CN107090504A - SNP marker combination and its application for corn gene parting - Google Patents
SNP marker combination and its application for corn gene parting Download PDFInfo
- Publication number
- CN107090504A CN107090504A CN201710304942.2A CN201710304942A CN107090504A CN 107090504 A CN107090504 A CN 107090504A CN 201710304942 A CN201710304942 A CN 201710304942A CN 107090504 A CN107090504 A CN 107090504A
- Authority
- CN
- China
- Prior art keywords
- dna
- misc
- feature
- artificial sequence
- corn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is provided to the combination of the SNP marker of corn gene parting, it is made up of 448 SNP markers, the numbering of the SNP marker is respectively ZmSNP001~ZmSNP448, their nucleotide sequence is respectively such as SEQ ID NO:Shown in 1 448.Molecular labeling fingerprint analysis can be carried out to corn variety resource, genotype identification is carried out to hybrid Population offspring, variety authentication is identified, breeding material genetic background is analyzed and screened, analysis is associated to economical character by being combined using the SNP marker of the present invention, be had broad application prospects.
Description
Technical field
The present invention relates to genomics, molecular biology, bioinformatics and Molecular Plant Breeding field, specifically,
It is related to a kind of SNP marker combination for corn gene parting and its applies.
Background technology
Sequencing of extron group (whole exome sequencing, WES) associates site sequencing with restriction enzyme
(RADseq) it is the gene order-checking method that SNP is excavated that is used in complex genome species using more high performance-price ratio.
Molecular marking technique (Molecular marker technologies) is the important tool in molecular breeding.Pass
System molecular marking technique, such as RFLP (Restriction Fragment Length Polymorphism, Restriction Fragment Length
Polymorphism) and the once performance in functional genome research of SSR (Simple Sequence Repeat, simple sequence repeats) technology
Important function.But, there are many limitations in traditional molecular marking technique, such as flux is low, quantity is few, operating process is numerous
It is trivial, it is impossible to meet the demand of large-scale commercial breeding.In order to accurately be controlled target gene, have to genetic background
Effect selection, carries out accurately analyzing and identifying, it is necessary to development and utilization high flux molecular marking technique to breeding kind.At present, it is high
Flux molecular marking technique platform mainly includes:Second generation sequencing technologies, biochip technology, and the detection of single SNP marker
System, such as Taqman and KASP are marked.
The content of the invention
It is an object of the invention to provide the combination of the SNP marker for corn gene parting.
It is a further object of the present invention to provide the application that the SNP marker for corn gene parting is combined.
In order to realize the object of the invention, the present invention is provided to the combination of the SNP marker of corn gene parting, by 448
Individual SNP marker composition, the numbering of the SNP marker is respectively ZmSNP001~ZmSNP448, and nucleotide sequence is respectively such as SEQ
ID NO:Shown in 1-448, their information is as shown in table 1.Every sequence is deposited by 101 base compositions, and at the 51st
In nucleotide variation.
The extron group of 276 parts of corn materials is sequenced the present invention, and other 206 parts of corn materials are carried out
(have 85 parts of materials to be identical in two groups of materials, therefore have 397 parts of different corn materials) is sequenced in RADseq, by 482
Part sequencing data carries out initial analysis, obtains a large amount of high-quality SNP (SNP) information.Based on these SNP
Information, integrates the public SNP data of corn and 397 parts of materials has been carried out with clustering and group structure analysis;Also, for 397
64656 shared high-quality SNP sites of part material do further screening, select 448 core SNP sites, are based on
These SNP genetic distance dendrogram shows, is only enough to distinguish above-mentioned 397 parts with the genotype information of this 448 SNP sites
Corn germ plasm resource.(Fig. 1)
The present invention also provides the SNP marker and combines the application in corn molecular mark.
The present invention also provides the SNP marker and combines the application in corn full-length genome breeding chip is prepared.
The present invention also provides the method using KASP technology for detection maize genotypes, comprises the following steps:
1) KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence;
2) representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result reacted according to PCR
Verify the availability of KASP primers;
3) genotype point is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment
Type, so as to identify the genotype of corn to be measured.
The present invention also provides application of the above method in corn variety identification.
The present invention also provides application of the above method in detection corn breeding material.
The present invention also provides application of the above method in corn whole-genome association.
The present invention also provides application of the above method in corn molecular mark.
The present invention is compared with other Markers for Detection systems, with advantages below and effect:
(1) compared with conventional molecular mark is such as SSR marker, with flux height, the low advantage of single marking data cost.
(2) genotype data accurately and reliably, genetic stability and reproducible.
(3) automatic detection is easily realized, human cost is reduced.
(4) integration of multiple genotype data result can be met.
Brief description of the drawings
Fig. 1 is distribution maps of the 448 core SNP identified from 397 parts of corn materials on genome.
Fig. 2 is 64656 shared high-quality SNP sites of 397 parts of corn materials in the embodiment of the present invention 1 on genome
Distribution map.
Fig. 3 is the Dendrogram of 276 parts of corn materials in the embodiment of the present invention 1.
Fig. 4 is the Dendrogram of 206 parts of corn materials in the embodiment of the present invention 1.
Fig. 5 be the embodiment of the present invention 2 in using KASP primers ZmSNP278 to corn sample to be measured progress quantitative fluorescent PCR
The result of detection.
Fig. 6 is the PCA analysis results of 448 SNP markers in the embodiment of the present invention 3.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Unless otherwise specified, embodiment
According to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual (Sambrook J&Russell DW,
Molecular Cloning:A Laboratory Manual, 2001), or according to the condition of manufacturer's specification suggestion.
Embodiment 1 is used for the exploitation that the SNP marker of corn gene parting is combined
Genome sequencing has been carried out to 276 parts of corn varieties using sequencing of extron group technology.Meanwhile, using restricted
Restriction endonuclease association site sequencing technologies have carried out genome sequencing to 206 parts of corn varieties, and 397 parts of corn materials are obtained altogether
Gene order-checking data.With reference to other corn varieties weight sequencing data in public database, (including Central China, agricultural university is tight
Build the SNP information of (2014) 503 parts of materials of SNP information and Hirsch et al. of 540 parts of corn materials of soldier professor), with jade
Rice B73 genomes AGPv3 is reference sequences, analyzes and identifies SNP site, selects representative, 397 parts of corn materials
Expect unique SNP marker totally 64656.Core SNP is identified and screened according to following steps.
1st, the comparison of sequencing Reads and corn B73 reference gene groups
Compare software:BWA mem
Reference gene group:B73 reference gene groups AGPv3
Input:The reads (paired-end and single end) of pretreatment
Parameter setting:-M
2nd, identify and screen SNP site
By using instruments such as picard, GATK and VCFtools, since the bam files after sequence merges, enter one by one
Row following analysis works, and finally gives original SNP.
(1)picard tools:MarkDuplicates
For WES sequencing datas, this step is required.And to RADseq data, this step need to be skipped.
(2)GATK:RealignerTargetCreator and IndelRealigner
The comparison again that local fine is carried out to the reads in known indel regions is arrived by comparing, the accuracy compared is improved.
(3)GATK:BaseRecalibrator
For each sample, on the basis of known SNP site, calibration model is set up by machine learning, then be based on
The model corrects base quality.
(4)GATK:HaplotypeCaller and CombineGVCFs
For each sample, nucleotide diversity therein (Variant calling), generation .g.vcf texts are found one by one
Part.And merging comes from 276 parts of WES corn materials and 206 parts of RAD corn materials respectively, obtains final two .g.vcf files.
(5)GATK:GenotypeGVCFs
Polymorphism parting (Joint genotyping), based on the variation information comprising all group member's samples
.g.vcf file, obtains the original SNP and indel information of each member each organized.
(6)GATK:VariantRecalibrator and ApplyRecalibration
Using known corn SNP data (maize.AGPv3.22.hmp.vcf), quality is carried out to original SNP site
Correction.Obtain vcf file of the quality re-graduation containing each SNP on the occasion of VQRS.
(7) VCFtools screens high-quality SNP
The SNP of the PASS after GATK is corrected is screened, by further selecting all samples missing in MAF >=0.05, group
The SNP of rate≤20%, constitutes high-quality SNP site collection, is used as next step analysis.
3rd, the signature analysis of high-quality SNP site
Two sets of corn sequencing datas are analyzed by above step, 1,173,946 (206 parts are identified respectively
RADseq materials) and 1,014,332 (276 parts of WES materials) high-quality SNP site.To these sites, we are further
Calculate SNP allele frequency, π values with VCFtools, heterozygosity, the relationship degree of correlation of sample, and according to SNP
Allele frequency calculate the PIC values of each SNP site.The Hardy- of each SNP site is also examined with plink
Weinberg balances.
