccc ctacccctgc tctagtgctc tgccawgttt tattctgttc nttttctttt 60

gtctcgtgct catctcgatg gttactggtg agctaagcgc t 101

<210> 70

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 70

gtacktatct ctgcttasgc ttatgcttat gcttgacgac gcaatgatat ncatgcatgt 60

agaacctygt gccggttgct gttgagggaa caaagaacgt y 101

<210> 71

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 71

cagaaagccc aacgattagc agcagagaga gaagctgcat atgcaccttt natttctcaa 60

gcgggcttgc cacagaggta wtttgctgtc atatatattt t 101

<210> 72

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 72

cttagaccta gagtcacgga ccatctgcat ggtaggcaat cacaaagaaa natgagacag 60

aragttaact tygagcragc aataaggtcg gtagtatgcm t 101

<210> 73

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 73

acagatcagt tattcatcat atatggatat aatgtaawca ctgcagaaat ncaaacatta 60

ctttgcatat agatcaggag ggtttgtatc cttggaattc c 101

<210> 74

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 74

gagggggcaa cggtcgagaa ggggttaggg cttcgggagg aagaaaagga naggaattgg 60

gggtagggac gtggtgtgat ttatatggag aggaaagaga c 101

<210> 75

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 75

rcagaggaag gcragccaac ycgtttccwc ggcgatcgay gaacagttcg ngagggtctc 60

gtaccaagcg ytgtcgaatg gaaccggtgg tttctcggag g 101

<210> 76

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 76

ttgcctcctg atgtcactgt tgaggaatta caagagctat ttggaggaat nggccaggta 60

tartttaatt ttacatcgct tccttttgag tgatagtaat t 101

<210> 77

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 77

tgtgaattcg atcataccga ygcggcgatc tctggcttgg cgtcgggccg nttctcctcc 60

ttcatcacct gcggcggcgg cccttcgacg acggcgacct c 101

<210> 78

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 78

tctgtttcct tggaacaggg cgagatcaaa attgccgact ttggctggtc ngtgcacacc 60

ttcaacagaa gacggactat gtgcggaact ctggattacc t 101

<210> 79

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 79

ggtgaggaag gaagacatat attagtacta acggtcggta gagctgtttt naactgaaga 60

ataatatctt ggtcacctac tttgtgctgg ctgtactttt c 101

<210> 80

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 80

cttaccgttc caacagctga cacgaatctg cgagatcggt aatgattctc ngattctgcc 60

attacgtcaa gcacgtggtg agcaccacgc gagatttatt g 101

<210> 81

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 81

atcttttttt ttcctccctc cctcrtgatg agaaacactt cttgcttttc nttatgctga 60

cgtcactgtg tgcaattgtt cactctgcag ttgtctgcaa c 101

<210> 82

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 82

cttctcaaac caatcaragg agaggcagtt gccataaact ccatcctaca nctccatcgc 60

ctcctcgttg acccagatgc aaacccagtg gtgcccgcac c 101

<210> 83

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 83

ctggaacgag ctggttatcg tgttgcacgy cggcgcaggt gcaagtcccg ngttggcatc 60

cagcacaggg tgaccaaaga agacgccatg aagtggttcc a 101

<210> 84

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 84

gagtttaaca tcccatccta tatgtgattt atcatttttt gtgcatcatg nttgacattt 60

taggggaagg aatgtataca tgcagttctc atctcaccaa g 101

<210> 85

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 85

aatctggtct aaatatcacg ctcatycctc tcaacgtgca gcggaaggtt ncttcatttg 60

agggcgtcct cggagctctg aagcaacaca cccagcatac t 101

<210> 86

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 86

gaacccgaag aacctgtcca tgatacygtg gaggagaaca aggtggctgc ngagggtgca 60

gttgtgggtg tctcagagga cgatggaaca gagcatggta a 101

<210> 87

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 87

cattcacaaa agtttgcatg cctaagaaaa attgaaaaga ttaagaaayc naaatttgat 60

gtgttacctg gtttttattg tacatgcaat cagaaagatc a 101

<210> 88

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 88

ggcagagggc catagcagcc ccccagccaa cggcacacac aaacgcgggc nagattcccc 60

ggctgccgag gtcggatgga ggaggagttc caagaagccg a 101

<210> 89

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 89

ttatgcttag gctctcaagt tggtccagcg tacgttcaag gctatgagct nrtggttgtg 60

agtttcyttt gggtggcgtg gcctcacctc tgacaatagg a 101

<210> 90

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 90

caatatgctg ttgtcaactg tttatctgag gctattgtca atgtcatacg nagccacctc 60

atctttatca tctattacca cctcagtctg tacgcatata t 101

<210> 91

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 91

cgctckcgaa ggccggccgc tttctcgact gyctggccct gctcgtggct nctgggagag 60

gaggccgcgc tgtgcagctc ggtggccgcg ccggacgacg g 101

<210> 92

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 92

atatttrtat ctcctttaat atgaatattc aagtagaaaa atgtaagtct nccactccat 60

gtttaatttt tgtattcaca ttttctccag gttttragag a 101

<210> 93

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 93

agaccagagt tattctcata tgaaatcctc gggaatgtga acagcgaacc nagctctgga 60

attgaaccat tcagctgatt atttgaaagg ttgatctccg a 101

<210> 94

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 94

agttggcgyt ggctggggac ggctcctcgt ttagagccct agtcgcagca nctgtttcgc 60

aagtcagaat acatatacgc cggtaatcgw tctgtttgag g 101

<210> 95

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 95

tgggttctcc actacatcag gcgcakgcgc ttttgcctgc tctgcactag ntgsagtggc 60

cttcttcgcc gctttcttct tgcggaactg ctcgagctga a 101

<210> 96

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 96

tggccagctg aaatcacrag catatcaata accaaattga tacactgtgc ntrtaggggt 60

taaaagraaa ggaaacgaat tctagcaaca aaaaaaagta g 101

<210> 97

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 97

gctgtttcca aacatrtggm agrcctygtt tacctgatta gttgggatak nccatgcwrt 60

grtkgttmtg atttgaattc ggaactttct acaatcagta t 101

<210> 98

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 98

catggctact tgcagtcyat gagctcgccg tcgacgaaga tgtggcagac natcytscct 60

ccgttctgag agttgctgtg wtggaakggg gaaragatga t 101

<210> 99

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 99

acccatggac tcaccgtgta cccatggact cwcctcgtga agatkgttga ngcargmttc 60

atgccgacgg cagccakccg ccgccgccgc tgatcgattg c 101

<210> 100

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 100

accacagaat gattttgagg gcataatgaa attctgtcac tagaacataa ntcccttacc 60

tgatagtcgy cggatctgtt ggygactgtc atttctatct a 101

<210> 101

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 101

acagagagtg gagagagagg acataattct atgagaacct cttgtttgtc ngtycaaawc 60

caaaagagag gtgtccccac gtagcctgat gacattatcy a 101

<210> 102

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 102

aacagcatat gataaataga ttaatatygg tcatgtctat aaggaatcac nagaaatact 60

aaaaaaaggg atatgrcagc aaataggtat aatagtcgtg t 101

<210> 103

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 103

tcatgagtga aggatctgat ttgttctcta aaacmmacgt ccarctcatc ngtryattct 60

ttcaatagyc ttcrttcrtc tgagtacatc tmtatctgcc c 101

<210> 104

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 104

tagrttccac atttgtttgt cggcttgtcg ccatgatttt acattttagt ntattatgct 60

aattgaatgt gtttgaagcg gaaattaaat ttggttrtcg t 101

<210> 105

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 105

gacccttsga gttaaagact ccaccaatta ctgcaggata tycgcgcacg ngattctacc 60

atcaatgaaa ccrcgkttaa attacaggag actgcagaag c 101

<210> 106

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 106

tgctacttaa aactgaaagc accacaagga tattatcata ttacatgtcg ncttgttatc 60

acaacagttt cggctcgatt cctttctact acctttgctg g 101

<210> 107

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 107

cgaagagcca tggggccatg gggaggaatg tccctggaaa ttggccctca ntctgggttg 60

ccagctcttg tgcccttttc ttttccttga tcctggacat t 101

<210> 108

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 108

aataaaaaaa tcccagatct tcgaacagaa atccagtata gtacttaatt ngaactgaaa 60

tccagtagta cttcagaacc gcaacactac aaagcttcca c 101

<210> 109

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 109

agtttgatta aaagaaaaaw tttacataac ttttcagtta aaatgaagaa nagggtccct 60

tggggacatc taatatatat aaacagaatt tgaacttcaa g 101

<210> 110

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 110

tacagcactt atgactccat tgtggacact aggatctcca gttatccggt ngtttgaaga 60

tgcttctttt tctccaactt yttcacctgy ttttcctttc t 101

<210> 111

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 111

gacaggtgat ctgctatcac cccrccaata aatgctccrc tggcacaccc natggcgaag 60

aggctgttca gtgctgctga gctgttgttg tcaaaaccta a 101

<210> 112

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 112

aaatcttctt tatactgaag atagagaagc atataatctc ttggagacag nctaaggtmt 60

cttatttgtg acaggrcaga gtagcctatc tttttagcaa g 101

<210> 113

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 113

acaaactctc tctaaakaga caattcggca gtaggtatat atgcatgtgt ntcatcagtc 60

actattggta caggtacact acgaacatgg catatatata c 101

<210> 114

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 114

ccgcgatcgt acatgcgctg gatctcttcc cggtacccgc tgagggactt ncgaggcagg 60

gcsggcgtca gctccaccac gtcccccatg ttgagcctcc g 101

<210> 115

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 115

gytatggatg ctagaatgga ttaagattaa ggagaactga tgtgatagac nttttcttta 60

acgttttttt ttatccctga agtaaagtca gtttggacgt a 101

<210> 116

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 116

catatccgca tatctgtgcr tttctagtgt aacaggtyga attacagtag nttgcgacgt 60

accagttgtg ggaatcaaag ctgttgttgc ggttgtctcc c 101

<210> 117

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 117

gagatcataa aggaagagtt taagtttatt actctcaaat aaagagtaat ntctgttcca 60

cgtgaaagca ttttctcagg atcaktttct tccttgataa c 101

<210> 118