4th, clustering
It is far and near for the affiliation between clear and definite different corn materials, these corn materials are carried out using SNPhylo softwares
Clustering.Successively the material that the corn material and 206 parts of RAD of 276 parts of WES sequencings are sequenced is clustered respectively, used
The shared SNP (64,656SNP) of two groups of materials is carried out to all 397 parts of materials (having 85 parts of materials to be identical in two groups of materials)
Clustering.
Fig. 2 illustrates distribution situation of 64,656 SNP sites for coming from 397 parts of corn materials on genome.From
Fig. 2 can be seen that SNP to be distributed in chromosome two ends density high, and the density near centromere is then relatively low, this trend with
The distribution trend of corn gene on chromosome is closely similar.
5th, public SNP data clusters analysis is integrated
To further appreciate that this 397 parts of corn materials genetic diversity in a wider context and group structure, Wo Menshou
The public SNP data of two batches are collected, including Central China agricultural university professor Yan Jianbing to from 540 parts of corn germplasms all over the world
The SNP chip Genotyping (containing 2,649,403 SNP sites) of resource and (2014) 503 parts of materials of Hirsch et al.
485,179 SNP site data.By the way that grand flat data are integrated with the Yan Jianbing data taught, we are extracted two
The genotype information of 34,324 shared SNP sites of partial data, and clustering has been carried out with these data, build tree-shaped
Figure.From the point of view of dendrogram, generally this 397 parts of materials and the extent of polymerization from the public corn resources such as CIMMYT be not high, says
The genetic diversity of this bright 397 parts of breeding materials has larger room for promotion.The Dendrogram of 276 parts of corn materials is shown in Fig. 3,
The Dendrogram of 206 parts of corn materials is shown in Fig. 4.
6th, core SNP collection (core SNP set)
Carry out further screening for 64656 high-quality SNP sites that 397 parts of materials have, it is a collection of to pick out
Core SNP site is used for marker development, and these materials are distinguished for later molecular breeding laboratory stable detection.Screen principle and
Process is as follows:
1. according to the PIC values of SNP site, the SNP of PIC≤0.37 is rejected.
2. .vcf files are converted into .map and .ped files, bed files is further converted into using plink.
3. plink arrange parameters -- indep-pairwise 100 10 0.5 is utilized, it is step screening that SNP, which is carried out,:With
Every 100 SNP are a window, and 10 SNP are step-length, calculate the linkage disequilibrium LD values between each pair SNP in each window,
If LD is more than 0.2, one of SNP is removed.
4. operated more than repeating, it is ensured that the SNP retained is not in same linkage disequilibrium is interval.
Screened by above step, finally obtain 448 core SNP sites, Fig. 1 shows these sites on genome
Distribution, overall trend coincide with the SNP distribution trends (Fig. 2) before screening, and site distribution is substantially uniform, and in centromere or LD
The selected SNP in longer region is less.Genetic distance dendrogram based on these SNP shows the base only with this 448 SNP sites
Because type information is enough to distinguish this 397 parts of corn germ plasm resources.All 448 core SNP sites are shown in SEQ ID NO:1-448.
The method that embodiment 2 utilizes KASP technology for detection maize genotypes
According to the core SNP sequences obtained in embodiment 1, the detection of maize genotype is carried out with reference to KASP technologies.Specifically
Method is as follows:
1st, KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence;
2nd, representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result reacted according to PCR
Verify the availability of KASP primers;
3rd, genotype point is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment
Type, so as to identify the genotype of corn to be measured.
Part primer sequence used is shown in Table 2.
The part primer sequence (5 ' -3 ') of table 2
Step 3 is specific as follows:
(1) genomic DNA of corn sample to be measured is extracted;
(2) corn sample to be measured needed for PCR is reacted using LGC companies production IntelliQube SNP detecting systems
DNA, KASP primer, Mastermix carry out high-throughout packing mixing;
(3) the Hydrocycler water-baths PCR instrument produced using LGC companies carries out high flux PCR amplifications;
(4) detection of fluorescence signal is carried out to PCR primer using IntelliQube, according to each corn sample DNA to be measured
Fluorescence signal determine its genotype.
The method that genotype to corn to be measured is made a concrete analysis of is as follows:
The DNA of corn sample to be measured will produce fluorescence signal in each cyclic process that PCR is expanded, a certain
The different corn sample DNA of SNP site genotype can produce different fluorescence signals.After PCR amplifications terminate, IntelliQube
Different fluorescence signal information will be collected and sorted out.
Fig. 5 is to utilize KASP primers ZmSNP278 (Primer_Allele FAM:CACCATCTTGCTCTCCTTCTGCA,
Primer_AlleleHEX:ACCATCTTGCTCTCCTTCTGCG,Primer_Common:
GAGTCAAAAGCTGAGGCGGAGGAA) the result detected to corn sample to be measured.Fig. 5 show IntelliQube receipts
The result of the fluorescence signal of collection, different fluorescence signal represents different SNP genotype, and each point represents different jade to be measured
Rice sample.Upper left corner blue-fluorescence signaling point represents that these corn testing samples are homozygosis GG in the genotype of corresponding SNP site,
Lower right corner red fluorescent point represents that these corn testing samples are homozygosis AA in the genotype of corresponding SNP site, middle purple
Color fluorescence signal point represents that these corn testing samples are heterozygosis AG in the genotype of corresponding SNP site.
The PCA analyses of 3 448 SNP markers of embodiment
The PCA analysis results of 448 SNP markers are shown in Fig. 6, can clearly demarcate male parent colony and maternal colony, with gathering
Class, group structure analysis result are consistent.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Yuanlongping Agricultural Hi-Tech Co., Ltd.
<120>SNP marker combination and its application for corn gene parting
<130> KHP161117561.5Q
<160> 448
<170> PatentIn version 3.3
<210> 1
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 1
ggaaatggaa catcaatcaa agagcagctc atgagacaga aacataaaga ncggcatctg 60
agattcygag ttaccattac cagccaatat cwwatataca g 101
<210> 2
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 2
ctccttcctg actctctatt cttttgtaga acaatttctc ggagttttca ntagaaagag 60
gttttaatct ataaacctcy tctactttag tgacaacccc g 101
<210> 3
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 3
gaatgctcta tgcyacaaga gtaataggta tcctccaagr ccattattwt ntgattcatc 60
taggcatcaa ggcgaaartg acttccakaa gccatttgtt g 101
<210> 4
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 4
ttgttatcgt cagatgttga tgtcccattg acgrcatacc aaatggtggt ntgttccgct 60
caatggcagt ctctctcaat ctatctgatt tgttrggatc t 101
<210> 5
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 5
tttgcgcaac gacgtaattt ttgtttttca atgaagacta gatgagtagt ntccataaaa 60
cttatgctgg tacagtgttg catatccttg agcaatcgtg g 101
<210> 6
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 6
tccatccgca ggacgagaca atttacgaac aaccragcat tcgycaccgg nccttctcgg 60
attcygaatt cgcrggctgy gcaacaaggg tgcgccagag g 101
<210> 7
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 7
atcctttatt gtcagattcc cactggtggc tttcctctcc ctgagaaaac ngaccctctt 60
ggcacmattt ctgctgctcc atggggatct gctttgattc t 101
<210> 8
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 8