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 118

ctcatgaaca ccggttgaca atggtgccag gctgccagca tgcatggatc naactcacac 60

tggctgtaaa aatagttttc gtgcagagtt ttttttytgt t 101

<210> 119

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 119

acctgagtac ctgacctgca taagcaaacc aacctacttg gttaacaata ntttgtaaaa 60

aagttagatg gtattgtatg acaagaagca cccctgattc a 101

<210> 120

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 120

gtgtttgcat gacattctct ttgagcttat atggggtagg tgccaaaaaa nagagattta 60

ttatcatctt atgacatcac aaatattttt ttgtcatgcg a 101

<210> 121

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 121

gtgtcgaatt cctcrtcaag ctcatctggg tttgcaacat cagcgtaaga natccttgtg 60

ttcatgtgtg gtgggaagcg yggscggaac cggtagttcc a 101

<210> 122

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 122

ggatccygaa ttatctacac ttgcataaag atacattagc aaacaaaaca ntgtgcatat 60

cttgctatac agaagtacca ataagtaagc caaacttagg c 101

<210> 123

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 123

taagaaactg atctccagac attcgaagga cgacccagac tccccatctg ncaaagagca 60

agttaggaaa gtcatttcaa aaaatttaga aaatgatgaa a 101

<210> 124

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 124

arcgsgtgaa tgaatcctga atatgtgtaa aatgcagttg ataaaataac nacattgtga 60

aacaaataag gaagactcag aatgacarat ggtatactgt t 101

<210> 125

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 125

tatcagccmt ttgttctcgc cacaaccgcc atattcacat atcacgaggc naaggtcaat 60

actagggtgc gcaacctggc aggatacacg ttgttcttct t 101

<210> 126

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 126

acatggtawt ttttaaccat ttmtgtacct tgttagtcat ctgagcctgg naatctgctg 60

aatcgtctct tggtttggca atcactgcac atgtaaatta t 101

<210> 127

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 127

tggcasattm gtcaatcttt cacttgacta gcacaagtgc actcatccaa ntataaacga 60

tgttctgcca tgccatttca tttgattgta tttgtatata t 101

<210> 128

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 128

ccttcacttg ttgagagttc cgcccctttc agcagtgcca gggctaatgc ntgtgtgtgg 60

aaaggcaaat ggatgtatga ggtgaccctt gagacgtcyg g 101

<210> 129

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 129

cggcgtctga gatcgcgagg ccgaggcttg tcccgtcccc gctccgctcc ncycacccac 60

ggtgagaatt ccgcgtgctc ggtwggcctg gctggtggtc g 101

<210> 130

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 130

acagggccta gmwgtagttg aaattatgaa acgatgacat ctaatcttgt nygacatgtt 60

aaattatygt acaagaaaag gtagctttat accgctccat t 101

<210> 131

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 131

agccatgagc aatagctaca agcctggaca agagtgagag agagagaagc nggaaggacg 60

gtgcagaaaa ttatgaagtg tcrtkttcct acatgggagt g 101

<210> 132

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 132

atgtctggga agttcaaaat aagcgactca gcagcatgtt gagcatcagg nacactggtg 60

gttcgtcggt gtgtctttgc ccttggggta gacgggcagg t 101

<210> 133

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 133

aaccccacgc ggtgggtgcc gtagtgctgc agcgcgaaca rgaacaccag natggcgcag 60

gttatcggga tgacggcatc tggcgaaggg aagaaattct c 101

<210> 134

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 134

ccgctactga attcttgctt cggcttctcg ctcctggtgg cagtaccctt ncctttggat 60

tccacatcaa tctcgtcctt gcctttcctc tttgaaaagc a 101

<210> 135

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 135

gattctgatg attctcctgg caggttcagt agtccagaat acaggcactt ngttatacta 60

tcaaggaacg ttmttgcggc ttctgtagca atcaactcaa c 101

<210> 136

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 136

gttattgatt agggcttact agacacaact aacaaatctg caccaagatt nattaaacaa 60

tcaccaggta tgcatctgag atgtcatcac gagcactgca g 101

<210> 137

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 137

actagagttg gagcaccrgc tctatctgga gcaatcgacg agatcccccg ngagtaccgg 60

atggyrtcgg tcagaacaaa cttggatacc catccttcaa g 101

<210> 138

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 138

ttagcacaac caggtctaag tcccactcat cagcaacttc cccgatgata nctgttggtt 60

tctgcccttc cccaagacgc tccatcaatc taaactccga a 101

<210> 139

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 139

gtggcttcgt ttcaggagac gggggatttc ttctcgccct tttcctcgcc ntgcggctgc 60

ggaataccgg ggccggcctg gatttgctcg agagtgagag g 101

<210> 140

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 140

tccacccgct tttgggtgtg tggacgatgc atggggrgag agagagggag ngggagagtc 60

tcctcctcct ccccgaccsg agcgccggyg ccatggaagg g 101

<210> 141

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 141

gtatggcagg aatttcagat atgacaatgg caacagcaaa caatgagaac ncgtcctttc 60

agtctgctga ggcgtctcag aggtatcaag ttaatgcccc t 101

<210> 142

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 142

taragttact tctacacatg gagctaatac attgggtttg ttcagattct ngctgccgtg 60

ctttttggag ttagcattgc cttgaaggac ggggccgaga a 101

<210> 143

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 143

ggtggaagat cgaagaagcg cacctgtcgt ggtcawagga agagaagatc nggaaaccag 60

tgggatggcg wwgatcagga ggcaacagtt gcagtgcctt c 101

<210> 144

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 144

tgggagtttg ttgcagcgcg cgccgccgcc acggaatcct cggcggactc nccctggccc 60

tataaaacaa tcacgggctt ccctatccct cttccccatt g 101

<210> 145

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 145

tactcagccc aaacacgctg tgaatcaata aactcactct cccatggctg natgtaacga 60

tacaagtttg gaatgagctg gtcctcttca tggctcatgc c 101

<210> 146

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 146

tggttgcttc aggcctgaga gagacccctc acaccttctc tgcagttctc ngtgcgtgca 60

acagctgcga ggggctgcaa ctgcatggcc gggtactggc a 101

<210> 147

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 147

tggaggaggt acatgtatat tttccctctt gatgaggatg ctgacttgat nttaggggaa 60

gcacagtcct caaaaacact agagaattct gaacacaaca t 101

<210> 148

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 148

ctcaaataca atagagaagg caggtacatt aaacyacaac tatgaaagta ngaaatcaca 60

ttggaaacat gtasygatgt acctttccta tgcaattaga t 101

<210> 149

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 149

acatcattat tttcaatctc agttattcat gagtacctca aggagagatg nggttacaaa 60

tgcatagcct gcacttgtca ttgaaaagag ctttacatct a 101

<210> 150

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 150

aggtagtgct tgtcctcatc tcaatgaagt attatgtgga aactatggtt ntcattctgg 60

agtgttcttt gcacctaaaa tgttgtgcac agttctttca t 101

<210> 151

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 151

ccagattcag agtgcctgtc actggtgtca gagaaggtat cagacccagc nctactggca 60

atgctcattg cctttccact tgatactgtc cttctatgtt g 101

<210> 152

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 152

tcggtgtctc sgcactgcag taggtgcaga ctgcagactt tcatcactcg ntcgccaggt 60

gatgagctca taaggaaaaa scaaaagcat caagcaagca a 101

<210> 153

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 153

tcattcgtat gytgcaactt ttgtcgagaa ygtgctgatc accaaktatg ntatccttat 60

tccaagggtg actacagtaa acaggtgtgt aaaattccag t 101

<210> 154

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 154

ttccaaatca aggggtagtg atccggaagg agactatgat ttttgtaagt ncgaggctca 60

agatcttatt caaggaaggt ggctatgata cttttgatcc t 101

<210> 155

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 155

ttgtttcttg gatgtcagtg agaactccgt cctgcaaaaa tggtcagata natgacattt 60

tgaaccaaca gaggtttgag gttatgtgaa gaaatttgac t 101

<210> 156

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 156

gccgcgcatg cacccgtccc ggagttygag ccaatcgatm ccggcagcga nctcgagrac 60

gacggtcagc cccttaaact ccctyccctc tgctcctttt g 101

<210> 157

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 157

atcttcaatt tgatagatgg gtccacrctt acccattgct gagtcagtag ntcctttttc 60

gcagaatcct ttgcgtccaa agaattctta aggataatac c 101

<210> 158

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 158

gaagcccatc agaaaaacag arcgaagcca atsgaaggac tggaggaggg nagtagcgtg 60

atagtgatgc cgtagtggtc gagctcgcgg cgragyagag r 101

<210> 159

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 159

aggggggagt tcgggctcat gcatacaawt caaataatgc aactmcttca nggaccggaa 60

atgtaaagay aaaggctcct gtggtatgag ctttgatcct t 101

<210> 160

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 160

ttgtccgccg gcagatctgg cgcgcgccgg cagmttgttc agcagagaca nagacgacga 60

aactgacaaa ttctgcagga gcttgccagt tgccagatac c 101

<210> 161

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 161

ctcctatcrt ccaagaagaa gatgctgtcc ttgaaccccg ggtactgact nacctcgtat 60

gacctggagc atcctcgccc caagaacagc atccggccac a 101

<210> 162

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 162

taagtttaaa tgtcaaacca gamatttcct tcattaaata tcacatctac natcctgtta 60

aaagaagttt ctcgtaccac aactacactt kcaagaatgr c 101

<210> 163

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 163

cgaamgggaa ccctggcaga cggcayctag gagacscgga gcgaaggaat nagagagggc 60

ggtaccttgg cggcgttgaa gatctcctcg gacttctgca c 101

<210> 164

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 164

tccccacggg ccgctcrttg tgtacctcag ccatcgatcg ctgctgtggt ncggtgacgg 60

tgagcggcgc tgtgcaggga gggggaaaaa ggagaggaga g 101

<210> 165

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 165

atactgtttt accatacyga taratgttcm atctgttaat actgatygtg nrattattac 60

ttgtcttggt aggctgggat tgcgaagaaa gagaacatca a 101

<210> 166

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 166