tccacgatct cgtcgcagac cgcgcggagg tcggccaggc arctcttaag ncggcggcgg 60
aggccagtga cggtgctrgc gacaggctcg agctccggga a 101
<210> 9
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 9
gcaagcttcg aaaaagaatg gggtggcgag ctgatgtcaa cgacagcaac nggtgcratg 60
cattccatta cattacatta catgcagaag acaatagcaa t 101
<210> 10
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 10
atgacagaga tatacgcaga catcatggtg gagcatcagt aagaattttg naacattctt 60
agaaatacct ctcttatggc aaaacaaata acatkcacac a 101
<210> 11
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 11
agtgtgacaa ctgctccatt ttgctgagga gaataaggag cagttgtata ntgcttaata 60
cattcttcat tgcagaacac agtgaatgaa atggaattga a 101
<210> 12
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 12
aaccattcct tccggccgtg gctgacgagt ggtcccctac accaccccct ntatctgaat 60
ggcaaacacc accacastcc cagacaccgt cyccttccct c 101
<210> 13
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 13
cagggattgg aacaacgacg tggagggttc tcaccggcgg cayggcagta ncccaggcgg 60
cgcaactktt gctatgcggc aagggaaaag ggaaatagtg g 101
<210> 14
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 14
cccactcctg aattcctcct ctgttctgtt aatagaattt gtgctcagat naatgaaaat 60
cagaagctat gtacgtccta tagagatcca tgtgatatga g 101
<210> 15
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 15
tcaataatag tgtatacata tggagaaaaa caaacaaaaa tgttatgctt naaccacagc 60
tcgttctacc aaaagyagtt gtccagatga atctcctcca t 101
<210> 16
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 16
ttttggttgg atcggagata gaagaactta ccgtgctctt tcaggccttg ngcgaccctg 60
tccccggtca cccggcgccg tcccccggcg ccggcggctg c 101
<210> 17
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 17
tatttttgcg ggtccttttg ccaggttcac tacaagtttg aactgatgga ngagacgcta 60
tttcttacgg taaacgtaat agatagattc ttggaaaagg a 101
<210> 18
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 18
tgrctttttg aagatgttgc ttrtagatat ttggattcta attttggcat nctttgcagg 60
tatgatccta gtagatatgc aggcagagat gaagatgtca g 101
<210> 19
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 19
ctctacctcc tgctgaactc cgscgcggcg caggagatgc tcgagacgtc ngcggcgcag 60
ggctacaagg ccccggagct gatgaagatg agggacgcca c 101
<210> 20
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 20
ggtgttgtta ggatctgyct aaaaacaaca cgcgaggccc tctcctcatc ngtcaattcc 60
ctggctggtt ccgcaggaag ccaatccctc acrgaagaag t 101
<210> 21
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 21
tgccatgatg aaaatgccaa ttggccctca gatcgagctt ttgcaggtga ngtcggacca 60
gataagaact tgggagaggg tgggccagtt gaataagctc g 101
<210> 22
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 22
gaggctaacc gtatcagaga gaagtaccct gacagaattc cagtaagctt ntaccctcct 60
gcatgcactg ttcrtttctt catgattgct ttsatccaat t 101
<210> 23
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 23
ttgattgcct gwatkatgtt ctctgcttcc tctactactg ttwtgtctcc ntttgcagta 60
ctgcgtgcgg caataaacgc ctcaacawcm tgttgcagtc t 101
<210> 24
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 24
tttcacctca gtatgtgccg tctgtaagtg cttcgatcta ttcttatgtg nttttgattg 60
tttcatttrt ttcgccttca ttggataata ctatattatc c 101
<210> 25
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 25
ttttktatgt ttcctgtttc atcttattag gttgaaatta aaagggacaa ncattacaag 60
gaggttcgts tgttttcaga tgcagggcga atcctcagac c 101
<210> 26
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 26
aaatgtttga tgtgttactt acaactggca ggtcctttaa aatactggaa ngaggaacca 60
tcagagatgc taaggcaaca gaccaattga tgttatctcg c 101
<210> 27
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 27
gcatgctgca gaagcaactt gagattcgaa gcgaagaaag gaaatttagt ntcaaatctg 60
ctgacgctgc acacaagcag catcttgaga aygtaaggaa g 101
<210> 28
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 28
cagcaatcca gcgtcttgaa tggaatttag aacaacacrt cmattttaat natctgagca 60
acaagtagag caaccaatcc atctgcargt ctaggagagg a 101
<210> 29
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 29
aactcacgtg ccaacaagcg caagaaaacg aaggaygttt ctgaatctga ntccgaagag 60
gatgatgatg atgatgagga tgaaagcgga gacgatgaaa a 101
<210> 30
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 30
tggagaaggc cggtcccaac ggccgaagca caccrgagaa aggrcagasa ncctsaacya 60
gaaaatactt catttctagg aracacrgwt tgcgtagcta a 101
<210> 31
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 31
tcgatgagat gaagcagaaa tctgcggcca gagaattcca ggtgatcgct nactgtttct 60
gtcttctccg ttgttcgtct gaaactgaca cgaccgaamr c 101
<210> 32
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 32
aaggrgagag ggttcaakca ttgcttagct ggagggaccc tcgggccaca ncagtctttg 60
tcctattttg tttgatagca gcaatagtcc tctatgttac a 101
<210> 33
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 33
gccacggcac cttggataca tacactatgt gaattcacag attctcaatt natttgtttc 60
aggtggacga gatatttgtt cagtctatta aagacgcagg c 101
<210> 34
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 34
aawargaagg gctgagtyga gagtgctgca gaatacatga ttrttrttgc ntgaaaagra 60
acatgmatgt cactacagmt agctatacac ttactggctg t 101
<210> 35
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 35
tcctattcag tatagaaaga wttcayaata ccatgaccac agaggttaca naccaascag 60
gtctacyagg gttgtgtcta tttttaagat actgaggacc a 101
<210> 36
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 36
gttcctaaca ckctgtaact ttggcctttg aatagattct agagagcctc naagaaaacc 60
actggctggt gctacttttt cttacgggac aaragagcct c 101
<210> 37
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 37
caatcctgtg aaacaggtaa acagaaayta aatgtacaaa caggtagcac ncaaggatca 60
taccgtttcc aatcttctcc aactttgaac atgctatggt a 101
<210> 38
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 38
ttctttaact ccgtatgtcg agcagggttg tttacatctt gctttcgttt ntgttcttca 60
atatttcagg cataaatgac agaactcggt gctagaagca g 101
<210> 39
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 39
ttcagctcat tatacacatg gttaccttct tgatartagt ccttcctgtg ncacatgaaa 60
tctgccatca gtgtttaagc aagaatgaaa tsgagatgct t 101
<210> 40
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 40
cagcctgtta aaagttttgc taaaccaaac atggtaccac caccaatrtg ngtcccagtt 60
accctttcaa actttctrtt tccagtaacc tacattatac t 101
<210> 41
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 41
agratatatg magatttggg atacaagcag tcaagctcca taatattctc nttctccaca 60
agtttattta gggtcattta akttggayat atgaagatgt g 101
<210> 42
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 42
tggttctaga acgtsctagg gagtagggag tgygcttgaa agggccrgac nagtgacgay 60
accgttggca ttgtgatktg tgcattttct gacgtgacta a 101
<210> 43
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 43
aaggtattma ttcttatgtt atgygcctca aatttatgty ctgaytttga ngtttttgtg 60
twcataactt aataaaattt gtatttcagc aaaagtacaa a 101
<210> 44
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 44
atttaatgag taactacatt taataatgag tacaacgttg agartgacgt naaccagcgg 60
ctccggaatc cggatctccc cacacggmca cacggacacg g 101
<210> 45
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 45
gctaaaaaca aactaaataa actagttggc aacaaatatt cgagaactga natactacat 60
aggaaaakaa tgaaaaactg gcaatgttga catccacaaa a 101
<210> 46
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 46
tagagaaggg atstgatgta tacttgtata gtgatacacc atgtaaaagt naagttccaa 60
cttgtacatc acccttggct gagaccccat cggtggtggt a 101
<210> 47
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 47
ccaatcaaac gtaagaactg cacccagggc aatgcaatag ccaagattca ncagttcttg 60
gaatcgacak gttccaagaa caagaacaat gttccgtcca a 101
<210> 48
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 48
gtagattatt ttacatagaa aaaaggtttc atgtagcact tattgccata ncattcaact 60
ggaacacctg taatctataa agtaagctga agaagcccaa t 101
<210> 49
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 49
tcragtccat acccgttrga agcataacct ataagcattg agttccacag nacttcrtct 60
ggattagcaa taccactgaa gatcctgcrt ccattggcca a 101
<210> 50
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 50
tctcaatctg gtattcatag caattataya ttgccacaaa gaaaaaagac nagagattat 60
actacgttgc aagccaggtc cttccaaatc tccaagtagc t 101
<210> 51
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 51
aatcgamtgc agggctgtga cgcgtctgtg ctcctcaact ccaccgcggg naaccgcctg 60
tctgagatgg acgccactcc saacaggagc ctgcgaggct t 101
<210> 52
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 52
agaccctgac gaggctgtat atatggtctg aactatagat acatatacat ncatattcat 60
acactaatgt rctagaatwc acgccctgct gtctatcacg g 101
<210> 53
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 53
tgacagaata gccgctaagt agtgacaaac acaggtgaat agtgaagtag nggtacaggc 60
ttaccacgta gagtgaattc tcgatgcggt cgccgcggag c 101
<210> 54
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 54
gtgatgcaag gaaattgcta agagatattc cagaaacata ttcttcttga naaaaagcaa 60
ggaagcatac atgactagga ggaatgtgtt ttccgctcaa a 101
<210> 55
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 55
carwaaaggg ggtgaattca trtagcggtt aattrgtata tcaccacaag nggagaarac 60
agatcttgtc tcaccgagca wgccctgatg tcctggcacc c 101
<210> 56
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 56
ttaactctgt aatttgtggt tataaactag tcatattcga gtaaatcttg ntagtgggaa 60
gacacctctt acacttgtca tttgtacacc agagcactga a 101
<210> 57
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 57
tttgggctgg aagtagtccc agaagtgtag cctagggcga tgctctgcca ntcrtccttc 60
ggtggcttcc aactgaactc cgggtcaccr gttttcagaa a 101
<210> 58
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 58
aatcctaatt cacttgtgat tcctgtcttc ctgatctatr wtgttgttta naaacatgtg 60
attcctgata ttatgatcag gcgtgtgtaa aaatatgaca a 101
<210> 59
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 59
gtgaaatcta gtaacttcta gcccaccctg gggcacacaa gacgagaaac ntccggaagc 60
ccacaggcca caggcaggcc ctcccaycgc tygttataaa t 101
<210> 60
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 60
gyggcagcar agaccttagg garggatggg ccgcaggaag agaragacgg ncgacmgtca 60
tggaagggtc aagccatcag tggagctgga aggaagcgaa g 101
<210> 61
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 61
atgaagtcct gctgccycat cttgtgcctt tgattttgtg gagcgacyta ntttaaaagt 60
attcgttgtc tgacttttgt tgtttgtttc atcttgtttt g 101
<210> 62
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 62
gtccacattg agtatttgct tgcttgggtc atactactca gcactgctcg ntacaggcta 60
ctgggccaat caatgatcat gtgggcttat gggcgggcct a 101
<210> 63
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 63
gacacaggrc tkgcagcaga tttcaacaag tacaggaggg agaagctaac ngagaggcgc 60
tcatcgccct gaattctgag acacatttca caatcacatc c 101
<210> 64
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 64
atgttccaaa tttaatatcc tkrtgtttgt agccatatga ttaagcacta ngaccagtta 60
agaagaaaag gtgactcagc aagtaccagc agtggygagg t 101
<210> 65
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 65
tgccatatat cacagttggt aggctctrtc acaatggrta catcttttca naagaattgt 60
ctgttgctaa cccattgacc aagayccggt atctattgca g 101
<210> 66
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 66
caaacttttg aaggattagt acaatctcca tatacaaatt ggatggatcc ngcgtctgaa 60
atattctggc ttgctgtgat atcaggttcc ttaactgcta g 101
<210> 67
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 67
ttgagtacat gtttaatgat cttgaattgg ccttttgctt tattagcttc ntcacctgtt 60
cagaaacaag atattgacat ttcagartgt agaagggaat a 101
<210> 68
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 68
gttggcgtga attaaatatg ygtacccatg cagaccaacc gcacaacggc naggatcttc 60
cctgctgtcc tagacgtcga gaacccagag ttcaagagga a 101
<210> 69
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 69
gcttgttccc ctacccctgc tctagtgctc tgccawgttt tattctgttc nttttctttt 60
gtctcgtgct catctcgatg gttactggtg agctaagcgc t 101
<210> 70
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 70
gtacktatct ctgcttasgc ttatgcttat gcttgacgac gcaatgatat ncatgcatgt 60
agaacctygt gccggttgct gttgagggaa caaagaacgt y 101
<210> 71
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 71
cagaaagccc aacgattagc agcagagaga gaagctgcat atgcaccttt natttctcaa 60
gcgggcttgc cacagaggta wtttgctgtc atatatattt t 101
<210> 72
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 72
cttagaccta gagtcacgga ccatctgcat ggtaggcaat cacaaagaaa natgagacag 60
aragttaact tygagcragc aataaggtcg gtagtatgcm t 101
<210> 73
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 73
acagatcagt tattcatcat atatggatat aatgtaawca ctgcagaaat ncaaacatta 60
ctttgcatat agatcaggag ggtttgtatc cttggaattc c 101
<210> 74
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 74
gagggggcaa cggtcgagaa ggggttaggg cttcgggagg aagaaaagga naggaattgg 60
gggtagggac gtggtgtgat ttatatggag aggaaagaga c 101
<210> 75
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 75
rcagaggaag gcragccaac ycgtttccwc ggcgatcgay gaacagttcg ngagggtctc 60
gtaccaagcg ytgtcgaatg gaaccggtgg tttctcggag g 101
<210> 76
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 76
ttgcctcctg atgtcactgt tgaggaatta caagagctat ttggaggaat nggccaggta 60
tartttaatt ttacatcgct tccttttgag tgatagtaat t 101
<210> 77
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 77
tgtgaattcg atcataccga ygcggcgatc tctggcttgg cgtcgggccg nttctcctcc 60
ttcatcacct gcggcggcgg cccttcgacg acggcgacct c 101
<210> 78
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 78
tctgtttcct tggaacaggg cgagatcaaa attgccgact ttggctggtc ngtgcacacc 60
ttcaacagaa gacggactat gtgcggaact ctggattacc t 101
<210> 79
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 79
ggtgaggaag gaagacatat attagtacta acggtcggta gagctgtttt naactgaaga 60
ataatatctt ggtcacctac tttgtgctgg ctgtactttt c 101
<210> 80
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 80
cttaccgttc caacagctga cacgaatctg cgagatcggt aatgattctc ngattctgcc 60
attacgtcaa gcacgtggtg agcaccacgc gagatttatt g 101
<210> 81
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 81
atcttttttt ttcctccctc cctcrtgatg agaaacactt cttgcttttc nttatgctga 60
cgtcactgtg tgcaattgtt cactctgcag ttgtctgcaa c 101
<210> 82
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 82
cttctcaaac caatcaragg agaggcagtt gccataaact ccatcctaca nctccatcgc 60
ctcctcgttg acccagatgc aaacccagtg gtgcccgcac c 101
<210> 83
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 83
ctggaacgag ctggttatcg tgttgcacgy cggcgcaggt gcaagtcccg ngttggcatc 60
cagcacaggg tgaccaaaga agacgccatg aagtggttcc a 101
<210> 84
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 84
gagtttaaca tcccatccta tatgtgattt atcatttttt gtgcatcatg nttgacattt 60
taggggaagg aatgtataca tgcagttctc atctcaccaa g 101
<210> 85
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 85
aatctggtct aaatatcacg ctcatycctc tcaacgtgca gcggaaggtt ncttcatttg 60
agggcgtcct cggagctctg aagcaacaca cccagcatac t 101
<210> 86
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 86
gaacccgaag aacctgtcca tgatacygtg gaggagaaca aggtggctgc ngagggtgca 60
gttgtgggtg tctcagagga cgatggaaca gagcatggta a 101
<210> 87
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 87
cattcacaaa agtttgcatg cctaagaaaa attgaaaaga ttaagaaayc naaatttgat 60
gtgttacctg gtttttattg tacatgcaat cagaaagatc a 101
<210> 88
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 88
ggcagagggc catagcagcc ccccagccaa cggcacacac aaacgcgggc nagattcccc 60
ggctgccgag gtcggatgga ggaggagttc caagaagccg a 101
<210> 89
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 89
ttatgcttag gctctcaagt tggtccagcg tacgttcaag gctatgagct nrtggttgtg 60
agtttcyttt gggtggcgtg gcctcacctc tgacaatagg a 101
<210> 90
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 90
caatatgctg ttgtcaactg tttatctgag gctattgtca atgtcatacg nagccacctc 60
atctttatca tctattacca cctcagtctg tacgcatata t 101
<210> 91
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 91
cgctckcgaa ggccggccgc tttctcgact gyctggccct gctcgtggct nctgggagag 60
gaggccgcgc tgtgcagctc ggtggccgcg ccggacgacg g 101
<210> 92
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 92
atatttrtat ctcctttaat atgaatattc aagtagaaaa atgtaagtct nccactccat 60
gtttaatttt tgtattcaca ttttctccag gttttragag a 101
<210> 93
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 93
agaccagagt tattctcata tgaaatcctc gggaatgtga acagcgaacc nagctctgga 60
attgaaccat tcagctgatt atttgaaagg ttgatctccg a 101
<210> 94
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 94
agttggcgyt ggctggggac ggctcctcgt ttagagccct agtcgcagca nctgtttcgc 60