cagtttccat tcttkaamag ttygtgcaaa ccagtccaay gatatacatg ncattatttc 60

tgtttctttt gaattctatc tatcccatca gcgtttgttg t 101

<210> 167

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 167

ttatctggaa cacccctata tygttcttag cactcatttt aactgttaat ntggcagata 60

attatctata attstaacac acctcaataa tcctgttttt g 101

<210> 168

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 168

gcatatcata aataatgcca taatcgccaa tgttgctcag agtaacttct ntgttctgac 60

ccttcttggt cctatacttc aggaatttga ctacaccgag t 101

<210> 169

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 169

actatcttra gcaattatcg tsaattccat cttacgtgaa taattgatgt ngatatttgg 60

acttcagcag ttgggagagt aaaaggcaat cagtcgctca t 101

<210> 170

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 170

cccaatcaac acaccaaccg atgtgagtct tggccggctg gttggtggga nccggcggac 60

agcgtcgcca ggctgtgttc ccccaccctc cagscwgcct g 101

<210> 171

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 171

gtaacaatgc cttccgatcr accctrcyga ttcttttwtt tggaagacat nagtcataay 60

ttagtgtaaa gcaatcttgc tgaagaaata gtcacttgag t 101

<210> 172

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 172

cgcgaagact aggccacaca gaagaacaac aaacctaatc acacgctagg ncgatttccg 60

cgaataaata cacaggcacc gagccggaag caagcccgcg g 101

<210> 173

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 173

cggcgtggtc agcaggccgc cgctgacggg aatcatccgg tgctccaatc nccatttctg 60

cctgcccgtg grycggaatc aatmaaaatt ggatcgaatt c 101

<210> 174

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 174

atagatcgaa caaacccaar aaaawcgcaa gwacaaatgt ttggacgagg ngcaggaaaa 60

acacaagaat tggatawgag ggaggttttc atgaggtcaa c 101

<210> 175

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 175

aagtatgaca taggccacta atacaacaca attttctttt agcaaacttt naactgacat 60

aagatgtaca tacatgttca gaattgttag ccttatcctt c 101

<210> 176

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 176

actcttgtgt ccaatatctc aatttcctac tcccttttct gcttatactg nccatgctat 60

tgtgcactag tgcactgaat attttatttt gcgctcaggc a 101

<210> 177

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 177

ttttgccttc cgactgtagg ttccaagata tttggaagct ttggatcaga naatgtgaga 60

tttcctatag gagaaaatgt tgttttactt gttctgggac g 101

<210> 178

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 178

ttctgttcct gagcaattca ttgacgttta tgatggtatg gaattaccag ngcttatamt 60

tgtaataaaa ttgtactccc tccatttttt atttgtcgcg t 101

<210> 179

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 179

tcttgtgagg raggatgttg atttaaggaw tctattctrt ggagaaacaa nccgcatgtt 60

gcaaraacag ctcaaactac tgaacckcag cttctcaaag t 101

<210> 180

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 180

taatctaagt tccaacakaa aaacttcatc ctcagtgctt tcccaaactt nagcacatga 60

tgaacactgc attgtagaat ttgagcaaat ccaggatttg t 101

<210> 181

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 181

gcctccgcca caccggcggc cggtgaaccg agccgtggcg ccgactgccg nggctcggcc 60

gccgaggacc ccataaggag agtcatgttc ttggctccct g 101

<210> 182

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 182

tgggttgacc ataatgtttg aatgaattca cagctcgaca aaactgctca natttcacaa 60

caaaaacgac aagcatggtc acgcttcaac tttctatatt k 101

<210> 183

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 183

ccagccaata tatttttcct gttcrgcgtc atagcagtgc tctccctcgt ntttgtgatc 60

ctcgtcgttc cagaraccaa aggactgagc ctggaggaga t 101

<210> 184

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 184

tgacatggag gagttttggg tcaagaaggc tgtggctcaa ggactggttg ncaatggtaa 60

tgagcaggat gtttggtgag tkcatcagct tgtgggactg c 101

<210> 185

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 185

aaccatgcaa tgacatatat gttcacactg acacaaaatg caaacagcca nctaataggt 60

tcccttgatc ttgcatgaca taatttgtaa ttacactgat a 101

<210> 186

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 186

ttatactaca aaacagcaag acacagattg gccaggccag cagccatacg ncaagtacag 60

ccacgacttg attaaatctt acgcatatca cagcgccatg a 101

<210> 187

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 187

tcttgttttt tttttaaagg gagagagart tactcttgat ttcacaayca ntgatcgygg 60

tgawaagata atcgtgagyt caactccgaa ctccataaat c 101

<210> 188

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 188

tggttcatct ttcttcttga crcacctcgt tttttatcct accaaatgtg ngtgtatata 60

watmtttcca ggctcgctac ttcttccaac aactcatttc a 101

<210> 189

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 189

ttattttatc tgtgtactct caacgtagaa caggaaatgt atgtagctag ncgtggtagt 60

gaatggaaat atgtaatctt actgctgcat acttcagaaa a 101

<210> 190

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 190

aagagtagca aatattttga tcacatcata ggcacatcac atcacawtat naacgaacta 60

atgawtcrat ttacatgagt cggatgccca agagaaaaag c 101

<210> 191

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 191

mtgacatttt aattgttrgt acccgagatc cggaaaatga ckggaaccga ngsrccaatg 60

gaagcgtcta tgckgragac ctgatgtagt traagttatt t 101

<210> 192

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 192

taccattgst acmaaataca cgagaatagt aggygcaata acaccacatt ngttatacta 60

gttagctttg cgacwgtaag cttattgatt gcaacgatgg a 101

<210> 193

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 193

atggccatta aaatgctcgc atgaatgttc aacggaacac gtaayacagt ntgagtgaca 60

tcattaattt gctaccaaca gaaattcata tattgcattt a 101

<210> 194

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 194

gacatccatg gagaggatgg kgcaggtgag agatggggaa ccgagggact nacacgacgg 60

cgccggcgac aagggggaag gagagccgca tcctgattcc t 101

<210> 195

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 195

atccaggaag ccracgaatt cttcaggagc atggaggccc agatcgacgc nttcycgtta 60

ttaggtgatt atgtttaact aaactgagtt gataatcgtc t 101

<210> 196

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 196

caagatgaag atgctgyaat tgcagcagta attgatgctg ctgaactcaa ntkgtaagca 60

taycacattc tcctatttts acaaaacggt atggttttts t 101

<210> 197

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 197

gaccaacaga acaacacaga cacacagcgg catttcagtt tcgtttcmga nwaaggaagg 60

aacaaccccg rcccacamgg cagaaactgc aagcgtacag a 101

<210> 198

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 198

ygaagatcaa aatggactac tcaggaaaga tagaaatcct aayctggaac nccaacaktt 60

tggaatggta cgtcctgswg gcasagccta tgmatgaatg c 101

<210> 199

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 199

tctgtttgca ccttgggagc cttacctttg tacaatgttc tgtggtactt nagccacaag 60

gacttgtatt tatatttgtc tataaacatc tctcttttct c 101

<210> 200

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 200

cattgatatc aaatagttgc aaggctgttg ctattcttgc agggcacaca nctgaggtct 60

cggtgcttgc atatgaatat ggtcgaaacc tggtttgtaa a 101

<210> 201

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 201

aaygctcgtg taatggtcct ggctgctaca aacaggcctt ctgagctaga ngaggccatc 60

cttaggcgct ttactcagat atttgaaatt ggaattcctg t 101

<210> 202

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 202

ygcttaataa aatgaaaggc gtgcatcata tccaaagtaa gcattctcct nwgagttycg 60

tgtcattcat ytctgtgaca tgatctttgg tgctgggcag g 101

<210> 203

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 203

gccatcatca cgccgtaagc gacctgcttg ctatcacgct agctaggcct ngctggtgtc 60

aggacwcagg aataggraga attctgctcg ttctgggatc t 101

<210> 204

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 204

aaaaccataa agcgcaagta ctccaaggcc caccaggcca ccacgagggc ncattcctac 60

tgttagtttt gygaattcgg aggcrcagcg ccaccwactt s 101

<210> 205

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 205

tcatatagat cccccatgtt kacccagagc tacargccct acgtgmcgkg nccggcaggc 60

atctcagagt gcacgatgtc gcggccgscc gtcattcact g 101

<210> 206

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 206

caatcaacct gatttcttat gtgcttcatt tcatgatmaa taaaaagats natcaatcaa 60

atggatgtaa tgagtaacgg tgagtcataa taaacaaagc c 101

<210> 207

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 207

aattgcagsc ggtcctgcac ggcgaattgc agccagtcgc ccagtgtgaa nttctgaatc 60

cttcaaggtc caatgtctga atggagctgc caagagcatc c 101

<210> 208

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 208

tggcagtggg tatcatgtta arataggagc tacaaacygt ctttgagaaa nagttttggt 60

ttagtctctt gcatcgtttt ggtctccaag ttttgcctcc t 101

<210> 209

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 209

catggttaaa atattgrcat ccttcggctt caaacagaca aaaccccaat ntgaatccag 60

acaccaaatg tggtccagag tacaaggaga atcacgyaag a 101

<210> 210

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 210

gagctgacct gtacccaaac ccggcctcac gaagttcctg ctccgacacg ngcgcgagcc 60

gctcgatcgt ggggaaccgg tggaacacga asccaccaac c 101

<210> 211

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 211

atgtttgtgg tgcagggaat cggcaggctg ttccgatgct tatgcaatcc ngcttatgat 60

gttgatgatg attttgagcc ccacaaatga gtcctaaaga g 101

<210> 212

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 212

gcggcagcta accgcgcggg caagatggct gcagggcagc gggcggacag nggsstcgga 60

ggaggacgag gcggcggtcc cgtacgtgga cgtgcctcgc s 101

<210> 213

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 213

acacctcctt cgaaatcctc ctcctcctct tcctcctctt cttcttcytc ntcctcctcc 60

tcgcsttcct cttcctctag aagagcatcc tgtggtcctg a 101

<210> 214

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 214

caagagacga ctaggtcatt tcattatgtg tgcggtrgtt ggatcatcta ntcaacttat 60