aagtcagaat acatatacgc cggtaatcgw tctgtttgag g 101
<210> 95
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 95
tgggttctcc actacatcag gcgcakgcgc ttttgcctgc tctgcactag ntgsagtggc 60
cttcttcgcc gctttcttct tgcggaactg ctcgagctga a 101
<210> 96
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 96
tggccagctg aaatcacrag catatcaata accaaattga tacactgtgc ntrtaggggt 60
taaaagraaa ggaaacgaat tctagcaaca aaaaaaagta g 101
<210> 97
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 97
gctgtttcca aacatrtggm agrcctygtt tacctgatta gttgggatak nccatgcwrt 60
grtkgttmtg atttgaattc ggaactttct acaatcagta t 101
<210> 98
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 98
catggctact tgcagtcyat gagctcgccg tcgacgaaga tgtggcagac natcytscct 60
ccgttctgag agttgctgtg wtggaakggg gaaragatga t 101
<210> 99
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 99
acccatggac tcaccgtgta cccatggact cwcctcgtga agatkgttga ngcargmttc 60
atgccgacgg cagccakccg ccgccgccgc tgatcgattg c 101
<210> 100
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 100
accacagaat gattttgagg gcataatgaa attctgtcac tagaacataa ntcccttacc 60
tgatagtcgy cggatctgtt ggygactgtc atttctatct a 101
<210> 101
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 101
acagagagtg gagagagagg acataattct atgagaacct cttgtttgtc ngtycaaawc 60
caaaagagag gtgtccccac gtagcctgat gacattatcy a 101
<210> 102
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 102
aacagcatat gataaataga ttaatatygg tcatgtctat aaggaatcac nagaaatact 60
aaaaaaaggg atatgrcagc aaataggtat aatagtcgtg t 101
<210> 103
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 103
tcatgagtga aggatctgat ttgttctcta aaacmmacgt ccarctcatc ngtryattct 60
ttcaatagyc ttcrttcrtc tgagtacatc tmtatctgcc c 101
<210> 104
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 104
tagrttccac atttgtttgt cggcttgtcg ccatgatttt acattttagt ntattatgct 60
aattgaatgt gtttgaagcg gaaattaaat ttggttrtcg t 101
<210> 105
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 105
gacccttsga gttaaagact ccaccaatta ctgcaggata tycgcgcacg ngattctacc 60
atcaatgaaa ccrcgkttaa attacaggag actgcagaag c 101
<210> 106
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 106
tgctacttaa aactgaaagc accacaagga tattatcata ttacatgtcg ncttgttatc 60
acaacagttt cggctcgatt cctttctact acctttgctg g 101
<210> 107
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 107
cgaagagcca tggggccatg gggaggaatg tccctggaaa ttggccctca ntctgggttg 60
ccagctcttg tgcccttttc ttttccttga tcctggacat t 101
<210> 108
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 108
aataaaaaaa tcccagatct tcgaacagaa atccagtata gtacttaatt ngaactgaaa 60
tccagtagta cttcagaacc gcaacactac aaagcttcca c 101
<210> 109
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 109
agtttgatta aaagaaaaaw tttacataac ttttcagtta aaatgaagaa nagggtccct 60
tggggacatc taatatatat aaacagaatt tgaacttcaa g 101
<210> 110
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 110
tacagcactt atgactccat tgtggacact aggatctcca gttatccggt ngtttgaaga 60
tgcttctttt tctccaactt yttcacctgy ttttcctttc t 101
<210> 111
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 111
gacaggtgat ctgctatcac cccrccaata aatgctccrc tggcacaccc natggcgaag 60
aggctgttca gtgctgctga gctgttgttg tcaaaaccta a 101
<210> 112
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 112
aaatcttctt tatactgaag atagagaagc atataatctc ttggagacag nctaaggtmt 60
cttatttgtg acaggrcaga gtagcctatc tttttagcaa g 101
<210> 113
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 113
acaaactctc tctaaakaga caattcggca gtaggtatat atgcatgtgt ntcatcagtc 60
actattggta caggtacact acgaacatgg catatatata c 101
<210> 114
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 114
ccgcgatcgt acatgcgctg gatctcttcc cggtacccgc tgagggactt ncgaggcagg 60
gcsggcgtca gctccaccac gtcccccatg ttgagcctcc g 101
<210> 115
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 115
gytatggatg ctagaatgga ttaagattaa ggagaactga tgtgatagac nttttcttta 60
acgttttttt ttatccctga agtaaagtca gtttggacgt a 101
<210> 116
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 116
catatccgca tatctgtgcr tttctagtgt aacaggtyga attacagtag nttgcgacgt 60
accagttgtg ggaatcaaag ctgttgttgc ggttgtctcc c 101
<210> 117
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 117
gagatcataa aggaagagtt taagtttatt actctcaaat aaagagtaat ntctgttcca 60
cgtgaaagca ttttctcagg atcaktttct tccttgataa c 101
<210> 118
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 118
ctcatgaaca ccggttgaca atggtgccag gctgccagca tgcatggatc naactcacac 60
tggctgtaaa aatagttttc gtgcagagtt ttttttytgt t 101
<210> 119
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 119
acctgagtac ctgacctgca taagcaaacc aacctacttg gttaacaata ntttgtaaaa 60
aagttagatg gtattgtatg acaagaagca cccctgattc a 101
<210> 120
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 120
gtgtttgcat gacattctct ttgagcttat atggggtagg tgccaaaaaa nagagattta 60
ttatcatctt atgacatcac aaatattttt ttgtcatgcg a 101
<210> 121
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 121
gtgtcgaatt cctcrtcaag ctcatctggg tttgcaacat cagcgtaaga natccttgtg 60
ttcatgtgtg gtgggaagcg yggscggaac cggtagttcc a 101
<210> 122
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 122
ggatccygaa ttatctacac ttgcataaag atacattagc aaacaaaaca ntgtgcatat 60
cttgctatac agaagtacca ataagtaagc caaacttagg c 101
<210> 123
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 123
taagaaactg atctccagac attcgaagga cgacccagac tccccatctg ncaaagagca 60
agttaggaaa gtcatttcaa aaaatttaga aaatgatgaa a 101
<210> 124
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 124
arcgsgtgaa tgaatcctga atatgtgtaa aatgcagttg ataaaataac nacattgtga 60
aacaaataag gaagactcag aatgacarat ggtatactgt t 101
<210> 125
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 125
tatcagccmt ttgttctcgc cacaaccgcc atattcacat atcacgaggc naaggtcaat 60
actagggtgc gcaacctggc aggatacacg ttgttcttct t 101
<210> 126
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 126
acatggtawt ttttaaccat ttmtgtacct tgttagtcat ctgagcctgg naatctgctg 60
aatcgtctct tggtttggca atcactgcac atgtaaatta t 101
<210> 127
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 127
tggcasattm gtcaatcttt cacttgacta gcacaagtgc actcatccaa ntataaacga 60
tgttctgcca tgccatttca tttgattgta tttgtatata t 101
<210> 128
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 128
ccttcacttg ttgagagttc cgcccctttc agcagtgcca gggctaatgc ntgtgtgtgg 60
aaaggcaaat ggatgtatga ggtgaccctt gagacgtcyg g 101
<210> 129
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 129
cggcgtctga gatcgcgagg ccgaggcttg tcccgtcccc gctccgctcc ncycacccac 60
ggtgagaatt ccgcgtgctc ggtwggcctg gctggtggtc g 101
<210> 130
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 130
acagggccta gmwgtagttg aaattatgaa acgatgacat ctaatcttgt nygacatgtt 60
aaattatygt acaagaaaag gtagctttat accgctccat t 101
<210> 131
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 131
agccatgagc aatagctaca agcctggaca agagtgagag agagagaagc nggaaggacg 60
gtgcagaaaa ttatgaagtg tcrtkttcct acatgggagt g 101
<210> 132
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 132
atgtctggga agttcaaaat aagcgactca gcagcatgtt gagcatcagg nacactggtg 60
gttcgtcggt gtgtctttgc ccttggggta gacgggcagg t 101
<210> 133
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 133
aaccccacgc ggtgggtgcc gtagtgctgc agcgcgaaca rgaacaccag natggcgcag 60
gttatcggga tgacggcatc tggcgaaggg aagaaattct c 101
<210> 134
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 134
ccgctactga attcttgctt cggcttctcg ctcctggtgg cagtaccctt ncctttggat 60
tccacatcaa tctcgtcctt gcctttcctc tttgaaaagc a 101
<210> 135
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 135
gattctgatg attctcctgg caggttcagt agtccagaat acaggcactt ngttatacta 60
tcaaggaacg ttmttgcggc ttctgtagca atcaactcaa c 101
<210> 136
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 136
gttattgatt agggcttact agacacaact aacaaatctg caccaagatt nattaaacaa 60
tcaccaggta tgcatctgag atgtcatcac gagcactgca g 101
<210> 137
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 137
actagagttg gagcaccrgc tctatctgga gcaatcgacg agatcccccg ngagtaccgg 60
atggyrtcgg tcagaacaaa cttggatacc catccttcaa g 101
<210> 138
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 138
ttagcacaac caggtctaag tcccactcat cagcaacttc cccgatgata nctgttggtt 60
tctgcccttc cccaagacgc tccatcaatc taaactccga a 101
<210> 139
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 139
gtggcttcgt ttcaggagac gggggatttc ttctcgccct tttcctcgcc ntgcggctgc 60
ggaataccgg ggccggcctg gatttgctcg agagtgagag g 101
<210> 140
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 140
tccacccgct tttgggtgtg tggacgatgc atggggrgag agagagggag ngggagagtc 60
tcctcctcct ccccgaccsg agcgccggyg ccatggaagg g 101
<210> 141
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 141
gtatggcagg aatttcagat atgacaatgg caacagcaaa caatgagaac ncgtcctttc 60
agtctgctga ggcgtctcag aggtatcaag ttaatgcccc t 101
<210> 142
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 142
taragttact tctacacatg gagctaatac attgggtttg ttcagattct ngctgccgtg 60
ctttttggag ttagcattgc cttgaaggac ggggccgaga a 101
<210> 143
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 143
ggtggaagat cgaagaagcg cacctgtcgt ggtcawagga agagaagatc nggaaaccag 60
tgggatggcg wwgatcagga ggcaacagtt gcagtgcctt c 101
<210> 144
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 144
tgggagtttg ttgcagcgcg cgccgccgcc acggaatcct cggcggactc nccctggccc 60
tataaaacaa tcacgggctt ccctatccct cttccccatt g 101
<210> 145
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 145
tactcagccc aaacacgctg tgaatcaata aactcactct cccatggctg natgtaacga 60
tacaagtttg gaatgagctg gtcctcttca tggctcatgc c 101
<210> 146
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 146
tggttgcttc aggcctgaga gagacccctc acaccttctc tgcagttctc ngtgcgtgca 60
acagctgcga ggggctgcaa ctgcatggcc gggtactggc a 101
<210> 147
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 147
tggaggaggt acatgtatat tttccctctt gatgaggatg ctgacttgat nttaggggaa 60
gcacagtcct caaaaacact agagaattct gaacacaaca t 101
<210> 148
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 148
ctcaaataca atagagaagg caggtacatt aaacyacaac tatgaaagta ngaaatcaca 60
ttggaaacat gtasygatgt acctttccta tgcaattaga t 101
<210> 149
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 149
acatcattat tttcaatctc agttattcat gagtacctca aggagagatg nggttacaaa 60
tgcatagcct gcacttgtca ttgaaaagag ctttacatct a 101
<210> 150
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 150
aggtagtgct tgtcctcatc tcaatgaagt attatgtgga aactatggtt ntcattctgg 60
agtgttcttt gcacctaaaa tgttgtgcac agttctttca t 101
<210> 151
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 151
ccagattcag agtgcctgtc actggtgtca gagaaggtat cagacccagc nctactggca 60
atgctcattg cctttccact tgatactgtc cttctatgtt g 101
<210> 152
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 152
tcggtgtctc sgcactgcag taggtgcaga ctgcagactt tcatcactcg ntcgccaggt 60
gatgagctca taaggaaaaa scaaaagcat caagcaagca a 101
<210> 153
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 153
tcattcgtat gytgcaactt ttgtcgagaa ygtgctgatc accaaktatg ntatccttat 60
tccaagggtg actacagtaa acaggtgtgt aaaattccag t 101
<210> 154
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 154
ttccaaatca aggggtagtg atccggaagg agactatgat ttttgtaagt ncgaggctca 60
agatcttatt caaggaaggt ggctatgata cttttgatcc t 101
<210> 155
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 155
ttgtttcttg gatgtcagtg agaactccgt cctgcaaaaa tggtcagata natgacattt 60
tgaaccaaca gaggtttgag gttatgtgaa gaaatttgac t 101
<210> 156
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 156
gccgcgcatg cacccgtccc ggagttygag ccaatcgatm ccggcagcga nctcgagrac 60
gacggtcagc cccttaaact ccctyccctc tgctcctttt g 101
<210> 157
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 157
atcttcaatt tgatagatgg gtccacrctt acccattgct gagtcagtag ntcctttttc 60
gcagaatcct ttgcgtccaa agaattctta aggataatac c 101
<210> 158
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 158
gaagcccatc agaaaaacag arcgaagcca atsgaaggac tggaggaggg nagtagcgtg 60
atagtgatgc cgtagtggtc gagctcgcgg cgragyagag r 101
<210> 159
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 159
aggggggagt tcgggctcat gcatacaawt caaataatgc aactmcttca nggaccggaa 60
atgtaaagay aaaggctcct gtggtatgag ctttgatcct t 101
<210> 160
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 160
ttgtccgccg gcagatctgg cgcgcgccgg cagmttgttc agcagagaca nagacgacga 60
aactgacaaa ttctgcagga gcttgccagt tgccagatac c 101
<210> 161
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 161
ctcctatcrt ccaagaagaa gatgctgtcc ttgaaccccg ggtactgact nacctcgtat 60
gacctggagc atcctcgccc caagaacagc atccggccac a 101
<210> 162
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 162
taagtttaaa tgtcaaacca gamatttcct tcattaaata tcacatctac natcctgtta 60
aaagaagttt ctcgtaccac aactacactt kcaagaatgr c 101
<210> 163
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 163
cgaamgggaa ccctggcaga cggcayctag gagacscgga gcgaaggaat nagagagggc 60
ggtaccttgg cggcgttgaa gatctcctcg gacttctgca c 101
<210> 164
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 164
tccccacggg ccgctcrttg tgtacctcag ccatcgatcg ctgctgtggt ncggtgacgg 60
tgagcggcgc tgtgcaggga gggggaaaaa ggagaggaga g 101
<210> 165
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 165
atactgtttt accatacyga taratgttcm atctgttaat actgatygtg nrattattac 60
ttgtcttggt aggctgggat tgcgaagaaa gagaacatca a 101
<210> 166
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 166
cagtttccat tcttkaamag ttygtgcaaa ccagtccaay gatatacatg ncattatttc 60
tgtttctttt gaattctatc tatcccatca gcgtttgttg t 101
<210> 167
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 167
ttatctggaa cacccctata tygttcttag cactcatttt aactgttaat ntggcagata 60
attatctata attstaacac acctcaataa tcctgttttt g 101
<210> 168
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 168
gcatatcata aataatgcca taatcgccaa tgttgctcag agtaacttct ntgttctgac 60
ccttcttggt cctatacttc aggaatttga ctacaccgag t 101
<210> 169
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 169
actatcttra gcaattatcg tsaattccat cttacgtgaa taattgatgt ngatatttgg 60
acttcagcag ttgggagagt aaaaggcaat cagtcgctca t 101
<210> 170
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 170
cccaatcaac acaccaaccg atgtgagtct tggccggctg gttggtggga nccggcggac 60
agcgtcgcca ggctgtgttc ccccaccctc cagscwgcct g 101
<210> 171
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 171
gtaacaatgc cttccgatcr accctrcyga ttcttttwtt tggaagacat nagtcataay 60
ttagtgtaaa gcaatcttgc tgaagaaata gtcacttgag t 101
<210> 172
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 172
cgcgaagact aggccacaca gaagaacaac aaacctaatc acacgctagg ncgatttccg 60
cgaataaata cacaggcacc gagccggaag caagcccgcg g 101
<210> 173
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 173
cggcgtggtc agcaggccgc cgctgacggg aatcatccgg tgctccaatc nccatttctg 60
cctgcccgtg grycggaatc aatmaaaatt ggatcgaatt c 101
<210> 174
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 174
atagatcgaa caaacccaar aaaawcgcaa gwacaaatgt ttggacgagg ngcaggaaaa 60
acacaagaat tggatawgag ggaggttttc atgaggtcaa c 101
<210> 175
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 175
aagtatgaca taggccacta atacaacaca attttctttt agcaaacttt naactgacat 60
aagatgtaca tacatgttca gaattgttag ccttatcctt c 101
<210> 176
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 176
actcttgtgt ccaatatctc aatttcctac tcccttttct gcttatactg nccatgctat 60
tgtgcactag tgcactgaat attttatttt gcgctcaggc a 101
<210> 177
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 177
ttttgccttc cgactgtagg ttccaagata tttggaagct ttggatcaga naatgtgaga 60
tttcctatag gagaaaatgt tgttttactt gttctgggac g 101
<210> 178
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 178
ttctgttcct gagcaattca ttgacgttta tgatggtatg gaattaccag ngcttatamt 60
tgtaataaaa ttgtactccc tccatttttt atttgtcgcg t 101
<210> 179
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 179
tcttgtgagg raggatgttg atttaaggaw tctattctrt ggagaaacaa nccgcatgtt 60
gcaaraacag ctcaaactac tgaacckcag cttctcaaag t 101
<210> 180
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 180