tactagctag cgttcgcaag aaacaagaaa atggagacga c 101

<210> 215

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 215

caacacgatc ctcgtcccca acaagtcagt ctgttatttt atttacgcct nttacgaatt 60

tcacttgctc tgattagtga ttacttgaat gtttrgtttt t 101

<210> 216

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 216

atagcttcag agcctaaaag ttgttamaay aatagggaaa agaagtgtca nacttctgtc 60

actagaattc aggcattgct ggagtcaaac attaagcaac a 101

<210> 217

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 217

gcaacaaaaa aatagtgaaa agggatcccc ccccccaaat aatgtataca ngaaacaacc 60

ttttaagaca gttttgtagg aaaccctgtt agtaatctta a 101

<210> 218

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 218

gatgkataga cctgcaacac actaggaatt caggatatgg tataattctc naasaacgtt 60

ttgcacgtat agaactctgt awwcttaaaa caccaatcta a 101

<210> 219

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 219

ccgagagatt aataaactag ctgggacgaa accggaaatt aattcatttt nagcagagaa 60

gagatagatg atccctggcc gattagggag acgtacgctg c 101

<210> 220

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 220

ctccccctcg acgctactct ttggagtgaa gtctgactgc tggttggcct ngttgctggt 60

gggctgttca aagaaagagc tagggatctg gatgtcagrc a 101

<210> 221

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 221

ggaattcaga tcaggatata tgaaaccaaa ggtatmttgc agagaaaygg nccgttccca 60

cacattctga accagatyct ctcgtgtgct caraacgaga a 101

<210> 222

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 222

tagackactt gcytttcttt gaggtatatc aagttctgat gaatggcctg nactgccact 60

tcaagtttcc gaagctctag ttctacaccc tgcacaaaag a 101

<210> 223

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 223

gctgatccgt tccggctrcg asgatcgcag gtgtatgcga cgatcaggac ngggtccatg 60

gcgattgcgg cgtccacgct cgactcgttg ctggatttca t 101

<210> 224

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 224

tatgggttca ttctctgcta attccaaagg caagggaatt cttgtggatg nacccccacc 60

agcaatttgg gaacggaact gctttaaatg caactgatca g 101

<210> 225

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 225

gagactacaa aatcgacagt gttaaatgac tcttgctgtg ctgaaaaata naaggctgat 60

gcctgctcaa gatctgtatg cgacacatct acagatccat c 101

<210> 226

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 226

tagtacgcat ggccagcatc attcttggaa atgtagtaat gttcgatcct nggtaggatc 60

acctgmttaa ttccatgttg arctgcgtgc atgcaggcgg c 101

<210> 227

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 227

ttccatttcc tacaagccag caagataaat cagccttaca gataaaatat ntctccctta 60

tcaatgtaaa ccttgaaaaa aaacccacct catcaagagt g 101

<210> 228

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 228

tgtcttgcat agtcaagaat atccttttcc tgtagttcaa agctttggat naagatacat 60

tatttcagga ggtctgagwa amcraaacat tgtagatacc a 101

<210> 229

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 229

gtcaaccgaa gctaacagcc taacactagt tcactgactg atcaatggcg nggcaggtgc 60

ccatgctcrc taatgctgcc tctagagcgg tagaaggagg c 101

<210> 230

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 230

tttgtggaac rcaattcaca tcgatgcagt agaaccggat tctgcatatt nagtygtaac 60

agaggtcatc aatttgtcaa aataaaataa aaaaacaaac a 101

<210> 231

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 231

acattcatct ctgttaacca ctccttctgc ccctggagaa agatcrtatt naattagaat 60

caaatcatac aggaagctag acctagattc cagcatacgw g 101

<210> 232

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 232

tgctatgcat cagagaggag gaacattgta gctaggctac caaataaata nttctcaaag 60

tcttttgact tttgatataa atccatggtt ttgacttttg a 101

<210> 233

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 233

cgatggatgt aatgctctct atcgggagga acaccaacct aatccgagaa ncatctgtgt 60

cagtactgaa gcaaatttaa tcatgccatg caactgcatt t 101

<210> 234

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 234

agtgaaatat ctttctgctt ttgcatctga attattgggc cccagattgc nattggacca 60

gctacccgaa tcagctatca gccaatctac aaatgtctgt c 101

<210> 235

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 235

ttgaggtagc taagctcgtc tgtgtctcta tttccaaatc cagcataaaa nggatttgag 60

tcgtgtggaa ataaatcttt gatggcctgc aaaggacaga g 101

<210> 236

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 236

tacaattgca ggaagtggag aaatckccag agcagacacc aagaacaaga ngggaatggt 60

acttccattt acaccattgt caatcacctt taacaatatc a 101

<210> 237

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 237

gccgcggtgc tcgccgaggc catctcctgc tgcttgttga gcaacgtcga ngaygcatgc 60

rcttgtaata agaccacggc cgaatggctc gtccaggaat t 101

<210> 238

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 238

atacagttgc atggacctgg ggcaagaagt gtagarcttg accttggtgt nagccggcac 60

aaagaaaacg tcaccttcct tcgcctttgc actgccagtc a 101

<210> 239

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 239

cttgtcagat tttattgtgt tccaataagt acctagacaa ccgaacaact ntgtatggaa 60

aagaaaaggt ctcaggactg ttagcaatgc ttcctattca t 101

<210> 240

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 240

ccctcctcca gagccckgct gcgcctctgc gccccttcgg ttcgatcgtg ncagagccct 60

cgcgattgtc agggaattcg aggagcgggt ttggttttgg s 101

<210> 241

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 241

aatacagggt gcatatcgag ctctcagtga atcaccactg cagctaaaca ntatacctct 60

aaaccctaay cctaaaacca aaaaatamag ggtgcacaac c 101

<210> 242

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 242

gaaaacgact atactgattc agagstataa atttagtgct sagaaactga naasatcgcg 60

ggacaagttt taaactgyag atgagtatga tagtaataaa a 101

<210> 243

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 243

tttgatggtt atcatcgctt gtattttsag gagagtgagg aagaggtaay ngataccgag 60

caggcagaaa actggttttc cttaactctt cagctcagcr c 101

<210> 244

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 244

tcagcaaact cacaaatatc atcatcatta catcgctgat cccataatgg nctggtgtct 60

gataacttgt aagaattcag attgcgtagc ttgccagggc g 101

<210> 245

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 245

ayggcgcggc gagctgaggg agcgacgcgg ctgggctgag argagggaca ngygcaggag 60

ctgggagctg agcgtcggcc tgctggaygy cgckagggga a 101

<210> 246

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 246

tatgtacatg ccagatgagc agggtgatgt acacagaact aggtttttcc ntaggcatat 60

tatatggttc accacgatgg ttaacagagc cgtcttccaa a 101

<210> 247

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 247

tctgggacat gtcaagggaa caattttgtt caaggatcac aaaaaacaat nttgctgcaa 60

gggaaattat tcctttcttg cagtattact ggcctacacc t 101

<210> 248

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 248

tctgttgtca ataagagtat gygacataat aaggactaar aaggaatcca nacctgcata 60

acaaggtcga attctgcaac atttgcttta tatccattgc c 101

<210> 249

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 249

acggccacgt aggattctcc agcaacatca tttgctaaac tatccacttc ngctagacag 60

gaaaacacgg tacaaaactt cttacataat aatgtcttca a 101

<210> 250

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 250

tagagtgatg gtttcatata tagacacaga accctaaccc taatgggccg ncakcycaac 60

agtggtacca gcccaactac acatacaata aaagagcaaa c 101

<210> 251

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 251

gagaagatat ccagcattgc gacaagaatt ccccagaaag ataaagcggc nwagggaaag 60

gctggggaag ggatcaaacc ttgcagattg gtcgctgtgg a 101

<210> 252

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 252

agaatgatct gtcctctttt tctccatttt cttttttcty ttagtattac nctgtattgc 60

ttcgcgtgta atatgttttc ctgtaatatc aagtgagggc g 101

<210> 253

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 253

aagagagagt gtaatcatta aaactttctt atcctaacat tgagcagcct ngagataaaa 60

ccaaatggga aaaaaagatc attaggacga ccacctcatg c 101

<210> 254

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 254

agagaaaaca agcttacttt taaatcccgg tggtacacac ccctgctatg ncaataatca 60

actgcattga ttaactgttg gaagtacctc cttgcctcgt c 101

<210> 255

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 255

gatgacctac ggccacaaca acacgctccg atgtgtcatc tggcaactcc ntgagcagtg 60

cctgccaygc atcctcggac cgagsccata ctcgctccag t 101

<210> 256

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 256

gagttcctga tgtttccaag agagctgcaa ctctctgggg agtcagccaa nctaatgaag 60

cttggggaag cagtttcaaa ggttagcaat tgctggcaat t 101

<210> 257

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 257

gacagcagcc catgcgcaag ccaaaatggg aggtccacct tggcgccctt ntctacctgg 60

atataaaaaa gaaactcaga ycctctttta tacaagcgaa a 101

<210> 258

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 258

gactggccgt caaaaggcca aagaacagaa taacacaatt cacatggtat nttttcaaga 60

gctctagtga caggccaaat tcttcaaacc ttttataaag a 101

<210> 259

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 259

tcgtgatggt gtacgaaaaa atgtaagttc ttcrttayaa ttagttcata nattgccttt 60

tgtgatcttt catgttctct ctgctgttct atttctttca t 101

<210> 260

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 260

aattaaactt ctgccacaga caccactcca taacatattt gatcatgctt nrgaaaatat 60

agagtataat atgtatgtag tcccattcta aattcagctt a 101

<210> 261

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 261

ggyggtacaa acaaaggagy gtcaggggtt gagggggagg ggtaagagtg nttctttttc 60

aaggaattac atgagctagg gaattcatat tcgagggcta a 101

<210> 262

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 262

ctggaggacc agccrttgta tcatatgcat gacatggtct cactttacct ngagaayaaa 60

acaaatratg cyactcgtgc tcttttatct gattccattt c 101

<210> 263