taatctaagt tccaacakaa aaacttcatc ctcagtgctt tcccaaactt nagcacatga 60
tgaacactgc attgtagaat ttgagcaaat ccaggatttg t 101
<210> 181
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 181
gcctccgcca caccggcggc cggtgaaccg agccgtggcg ccgactgccg nggctcggcc 60
gccgaggacc ccataaggag agtcatgttc ttggctccct g 101
<210> 182
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 182
tgggttgacc ataatgtttg aatgaattca cagctcgaca aaactgctca natttcacaa 60
caaaaacgac aagcatggtc acgcttcaac tttctatatt k 101
<210> 183
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 183
ccagccaata tatttttcct gttcrgcgtc atagcagtgc tctccctcgt ntttgtgatc 60
ctcgtcgttc cagaraccaa aggactgagc ctggaggaga t 101
<210> 184
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 184
tgacatggag gagttttggg tcaagaaggc tgtggctcaa ggactggttg ncaatggtaa 60
tgagcaggat gtttggtgag tkcatcagct tgtgggactg c 101
<210> 185
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 185
aaccatgcaa tgacatatat gttcacactg acacaaaatg caaacagcca nctaataggt 60
tcccttgatc ttgcatgaca taatttgtaa ttacactgat a 101
<210> 186
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 186
ttatactaca aaacagcaag acacagattg gccaggccag cagccatacg ncaagtacag 60
ccacgacttg attaaatctt acgcatatca cagcgccatg a 101
<210> 187
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 187
tcttgttttt tttttaaagg gagagagart tactcttgat ttcacaayca ntgatcgygg 60
tgawaagata atcgtgagyt caactccgaa ctccataaat c 101
<210> 188
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 188
tggttcatct ttcttcttga crcacctcgt tttttatcct accaaatgtg ngtgtatata 60
watmtttcca ggctcgctac ttcttccaac aactcatttc a 101
<210> 189
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 189
ttattttatc tgtgtactct caacgtagaa caggaaatgt atgtagctag ncgtggtagt 60
gaatggaaat atgtaatctt actgctgcat acttcagaaa a 101
<210> 190
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 190
aagagtagca aatattttga tcacatcata ggcacatcac atcacawtat naacgaacta 60
atgawtcrat ttacatgagt cggatgccca agagaaaaag c 101
<210> 191
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 191
mtgacatttt aattgttrgt acccgagatc cggaaaatga ckggaaccga ngsrccaatg 60
gaagcgtcta tgckgragac ctgatgtagt traagttatt t 101
<210> 192
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 192
taccattgst acmaaataca cgagaatagt aggygcaata acaccacatt ngttatacta 60
gttagctttg cgacwgtaag cttattgatt gcaacgatgg a 101
<210> 193
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 193
atggccatta aaatgctcgc atgaatgttc aacggaacac gtaayacagt ntgagtgaca 60
tcattaattt gctaccaaca gaaattcata tattgcattt a 101
<210> 194
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 194
gacatccatg gagaggatgg kgcaggtgag agatggggaa ccgagggact nacacgacgg 60
cgccggcgac aagggggaag gagagccgca tcctgattcc t 101
<210> 195
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 195
atccaggaag ccracgaatt cttcaggagc atggaggccc agatcgacgc nttcycgtta 60
ttaggtgatt atgtttaact aaactgagtt gataatcgtc t 101
<210> 196
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 196
caagatgaag atgctgyaat tgcagcagta attgatgctg ctgaactcaa ntkgtaagca 60
taycacattc tcctatttts acaaaacggt atggttttts t 101
<210> 197
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 197
gaccaacaga acaacacaga cacacagcgg catttcagtt tcgtttcmga nwaaggaagg 60
aacaaccccg rcccacamgg cagaaactgc aagcgtacag a 101
<210> 198
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 198
ygaagatcaa aatggactac tcaggaaaga tagaaatcct aayctggaac nccaacaktt 60
tggaatggta cgtcctgswg gcasagccta tgmatgaatg c 101
<210> 199
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 199
tctgtttgca ccttgggagc cttacctttg tacaatgttc tgtggtactt nagccacaag 60
gacttgtatt tatatttgtc tataaacatc tctcttttct c 101
<210> 200
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 200
cattgatatc aaatagttgc aaggctgttg ctattcttgc agggcacaca nctgaggtct 60
cggtgcttgc atatgaatat ggtcgaaacc tggtttgtaa a 101
<210> 201
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 201
aaygctcgtg taatggtcct ggctgctaca aacaggcctt ctgagctaga ngaggccatc 60
cttaggcgct ttactcagat atttgaaatt ggaattcctg t 101
<210> 202
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 202
ygcttaataa aatgaaaggc gtgcatcata tccaaagtaa gcattctcct nwgagttycg 60
tgtcattcat ytctgtgaca tgatctttgg tgctgggcag g 101
<210> 203
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 203
gccatcatca cgccgtaagc gacctgcttg ctatcacgct agctaggcct ngctggtgtc 60
aggacwcagg aataggraga attctgctcg ttctgggatc t 101
<210> 204
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 204
aaaaccataa agcgcaagta ctccaaggcc caccaggcca ccacgagggc ncattcctac 60
tgttagtttt gygaattcgg aggcrcagcg ccaccwactt s 101
<210> 205
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 205
tcatatagat cccccatgtt kacccagagc tacargccct acgtgmcgkg nccggcaggc 60
atctcagagt gcacgatgtc gcggccgscc gtcattcact g 101
<210> 206
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 206
caatcaacct gatttcttat gtgcttcatt tcatgatmaa taaaaagats natcaatcaa 60
atggatgtaa tgagtaacgg tgagtcataa taaacaaagc c 101
<210> 207
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 207
aattgcagsc ggtcctgcac ggcgaattgc agccagtcgc ccagtgtgaa nttctgaatc 60
cttcaaggtc caatgtctga atggagctgc caagagcatc c 101
<210> 208
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 208
tggcagtggg tatcatgtta arataggagc tacaaacygt ctttgagaaa nagttttggt 60
ttagtctctt gcatcgtttt ggtctccaag ttttgcctcc t 101
<210> 209
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 209
catggttaaa atattgrcat ccttcggctt caaacagaca aaaccccaat ntgaatccag 60
acaccaaatg tggtccagag tacaaggaga atcacgyaag a 101
<210> 210
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 210
gagctgacct gtacccaaac ccggcctcac gaagttcctg ctccgacacg ngcgcgagcc 60
gctcgatcgt ggggaaccgg tggaacacga asccaccaac c 101
<210> 211
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 211
atgtttgtgg tgcagggaat cggcaggctg ttccgatgct tatgcaatcc ngcttatgat 60
gttgatgatg attttgagcc ccacaaatga gtcctaaaga g 101
<210> 212
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 212
gcggcagcta accgcgcggg caagatggct gcagggcagc gggcggacag nggsstcgga 60
ggaggacgag gcggcggtcc cgtacgtgga cgtgcctcgc s 101
<210> 213
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 213
acacctcctt cgaaatcctc ctcctcctct tcctcctctt cttcttcytc ntcctcctcc 60
tcgcsttcct cttcctctag aagagcatcc tgtggtcctg a 101
<210> 214
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 214
caagagacga ctaggtcatt tcattatgtg tgcggtrgtt ggatcatcta ntcaacttat 60
tactagctag cgttcgcaag aaacaagaaa atggagacga c 101
<210> 215
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 215
caacacgatc ctcgtcccca acaagtcagt ctgttatttt atttacgcct nttacgaatt 60
tcacttgctc tgattagtga ttacttgaat gtttrgtttt t 101
<210> 216
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 216
atagcttcag agcctaaaag ttgttamaay aatagggaaa agaagtgtca nacttctgtc 60
actagaattc aggcattgct ggagtcaaac attaagcaac a 101
<210> 217
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 217
gcaacaaaaa aatagtgaaa agggatcccc ccccccaaat aatgtataca ngaaacaacc 60
ttttaagaca gttttgtagg aaaccctgtt agtaatctta a 101
<210> 218
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 218
gatgkataga cctgcaacac actaggaatt caggatatgg tataattctc naasaacgtt 60
ttgcacgtat agaactctgt awwcttaaaa caccaatcta a 101
<210> 219
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 219
ccgagagatt aataaactag ctgggacgaa accggaaatt aattcatttt nagcagagaa 60
gagatagatg atccctggcc gattagggag acgtacgctg c 101
<210> 220
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 220
ctccccctcg acgctactct ttggagtgaa gtctgactgc tggttggcct ngttgctggt 60
gggctgttca aagaaagagc tagggatctg gatgtcagrc a 101
<210> 221
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 221
ggaattcaga tcaggatata tgaaaccaaa ggtatmttgc agagaaaygg nccgttccca 60
cacattctga accagatyct ctcgtgtgct caraacgaga a 101
<210> 222
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 222
tagackactt gcytttcttt gaggtatatc aagttctgat gaatggcctg nactgccact 60
tcaagtttcc gaagctctag ttctacaccc tgcacaaaag a 101