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 263

ttgagaagca gaattcagga tggattgcag cacagcaaga rttaaaggaa ntggcacaaa 60

tggcattcaa ggataaagat gatrtcarra atacaatcaa t 101

<210> 264

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 264

acgcggtttc gtcctgacca ttgccatgtt gctttcttct trgacckgtg nttggttcca 60

ataattaaag tttagtgtgt attatatgga atgtttgaat a 101

<210> 265

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 265

atgaagtccc tgtcagagat ggttgatcca tctatccgag gagagtgttc ngtgatacta 60

ttgtcatgtt ttgcagacat catcagtcgg tgtattcagg t 101

<210> 266

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 266

gcaaaaccat ttcaacaatg gaggtactay rttaagtcac tacctagctt ngttggctga 60

aattcccaca atacatcttt gtcaagggca ggaactgaaa c 101

<210> 267

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 267

catagagaaa ctgtttctat atgtagtgta atattctgrt tgtttggagc nctkctatgg 60

aaacatcata yggwtcaaga acwatatgat caaacactaa c 101

<210> 268

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 268

gaaccctgaa tcgagggagg cgaggagggc agcggaggag gggcgcggac nggaaggggg 60

aggcgttata taaagggacc aggccacagc ggcgaggagc g 101

<210> 269

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 269

ttcatgaaca gcatgcctat caaccttgtg tccatctcgt tccatmtcmt ntttaagtga 60

actcttcttt ggaagaycct gatggcaaar gaatgtgaag a 101

<210> 270

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 270

ccactagcag aggtgtggaa tggagctatt tgctttgcag taaattgaag nttaaaaagg 60

cttgtagaag taattagatg tattccttaa tgcatctgcc a 101

<210> 271

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 271

ccagtgaaaa tgcaargaat tctccttggg tatgttgcca tagcctttac ntatgagtaa 60

gacttttact ttgttgcatc cttggggcag caggcagctt t 101

<210> 272

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 272

gaaaatcaat aackgygttg acatacccag tatggaattc atgatggaag ntctaacaac 60

acatcatgtg cctagtgagg acatggcact tgttttatac a 101

<210> 273

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 273

gatcttgcta gctatcttst accaaattat ttccatgtct gattgatttc ntcatttttc 60

agaggttgca aagaaggctt agacaagaac agatcttttt t 101

<210> 274

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 274

caaactgggc ttcaatgtga acckggtgag caatgcgtgg araccatggg ncaaatgyct 60

tagcaagtta ccaatgcctc gggttgccgc ttgtygcaya c 101

<210> 275

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 275

gagattcagt aataaacttg ttcawaccag kaaattttgg raaaccaagg ngagtgcggt 60

tgacagatct gccagaatct agcagttgaa ttcaaaaaaa a 101

<210> 276

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 276

tgtgtgtcgc aacgctctca aagctgagac tgtatgtgta ctggtgtaat ncacttgtca 60

agatgagcac gtacgaactg ttctcttggt atccctcatt t 101

<210> 277

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 277

catccatatt ggcsaacagg gcatctgtac gtgaagagcg acgtgtacgg nttcggcgtg 60

gtgatgctgg agatgctgtc ggggcagcgr gcgctggacc c 101

<210> 278

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 278

tccacctttt tgctgscttt ggaaccatca ccatcttgct ctccttctgc nccgccttcc 60

tccgcctcag cttttgactc gtcgaactcc agcagctgca t 101

<210> 279

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 279

tacgcctccg agtggaacga cgacgagaag agcaagggac tccatagcgc nagcctcaag 60

ttcgccgaga acagccgctc agagcgcggc aagcgmaacg t 101

<210> 280

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 280

ttttcctttt cstttttatt tttaatttct tggttcggtt cttgatcacc ngttcttcct 60

tatccaggaa attagattat caggtgcttc tatttgtttg t 101

<210> 281

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 281

accggccaga cagcagctag ctatagcyct aaagattgcc ctgacctgat nagatgatat 60

gagctttttg caagatggtg gctatagcag ctagaktagt a 101

<210> 282

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 282

atcttccaaa gaagaaggaa gagaccatca ccctaaggcc gctgagcatg ncagatctga 60

aggaagcaaa gaaccaggtg gatcyatgcc ttaccaagyg c 101

<210> 283

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 283

cggcccgttc tttcccatca tttggggccc atctgagaat tctaaggccc ntcccgccgg 60

cccggctacc agcctactca ggcccttcaa tctcagccgt g 101

<210> 284

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 284

tttcgcctgt gtgtggaata aaatacaaag atcaggaccg cagaagtttg nagcagaaat 60

ggagtcagta gtgcatatga tggatgtata tgatgtttga a 101

<210> 285

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 285

gatagctgaa caaatcatgc aacmacaaay aaaacacacc aataactgaa ntatctaccs 60

caaatttaaa tccaggtaac attatatagc atgatacaat a 101

<210> 286

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 286

aacagtgtts tttggcaatg attattygag tgtatcttcc atgcttactt ntgttttaat 60

gctatgcagt tgctytagca agaatactgt ttcctatgga g 101

<210> 287

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 287

cggatcatgt argtcgggtc gatgtacttg agrgttatyg ggaaacgkgg nttcttcttg 60

aaatgatcct gcatgtcaaa gaaatgggat aaaattcagc a 101

<210> 288

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 288

attcaagtta tctgtgttac tgatggtgag cgaatcttgg gacttggaga nttgggttgt 60

caggtatgat tgtctcgtta gtttcttatt acttgagggc c 101

<210> 289

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 289

csgcacrccc agtctcgaag gttcgccaca gcccaacgtg ttcagcgagt nccccgtccg 60

tgtttcccag acgtggacct ggccgtccga cggcactccg g 101

<210> 290

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 290

atcacaaggc cggaatgccg gactggcatg ttctattacc tgacaatgga ntgtcatcag 60

caaaattagc ctttgacttg agtcccccaa cttgttactg a 101

<210> 291

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 291

cacatctgtt taaattttct aatggaaaat gacttatgca catatctcca ngttcaaatt 60

taggaagccc tcgrgtycgg ggagatgagg argaggatgg a 101

<210> 292

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 292

aaaaatttta agcttaggta tcaaataggg agcgcacata gtckcacttt nctgtactca 60

ttttcaacat ggataccarg aaatgtawtt tytctctctc t 101

<210> 293

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 293

aactggtcat catgtgscag gtacccacca cacggtcgac gaaccgtggt nttggaggat 60

ggcgtgcaat gggacagggt gagggcaccg cctgttgaca c 101

<210> 294

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 294

attcagaaac agacatttga tcgracagct tcatcgcata atctacaaat nycaaacaat 60

atggctgatt cccctcatgc atctaaagac atgtcattat a 101

<210> 295

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 295

cccatttgta gtagttccct ctgmaagaaa tggaaagcga aaatcaattt nttcaaggga 60

caaaatgaag gaaaaaagat tgcatagaaa taagaatgct a 101

<210> 296

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 296

aacattatca caacctggta acaattaact gcaataaagt aaggagttaa nacgcatact 60

acaattgcgc ctcccaataa tctagttagg gccatgctat g 101

<210> 297

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 297

gatagaggat gtgagctaca amacttgaag gtcaaagtga catctggtat ntttctataa 60

ctacgatttt atgtatgtat gaagtgctgt aactctttct c 101

<210> 298

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 298

gtgctgtgta gaattttcag tagggaaagt atygtacacy gtttctattt ntaagcaatt 60

attttcaaga tccttacttt taccttgacc aggttcaaca a 101

<210> 299

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 299

tgtttctact tacattctct ggaccatact gcatcttttt tcyycctaat ntatgtacat 60

cttcattgtc atggttaagt cagatgcctc aagggcattg g 101

<210> 300

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 300

ttgccgttgc ttgggcgttc tcgcttctgt agtgcgtagt tggattcact nactcaatac 60

atagacattt atatatctga aatattaaat agacatttta t 101

<210> 301

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 301

ccgtwctttg tctgtcgctg gcggtgtgtt tcggtatgtt atttsagtyg ntcagatctg 60

ttaaaaattt tgtgagctat gcagttcagt tcagctctgt t 101

<210> 302

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 302

aaaggactaa aacatcrcac ctttctaccg ctttcccmaa ttccccaacc nctaaacata 60

tgggtcgaca gagatccccg gaattccatc caaaaacctt g 101

<210> 303

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 303

agaacttgct gccattctgc aactaaacta atagataatt cacttgctag natataaaac 60

taaagcacct gatattgccg atcttggaac actatctcaa y 101

<210> 304

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 304

aattaggtac ttaataaaar tgaattcatg acgcagtast acagaaatas ntgttaatca 60

ttgaaatgta ttttggacta tttctcgaaa cactgtaagt t 101

<210> 305

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 305

caggtcaagt atacacaaag taatagaaag gattctgttt ggcgtgtgtt ngattaagaa 60

atcgaaatac tagcaattag tacaaatgaa agaaacacgc a 101

<210> 306

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 306

gcctgatgaa cttgagcttc ttggaccatg gcttcttctc acaggctgcc ncytcctcgg 60

cagcatcact rccagtggat atgcamtcat ggaagtagta c 101

<210> 307

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 307

attatgtttc crgtccatcg ratcttcggg tacacgtctc agaagttytc nttgtggaaa 60

tggaaccggg ttgtggttgt ctggctgaat tctttcgaaa g 101

<210> 308

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 308

taagttatcg cgcagtggcc atacaaaaca cagagcagct tccttccatg ncacaccgta 60

tactagacaa accgtacatg catataaatg ggactgtctt c 101

<210> 309

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 309

ttacttattg gtatactgaa yctgggtaca gcgcggggag accaaccagg nactgttcca 60

tgctgccacg atatatagtg ctagtatcca acacggmaac a 101

<210> 310

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 310

ctcagtgraa aggcttgtca ccactgcatc aggcctgtcc ttctaacaaa ntacagtata 60

tatattcata actgattttt caacgaaaca tctcaaaatg a 101

<210> 311

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 311

ggaagcttct gctatgctaa gttgatarag ccaagttaag ttcyggcacg ngttaaacca 60

agctgattca gggggggttt ctctcaaagg aaaatcaaca a 101

<210> 312

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 312

caytgccgct tgacacaact tgttyagccg ccaaagaagc aaatcttygc ngcctcctgy 60

tgtcgcttca ratgcaagct cgcaaccctg atcaggcaac a 101

<210> 313

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 313

cctctcgccg ctttcgtcac cggggctctg agcggcctct tcggcatcgg nggagggctg 60

cttctgaacc ctgtccttct tcagatcgga attcccccgc a 101

<210> 314

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 314

agcttgcaat gtgtataata tatctacctg tttcttycca cawgttgcat natacaacas 60

gttcatgctr tgttattgct tcagcagcag ttgctagcta g 101

<210> 315

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 315

ctgatagcac ctgtgtataa agggaagttt ctcatggctg ctagaagatt naggcgtggt 60

ccccatactg agtacattat atctcttgat gcagaggact t 101

<210> 316

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 316

gccgaggatg cgattaaagc tgctgtaaaa gactacgaag ccaagaagtc naagatgggg 60

cagaagggtg aagacagccc ttcasagaag gctgctgaag c 101

<210> 317

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 317

agaattcttk cytatcattt tgcaacmtat ttcctccktt gcaaattata ngtcattata 60

gcttttytmg atacatgctt taactatgta tctagtttca a 101

<210> 318

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 318

gatggccgag cttctcgrac taggtgcaaa gaagttcggc atcaagcctg ncaaggtcct 60

gacagttggg ggtgctgaga ttgatgaggt ggagcttatc a 101

<210> 319

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 319

ggttagttag tcagttaccc tttcccaggg gccaaccctt cagcagctcc nctggaccca 60

catgcaacct cagcctgtag taggcacatg tcgtcasaga c 101

<210> 320

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 320

gattattact tctgaccagg ctaacttttc cacttgaata acaggaaccc nctttacctg 60

tttgccatat ttgtgatkta tctcgttgga aaagccattt g 101

<210> 321

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 321

ttygacagct ccgaaacccg tggacaaaaa actacactta agaactagtc nacaacaatc 60

rcgtctgttt cagaattcct tgaattaatc tcttcatgaa a 101

<210> 322

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 322

ggcaagtcgc cgctcatcat cttcgacgac gccgacgtcg acatggccgt naacctgtcg 60

aggcttgccg tcttcttcaa caaggtatgc tggcattgca t 101

<210> 323

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 323

aaaaggcaga agtaaaaaag atataccttt ataagcatat ctatatctcc nccactttga 60

ctaggagagc caatatttgg aataatatca ctaccactat t 101

<210> 324

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 324

taaaatgttg tgatgacata agggtgttcc ttttccattt agtatggcct nctgataaaa 60

tttctatctt attcaaccat tactcttgga attcagatat a 101

<210> 325

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 325

tcagctctct tattgcaacc tgggaccggc cattccttca attgacacta nctgctttct 60

cttttaaaak acagcaaatg ctgcttgaac tgtgatgtga t 101

<210> 326

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 326

saactgaagg ggagaaaaca acggagcgag atgcacagaa ttaagtaaaa nacattactt 60

ccaaagcatt ctttattttt ccactaagct ggttgacaga a 101

<210> 327

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 327

ctaataatcc tcactgatca ggcacgtgtc gtaggagaag agctatcctg nctgtcgtct 60

ctttatccca ggcataggca gggatgcccc tgatcttgac a 101

<210> 328

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 328

aagtgcttct gcagttctgc tagtgcccct cccgtcctct caatcttatg nagccatttg 60

gaccaatgaa tagcaatgtg caggtcaaca gtcaaatctt t 101

<210> 329

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 329

tgcagcaata acttgaagcg gtgtaacata gaagacaatt gctgctacca nacagaacag 60

gacaaagact gctgtggcac gagggtccct ccagctaagc a 101

<210> 330

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 330

ggatgtaatt ctttcagctt cagtacasac gaattcaatt ttaatcatgt nttatcagca 60

taaaacagaa agttagctca gctgtgaact tttagttttg t 101

<210> 331

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 331

tcatcgtcat catcgaaagc tatttcgctt ggctgatgag cggcaaccac ngaagcagtg 60

gcagcctctg ctttcctcat tagcgaattg tattgttcaa g 101

<210> 332

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 332

attgtttgyg ttgcatattg tatgtgacat accgacaagt ttctttattc natgtttttg 60

acaaaktcag tttttcgtgc aggaatgctt caatgcttgt g 101

<210> 333

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 333

aagtacaggt accttcacca tattgtacta ctattggttg ctcagacgtt ngagtttctg 60

atgatcgtca gtttagagtg aacatttgct tgtaaaatcc c 101

<210> 334

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 334

agcttaaaag tgcgaacgga gattatggaa taatagatyt acatgtgagr nagtcgatgg 60

tcgatgacac ggcaaagcat aaaggcatca cagctgaaac t 101

<210> 335

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 335

ccatatatca tttgcctgat caggctcktc ctcctacgca ggatcgatac nccatataat 60

ttgggattct aaggycccgg tgcagcttct tctcgcagaa g 101

<210> 336

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 336

aagcaaaaag gttggtttya tcacagctcc atgtcctcta gttcaggaag nggaaaacga 60

agtatagcyg ctattccwgt cagttgcgcc aactctgttc a 101

<210> 337

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 337

ccccgaagaa cggcacggcg atgccaacca gagctgtcag cactgcacgc ncgacaaaag 60

atgcatatgt aatcagatca gttcaatgcg tacgtacgtt g 101

<210> 338

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 338

ctggtgtagg gcaggaagac trcgatagag ttgcaatcag ramagtattg nagatctatt 60

tatragtgtc gwtggacatg ctttaaagat gtatatgttg g 101

<210> 339

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 339

aactkttgtt ggtatcctac agtttcagga aagaaacaag tattgatatc nttgtcggat 60

aaaackgayt tggcttatct tggcaatggt cttcagggtt t 101

<210> 340

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 340

wgtaacatyg agaataatct tttccaggat gtaatggggc ggacaatcaa ngtggagttt 60

tcwaagagct tcagaagacc agctccgcct cctcctccrg g 101

<210> 341

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 341

tcatcacaat aattcattaa aacayacata tattakcagt ccagcagcta ngtatgctaa 60

cgtgtagaca actggtgctt caatcacgtg acttaccttc a 101

<210> 342

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 342

gcgtcgcggt cgcggyccgc cgycgctcrg caccggcggc gtccctgctg ncatcgtccg 60

cgtcggcgtt cgcctgcctc aggcggctgc gggtgagcac g 101

<210> 343

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 343

gaacatacta aacccaatgg gccatggacg ytctgcccat aaatgtgcct naaaaagtta 60

caatttttca gagaggaagt tatggaacct aaaacgaaat t 101

<210> 344

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 344

agagaaccta acaaattagt agtagagaaa aagagtcagc aaaactgagc ngctagcrgt 60

aaaacacgta agaatgaaat wgacaatggg actataccaa c 101

<210> 345

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 345

aacttgacat acagctgtat tatattgaac ccatgcatct ctaataaagg nttaatttct 60

caccaycaat tcacgtcaat ctaaaccaca aaaaagaagc t 101

<210> 346

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 346

agtaaggaat atgcacatga aggagggttt tcagttcgta ttggttcaca naatgtactt 60

tttggtgaga tcatgaacaa gaggttcttg tgttcaagaa a 101

<210> 347

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 347

tcacatttgg gttccaaagg acgggacgct acctgccccc gactcyaggy nagctgsctg 60

aaggctcgag ggcaggcgga agggggaaag ctctagakga c 101

<210> 348

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 348

ggaggcgagg tggagcgcgg cggggacgtc gccggactcc agggacgaya ncgaggcgcg 60

gaggcggtgc agcgagaggg cgaggtggtc ggcgcagggy c 101

<210> 349

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 349

aagctacaag attaccattg gcagatactt tagtgggtgg aagaagtacc ngactctctt 60

caagacatct ttyttccttt gtgttcgaac cctgttcagg a 101

<210> 350

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 350

ttctgtctgc tccamggata cggattcatc ctgcacgcag gcaagcaacg ncgatcagac 60

ttgccagctt ccawgtacac ggttctgtaa tcaccacctg c 101

<210> 351

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or a

<400> 351

gattmatagm cgycrtgatg agakagcaga aaagttaaga tacagccacc ntttcctcta 60

tggatcaatt stcgcaggac ytwatctggt aagtgagcag g 101

<210> 352

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 352

attccacgaa tgttgtaacc caacctgcct ccaatctaca agaataagag nctaagataa 60

catataactt gcttatatgc aataaatgca aatgattttg t 101

<210> 353

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 353

caagttcggg ctcgaatcgg ctygkggtgg ctcggtattt agaactagct ntagctgagc 60

ctgttttttt gctcgaaaag agcgagccca cgagctggtt a 101

<210> 354

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 354

attcggtcca tcatcatcac ccaccccggg ccgttgccaa ratgacaata natggccgca 60

tgcagggaag caggggtcgt cgccgatcaa cctcgggtgg a 101

<210> 355

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 355

ttgctgtttc tgcttgctgc atcacaggat tacttggata ataacggtac ntatttgtat 60

tggctgacat atcttgtgga aaggytgaca tactcgagaa t 101

<210> 356

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 356

tcgaggctcg agcggcrgcc gwgatcgcca gcaacaccgt acggttacgg nccgggaccg 60

tgccagattt ttctattrat tygtaggatg cgtccacttc g 101

<210> 357

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 357

ggcgtgcckg cgagcctcgc gcaggcccck agcctgcagg cggttgacct ntcgtayaac 60

aacctcaccg gcmccatccc caaggtgctg ttcgggctcc a 101

<210> 358

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 358

tctccagatc cgaaacccta tatcactgaa tcacaagcca aagcacgccg nartatcaca 60

cgattarcmc cgagacctga tcacaggatc tgaacgttct c 101

<210> 359

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 359

ctgackgcay cgtcagttcg ccacgtagat gtattacaag aaatgggaag nggtaataga 60

gtaacccccg cgcgcacctg gccaggctcc gacgagtccc g 101

<210> 360

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 360

yggtacgtga ctacctggaa accggtcgar aygtgctcac cggacgcggc ngcggaggct 60

ctggagagct gggaaaggga tggacggcgg csgatctgtr c 101

<210> 361

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 361

ttgtttcaac tattttgaac aggtgaagta gcaaagttat tttcagacgc nggccttgta 60

tgtattgcaa gtttgatatc tccatatagg agagaccgtg a 101

<210> 362

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 362

caccgggcac acgtttctgg acgccaaggg aagggccacc tagcgacctc naccaatgcg 60

ggagaagaga agaagagggg cgaagygacg gcacgaaatt a 101

<210> 363

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 363

atcacctcgt acgtagttat caacgtgtgg aattttacat gacgcccacc ntttttgtct 60

gaaaaaaatt catgctgctg gcacatctgt ggcaaatagc a 101

<210> 364

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 364

cttccatgaa ctgatawgcg actgatgaaa ctrcttttca ataacagcaa nttttcagat 60

gtmtttgatg aggagcactt cataaattct ttagcaaayt a 101

<210> 365

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 365

aattcaatac ggaagaacat tcaacctact agagtctaga gtgtattgac ntcagcccta 60

acatgtaacc tatgggaatt tcattaactw tattgcactg a 101

<210> 366

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 366

aaaattcact cccgttgttt acaccacctc aaactcaacc attaagacat ncacatctat 60

atccacctcc tggtcaaagc tatgaagatg ctgccataca a 101

<210> 367

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 367

atagttcaca accaactgaa agtatcaaga cagatgaata gtaaagcggt nggtagtaac 60

ttcacctgaa tgacccacat gctcagaaaa gcctccaggc a 101

<210> 368

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 368

gagaaagagg ggtarcatcc aacaggagat aattctggat ctcatagyca ncctctcsgc 60

tcawgatagc agcctgsata gtagctccgt aggcaacagc t 101

<210> 369

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 369

aggwggtggt ggtggtggag gatatggsgg atcrtcagga tacggtggtg nttatggygg 60

cggcggcagc agyggctatg gtggtggtca gagtacgagt t 101

<210> 370

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 370

acccactcct ckcgktttat tcctctgaaa tgagctgtta cccggctytg nagtctccca 60

agagtyagkt ggcratgttc gttcagcttt tctacttgtt t 101

<210> 371

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 371

gttatgctgc ttgctttcat gaatttttta atcaatatgt tttccaattt ncacagagca 60

gtgaaaaaga aattgaagga gcggatggat gactttcagg t 101

<210> 372

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 372

agagcccgat cgagttytca gggcacctgg agtaggatgg cggcggyggc ngtctcccag 60

tcgtcgccgc gagaactgag aattcccccc gcggggtagg a 101

<210> 373

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 373

ataagtatta tatcatctga ttcacaggcc atggggcgcg ttggagaggt ntgrcacata 60

aatcctaaaa atttcattct crttattaag aaattacata g 101

<210> 374

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 374

gtaccaaygt taaattctta cgtcgtttaa tgcatcagaa tcatactgtt naaatatact 60

tgtttgctkc atgctttgac akattgttac cagaatgatg g 101

<210> 375

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 375

actggatcga gttagggacc tgcattttgg gtgttatttc gggttggatg ntggtttcgt 60

cctactgttg ctcgatgygc ctgatgtctw gttcttaatc c 101

<210> 376

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 376

gctactgtaa gtaaaactga ctgayyttag tatccgaatt caggatcatg ngtagtggtt 60

gcaaaaggat gaatttacat gtctctttcc agtaattttc r 101

<210> 377

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 377

gcttcctgaa ttcaggatca acaatcccaa tcatggcact aagaacacgr nsatcatcgg 60

ttattttgga actggcctgc tcaacattat tctggctccc a 101

<210> 378

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 378

wagagcgcca acctacagaa aggtttattc atcccgttct catggctyga ntgtaacctg 60

gtttgctcgt ttgcttccag ttctaggggt aaactatttc c 101

<210> 379

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 379

ctgtaaaggt ttgtgaattc aagaaactat ataatccaaa tcgaaaatta naatcgggtg 60

atgaggtcac ataagatact cacatgaaga ttttttttat g 101

<210> 380

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 380

tagtgtgttt ctgactgagg gcaataggcg tgggggatag aaaatgcctt nyccccacca 60

cccatccacc acctaattaa aattaactgt tgtatgctgt g 101

<210> 381

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 381

gagcaaaaga ttcgcgcart tgtaacaaat gccaagcaaa tacagaaggt ncaggagtcc 60

gtgttattac agttatttgc atctgcatcg aatttttttc t 101

<210> 382

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 382

gatttactcc actgcatgca gtgaagaaag agcctgggyt gcytgatgtc natgagaccr 60

cagataakca cacactacat tmtttggcag ctgckgcagc t 101

<210> 383

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 383

tgtatccagt tgccytaaag tgatgctcaa agttctatac aggtggttgt naataagcta 60

catccattrg atggatcaaa ctggacaaac atcatcttca g 101

<210> 384

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 384

tttccgaggg ctcacggtcg ytgctggaca gcagaccrcc tagcaaagaa nggactgcct 60

caccctcaat tttgtcccct ctgtgatcaa gaggaagaga c 101

<210> 385

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 385

aaactaggca tattatatga aatatttacg tcaaaatcct gtggaatttg ngtgagtagc 60

cgacaaatgt tttgctggct gcttatttaa aaaatataaa a 101

<210> 386

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 386

acaactcttg taggaagaga tactmtattc atgwttaatg tattygaata nctacatcag 60

gacaatattt ataactttky gtagtaaagg taatgctcac t 101

<210> 387

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 387

tctccatttc tcctagatga tttacggatg gcagtgaaag aaattatatg ngacagcgag 60

actgggcgkc aggagtacga agaagcagtt atagcaatta c 101

<210> 388

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 388

ggcgaatgac tcctgtctct gtctctgtgg atgaacccat gatcaccttg nccacggtgt 60

ctatgggaat acggcataaa aaacctgtcg tccatcatgc t 101

<210> 389

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 389

tgtgaagaag tctcgctctc gcgcgcccac gctcactctc tcagtcacat nctgtgttcg 60

atgcgatttc cagggagcac cgcggaggcc gcgccgtcgg a 101

<210> 390

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 390

ctgggttgtg ggctattctg gaggtggcat gcatgcctgg agtgctcttc nttacattcc 60

tgatcgaatt gctggtacct acttcatttg gttttcttct a 101

<210> 391

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 391

ctggacatgg caattttgga acagaggaca accatgaggt tacaaccatg nctactcttt 60

gcgatgtttg atctgsrtac ytgaatctgt ttatgatacc c 101

<210> 392

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 392

gctagcctcg aagcttccag ggwgtaggag tccacggagt ccccgaagga ngcggggcgc 60

gtcggccaga agcgcgtgtc cctggcctcc ctcggctgca c 101

<210> 393

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or a

<400> 393

taccattgtc ggaaagcgyc catttcaaac tgtattgggt tgatctcaat nagatttcaa 60

gagactgata rcaaatttag cttatagtca tggcatacgc a 101

<210> 394

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 394

gtggacatga aarcggctgc atgcttgtgt cgacgacttc ttgctgaaaa nggtgttctg 60

tctacctcgt ctcgtatagg cctatctctg gcaagaagtg c 101

<210> 395

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 395

agtgaaacct tggcaaagga aattgytgtt aacataacak ttcttgtgcm natgaaacag 60

gcttactatc taccggagac cgagtacgtc cactgggcgc g 101

<210> 396

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 396

ttcttttacg cacagatttg ggatgcttca tcaccatatg aacagatgat ncggatcagt 60

taattctcga tygatgckgg tggttttygc tcaggcattc c 101

<210> 397

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 397

wcagagagat aacagcgaga aaggcckwgg tggaagaaag cactgacaag nccaaggccc 60

tkctcaccaa gctggaaatg racagtgtgc tcgaatcact g 101

<210> 398

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 398

cgtccgcctc gcyatgacgc atgtcgtygt ctttgatctc agtacctctt ncgatacgca 60

cctggccgtg ctttgcctcc tcgtggtcag caccatttgg g 101

<210> 399

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 399

tgaccaaaat gatttgataa tcgcaaattg gcgatgaatc atggtttggg nrttttgccg 60

aacactaagc ggatgctgca tgaaccttca ctgcctacgc c 101

<210> 400

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 400

gcactgaagg gatraaacat trtagagtta ttaggaacag ctatytgaaa naatgtccat 60

wcaataataa acctctygaa gaaaatacag agcgcgataa a 101

<210> 401

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 401

tccgtggggc gtggaggagt gggacgacgc acgcggaggc agccccggtc ngttgctgct 60

gtatccgtcc aggatcgggg gaattccagg aggcaggtga g 101

<210> 402

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 402

caggcaggac amggatcacc gattcttgcc agcacatcag agcgcctcct nctcgacttg 60

acgagatcag magaatcaga cggtgcccag gtrcggaaga a 101

<210> 403

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 403

aaggaaattc cttacagtcc gtgccgtctc caatttgttc ttgcagggcc ngacgtttcg 60

tcggtgaatc ctcgagctgc ygccgtcacg tatgaggaac t 101

<210> 404

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 404

aggatggttg aagaaagctc gctggaaagc cgcctgatga tggctctgcr ncatttgtac 60

ttcagttttc aacttttcat catgttattt crttgcatga g 101

<210> 405

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 405

taggatgyta ttatccctmt tgcgtggcac aagggaaagt tggtagcayg nrtgactggc 60

aaaaagactt grtctarcat mtttcatrat attcaggtaa t 101

<210> 406

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 406

ttatgcatcc tgcaagctcc taggagcgtt ctccagatga ctgaatctgg ntcgaggctc 60

ataccatgga tgaattccac ggmttcatcg agcttcccag c 101

<210> 407

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 407

tccgcacccg cctacgcctt cttccttggg acaaatcgat tcacggcaag ncaagagamg 60

catgcggcag catcagcttt gccgcgcccg gccttgcttt c 101

<210> 408

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 408

tgctcgctgc ccttgaattc cagggctacc agtgatgttt cttgaggggg ncagaaatcc 60

arcagagtcg tttctcctaa caggaggcaa tactccaggc a 101

<210> 409

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 409

cgattmaagg tatggaagag aacctcacca attcrcctaa ttaacmtgta ngtaaaaaca 60

cyttctcrcg ttaagccgcc accacggaaa tgccggtrat c 101

<210> 410

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 410

gatacgtagg atgatacatc raatgaacac cttggaacac cagatctaca naagttcctg 60

tgatgatctc cggtcagctc ctgcgtcgtc tccacacgct t 101

<210> 411

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 411

cycagtttaa tgtttgccac caatagaggt atcatgttgc atgcatttca nttttacaag 60

caaaygtcaa ctaggagtat tgcacaaaca aggctcwtaa c 101

<210> 412

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 412

ccaatcagcg ctcacctctc gcgtcctata ataaacgcac crccccmytg ncttcyctmc 60

cagcaacagc caacatatct cctcgcattt tccttgcaac c 101

<210> 413

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 413

cctacagata gtccacgagt cctgcttgcg ccaaaarcca cgtttggaat ntagctcttg 60

gactgtacag taatgtgaam ttgcctgcag acgctagcta c 101

<210> 414

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 414

ccaaggccta cccagacagt acgcattaac aggacagaac catatactca naaacatata 60

ggtractttg ggggaccttc atctcctgca ggaagagtgt c 101

<210> 415

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 415

tgtccagctg agtkartraa tattacagat taaaagtagt attacagatt ngctgagtta 60

agaacttgca ttgcatctat aacctgcagg cttttaatgg t 101

<210> 416

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 416

tgcaggggag gagattagga gaagcacctg ttctggggtc cacttgtctg nggtcgtagg 60

aaccagggcg cggcgcattg gtcactgacc caagcggccc a 101

<210> 417

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or g

<400> 417

caatggcaga aataagmttt gaaaccatat tcaccttgaa cttgaagtcc nccaccacca 60

aaaaataggt gatctgttct tgataagcac tgctccttca a 101

<210> 418

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 418

cagttttctc caacatctta tcttcagctc ctctatcrgt agcygttgca nagtgaagta 60

catgtgatga gttagcttgg ttagggtgag cactctgtty g 101

<210> 419

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 419

tcccatccgg actataaata aaagcttcca ttattttgtg ttgcaatgta ntgttaatgt 60

gcatgcatca aaaaattaaa ttaaaagata cagttccttt t 101

<210> 420

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 420

ccctccctct gctcctctct ctctctctct acacattcca aagtgcacaa ngaacactcc 60

atgcaccatc atcaycacct cacatgtctc aatgcaaaag a 101

<210> 421

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 421

agcgckgcgc tcctayayag catagcatag ycaatcgcyg ttcagygaac ncttctgytc 60

caaataactg ccagagcctc aaaacaaaac tggtcttgac c 101

<210> 422

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 422

tatgcaacca agtctcagaa atacttttca caaccaccat catagaaaaa nttggtgaat 60

agaaaatata cccagtcata attgaagata ccaataactt g 101

<210> 423

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 423

cctaccgcat ctgtatggag gccattggcc aacaactaca cttttttagc nagagtccgc 60

tgttttgtgc catgctccac aactttctct tcgacatgca g 101

<210> 424

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 424

gtgtgcaagt tcagcgaact cccggagccc tcgtcgccgt cgatccttcc ncggctctat 60

ccgctgggcc gtcgaccatg gtgaaccaca ctttcacact c 101

<210> 425

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 425

aattgctaat arcaatcgga aatttaggga acgctgtaga tamygagact ntatgttgca 60

agttagtcay gaaagaaatt aagtattgca gtgcgtagga c 101

<210> 426

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 426

aaaagagcag caccatcaca cttaacgagg tccatgatat ttggactccc ngatacgata 60

ctcaagggag atgmttcctt gaatagcatg tcagagagca t 101

<210> 427

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 427

cccgcgccac tgttttaaat cccctgccgc cgctcaaccc cgccgtcccc nctctccggc 60

tctccgcgac gagatcctct gcaccggctc tyccccmttc c 101

<210> 428

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 428

arattgtgcg ggatcacaaa taacacgaag attagtcatt tttacagcac ngagactagc 60

ataggtgtca accaaagggg ctatacatgg caatttctat a 101

<210> 429

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or t

<400> 429

gtttatgaag tatgcaatga tttggttaga gttttgcatg actggaggtt naagaataat 60

aaagctgtaa tcaaatggtc tgagttccgt gagatatgtc a 101

<210> 430

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 430

ttcccccctt tcccgcggtc cgtcctagtc tcctagagat ttagctccga ncattgaaca 60

gtgtcctccg ccctagtccg aatcggcttt aycgcctagg t 101

<210> 431

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 431

cggtatgatc accagaaaag gcctacagcc aaggaaacca tggtacatct ngcctacatt 60

cttgaagcaa rttactggat tagtatgaca tgcataacst c 101

<210> 432

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or c

<400> 432

cttgtcccat tgtctaaaaa atgatcagta ggaggcaact catgctggtc nctagaaaaa 60

tcagtaacag aacmaaaatt acatatttat tttgctctaa a 101

<210> 433

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 433

accctacaga gaaagtcctc acgaatgcac ggaagaagcg cgtacgtacc nctggagccg 60

gagaccgacg cggcggcggc ggaggcggcg ggcgagcagg a 101

<210> 434

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 434

aagattctaa ataacgcacc ctatgtgtgg ctggatagcg aattgtttga ngccaagctc 60

agaggggaac aaccaccraa agagtcggcg tgcaataata g 101

<210> 435

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 435

gagattctcg tgcaaatcct aaaggaaacc ttcttactag ccatataagt ngtactgatt 60

tcactgaaga cggtgsatcc attcagtctc cgagctcaaa a 101

<210> 436

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 436

gatctgcttc tggctgagat aaggctctaa gttcgctctg ttgatggggc naccatgarc 60

cacgggaacg ggatgttgaa ttctgtcaar gtggagaggt g 101

<210> 437

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 437

gatctgttag catgtattaa ccttttggst gtattgmaat ttaattmata ntcctaygtt 60

attatatatr tctatccwrt gcsattcata agccatctgg t 101

<210> 438

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 438

ggtcacatta aaagaaaaaa arggwggcaa tagaaaagra aaaatttatg ncggagatga 60

aagcgaggtg aacaacgrta gtacatcaac caacagcaag g 101

<210> 439

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 439

atcgaagagc ttagrgaggc actggctgat gaactggagg gaaccgatga ngacatcatc 60

aatggcatca tccgagacgt ggacacrgat aaggtcagca a 101

<210> 440

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or g

<400> 440

ctgtcggtaa cattttggtt gttgtagcca agttttactt amacagaggt ngasgctttc 60

attccttgca acgcactgta ggccaagttt tatttctgtt a 101

<210> 441

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 441

gggccactct cagagctggg tctttttctg tggtttgtaa gaaatggtcc ngtctcatgg 60

agtccagggg cgccttactc ccggtgttga tcaatgttga g 101

<210> 442

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or a

<400> 442

gcagaagagc cgttctatgg atttggtact gaattctctc cccgytgtca ntaaaaacta 60

gatcgttgat gtgaccaaag gggtygagtg aggttycatt g 101

<210> 443

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=t or c

<400> 443

aaaamgtgac atggtcaacg agtggccatg ggccatggct ttgcaccmtg nagaacaagg 60

cgagtgacta caaaacagct ctgttyggca tatggagaga g 101

<210> 444

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or g

<400> 444

gaacaatagc aastcactgc ggtaccacag gccattcagg aattctggcc ntatttattr 60

caactctttt acagacaaca gcagcatggt ttagctcttg a 101

<210> 445

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 445

gaattcagay ggacaacaca ggaaacctca aactgaacgt acactcagga ngtgagagga 60

tgttcagaca aygcaaaaca acagagcacc ataarctaaa g 101

<210> 446

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=g or c

<400> 446

gcgtacgamt gtgggtggac cgacccttgt gtgattgtgt cggcccrgct nagcttgagc 60

gatsgccatc rtcgatcgga ggagcggaga acgggagaag g 101

<210> 447

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=c or t

<400> 447

agggtttcgt tcttggtgcg gcggccggcg ggctcgtagt cgtaacctct ntggcccgac 60

cggatcagga attcaggatc cacccttgag ccggcccagc c 101

<210> 448

<211> 101

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (51)..(51)

<213>N=a or t

<400> 448

catgaccagt ccctctaaga attccctccc tttcccctct aaaactccaa nctcccgcaa 60

aaaaatattg catgttattg tgtctggatc acacatttga t 101

Claims (8)

1. the SNP marker for corn gene parting is combined, it is characterised in that be made up of 448 SNP markers, the SNP The numbering of mark is respectively ZmSNP001~ZmSNP448, and nucleotide sequence is respectively such as SEQ ID NO:Shown in 1-448, they Information is as shown in table 1.

2. SNP marker described in claim 1 combines the application in corn molecular mark.

3. SNP marker described in claim 1 combines the application in corn full-length genome breeding chip is prepared.

4. utilize the method for KASP technology for detection maize genotypes, it is characterised in that comprise the following steps：

1) KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence；

2) representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result verification reacted according to PCR The availability of KASP primers；

3) genotyping is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment, from And identify the genotype of corn to be measured.

5. application of claim 4 methods described in corn variety identification.

6. application of claim 4 methods described in detection corn breeding material.

7. application of claim 4 methods described in corn whole-genome association.

8. application of claim 4 methods described in corn molecular mark.