<210> 223
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 223
gctgatccgt tccggctrcg asgatcgcag gtgtatgcga cgatcaggac ngggtccatg 60
gcgattgcgg cgtccacgct cgactcgttg ctggatttca t 101
<210> 224
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 224
tatgggttca ttctctgcta attccaaagg caagggaatt cttgtggatg nacccccacc 60
agcaatttgg gaacggaact gctttaaatg caactgatca g 101
<210> 225
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 225
gagactacaa aatcgacagt gttaaatgac tcttgctgtg ctgaaaaata naaggctgat 60
gcctgctcaa gatctgtatg cgacacatct acagatccat c 101
<210> 226
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 226
tagtacgcat ggccagcatc attcttggaa atgtagtaat gttcgatcct nggtaggatc 60
acctgmttaa ttccatgttg arctgcgtgc atgcaggcgg c 101
<210> 227
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 227
ttccatttcc tacaagccag caagataaat cagccttaca gataaaatat ntctccctta 60
tcaatgtaaa ccttgaaaaa aaacccacct catcaagagt g 101
<210> 228
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 228
tgtcttgcat agtcaagaat atccttttcc tgtagttcaa agctttggat naagatacat 60
tatttcagga ggtctgagwa amcraaacat tgtagatacc a 101
<210> 229
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 229
gtcaaccgaa gctaacagcc taacactagt tcactgactg atcaatggcg nggcaggtgc 60
ccatgctcrc taatgctgcc tctagagcgg tagaaggagg c 101
<210> 230
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 230
tttgtggaac rcaattcaca tcgatgcagt agaaccggat tctgcatatt nagtygtaac 60
agaggtcatc aatttgtcaa aataaaataa aaaaacaaac a 101
<210> 231
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 231
acattcatct ctgttaacca ctccttctgc ccctggagaa agatcrtatt naattagaat 60
caaatcatac aggaagctag acctagattc cagcatacgw g 101
<210> 232
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 232
tgctatgcat cagagaggag gaacattgta gctaggctac caaataaata nttctcaaag 60
tcttttgact tttgatataa atccatggtt ttgacttttg a 101
<210> 233
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 233
cgatggatgt aatgctctct atcgggagga acaccaacct aatccgagaa ncatctgtgt 60
cagtactgaa gcaaatttaa tcatgccatg caactgcatt t 101
<210> 234
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 234
agtgaaatat ctttctgctt ttgcatctga attattgggc cccagattgc nattggacca 60
gctacccgaa tcagctatca gccaatctac aaatgtctgt c 101
<210> 235
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 235
ttgaggtagc taagctcgtc tgtgtctcta tttccaaatc cagcataaaa nggatttgag 60
tcgtgtggaa ataaatcttt gatggcctgc aaaggacaga g 101
<210> 236
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 236
tacaattgca ggaagtggag aaatckccag agcagacacc aagaacaaga ngggaatggt 60
acttccattt acaccattgt caatcacctt taacaatatc a 101
<210> 237
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 237
gccgcggtgc tcgccgaggc catctcctgc tgcttgttga gcaacgtcga ngaygcatgc 60
rcttgtaata agaccacggc cgaatggctc gtccaggaat t 101
<210> 238
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 238
atacagttgc atggacctgg ggcaagaagt gtagarcttg accttggtgt nagccggcac 60
aaagaaaacg tcaccttcct tcgcctttgc actgccagtc a 101
<210> 239
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 239
cttgtcagat tttattgtgt tccaataagt acctagacaa ccgaacaact ntgtatggaa 60
aagaaaaggt ctcaggactg ttagcaatgc ttcctattca t 101
<210> 240
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 240
ccctcctcca gagccckgct gcgcctctgc gccccttcgg ttcgatcgtg ncagagccct 60
cgcgattgtc agggaattcg aggagcgggt ttggttttgg s 101
<210> 241
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 241
aatacagggt gcatatcgag ctctcagtga atcaccactg cagctaaaca ntatacctct 60
aaaccctaay cctaaaacca aaaaatamag ggtgcacaac c 101
<210> 242
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 242
gaaaacgact atactgattc agagstataa atttagtgct sagaaactga naasatcgcg 60
ggacaagttt taaactgyag atgagtatga tagtaataaa a 101
<210> 243
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 243
tttgatggtt atcatcgctt gtattttsag gagagtgagg aagaggtaay ngataccgag 60
caggcagaaa actggttttc cttaactctt cagctcagcr c 101
<210> 244
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 244
tcagcaaact cacaaatatc atcatcatta catcgctgat cccataatgg nctggtgtct 60
gataacttgt aagaattcag attgcgtagc ttgccagggc g 101
<210> 245
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 245
ayggcgcggc gagctgaggg agcgacgcgg ctgggctgag argagggaca ngygcaggag 60
ctgggagctg agcgtcggcc tgctggaygy cgckagggga a 101
<210> 246
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 246
tatgtacatg ccagatgagc agggtgatgt acacagaact aggtttttcc ntaggcatat 60
tatatggttc accacgatgg ttaacagagc cgtcttccaa a 101
<210> 247
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 247
tctgggacat gtcaagggaa caattttgtt caaggatcac aaaaaacaat nttgctgcaa 60
gggaaattat tcctttcttg cagtattact ggcctacacc t 101
<210> 248
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 248
tctgttgtca ataagagtat gygacataat aaggactaar aaggaatcca nacctgcata 60
acaaggtcga attctgcaac atttgcttta tatccattgc c 101
<210> 249
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 249
acggccacgt aggattctcc agcaacatca tttgctaaac tatccacttc ngctagacag 60
gaaaacacgg tacaaaactt cttacataat aatgtcttca a 101
<210> 250
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 250
tagagtgatg gtttcatata tagacacaga accctaaccc taatgggccg ncakcycaac 60
agtggtacca gcccaactac acatacaata aaagagcaaa c 101
<210> 251
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 251
gagaagatat ccagcattgc gacaagaatt ccccagaaag ataaagcggc nwagggaaag 60
gctggggaag ggatcaaacc ttgcagattg gtcgctgtgg a 101
<210> 252
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 252
agaatgatct gtcctctttt tctccatttt cttttttcty ttagtattac nctgtattgc 60
ttcgcgtgta atatgttttc ctgtaatatc aagtgagggc g 101
<210> 253
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 253
aagagagagt gtaatcatta aaactttctt atcctaacat tgagcagcct ngagataaaa 60
ccaaatggga aaaaaagatc attaggacga ccacctcatg c 101
<210> 254
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 254
agagaaaaca agcttacttt taaatcccgg tggtacacac ccctgctatg ncaataatca 60
actgcattga ttaactgttg gaagtacctc cttgcctcgt c 101
<210> 255
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 255
gatgacctac ggccacaaca acacgctccg atgtgtcatc tggcaactcc ntgagcagtg 60
cctgccaygc atcctcggac cgagsccata ctcgctccag t 101
<210> 256
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 256
gagttcctga tgtttccaag agagctgcaa ctctctgggg agtcagccaa nctaatgaag 60
cttggggaag cagtttcaaa ggttagcaat tgctggcaat t 101
<210> 257
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 257
gacagcagcc catgcgcaag ccaaaatggg aggtccacct tggcgccctt ntctacctgg 60
atataaaaaa gaaactcaga ycctctttta tacaagcgaa a 101
<210> 258
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 258
gactggccgt caaaaggcca aagaacagaa taacacaatt cacatggtat nttttcaaga 60
gctctagtga caggccaaat tcttcaaacc ttttataaag a 101
<210> 259
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 259
tcgtgatggt gtacgaaaaa atgtaagttc ttcrttayaa ttagttcata nattgccttt 60
tgtgatcttt catgttctct ctgctgttct atttctttca t 101
<210> 260
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 260
aattaaactt ctgccacaga caccactcca taacatattt gatcatgctt nrgaaaatat 60
agagtataat atgtatgtag tcccattcta aattcagctt a 101
<210> 261
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 261
ggyggtacaa acaaaggagy gtcaggggtt gagggggagg ggtaagagtg nttctttttc 60
aaggaattac atgagctagg gaattcatat tcgagggcta a 101
<210> 262
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 262
ctggaggacc agccrttgta tcatatgcat gacatggtct cactttacct ngagaayaaa 60
acaaatratg cyactcgtgc tcttttatct gattccattt c 101
<210> 263
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 263
ttgagaagca gaattcagga tggattgcag cacagcaaga rttaaaggaa ntggcacaaa 60
tggcattcaa ggataaagat gatrtcarra atacaatcaa t 101
<210> 264
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 264
acgcggtttc gtcctgacca ttgccatgtt gctttcttct trgacckgtg nttggttcca 60
ataattaaag tttagtgtgt attatatgga atgtttgaat a 101
<210> 265
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 265
atgaagtccc tgtcagagat ggttgatcca tctatccgag gagagtgttc ngtgatacta 60
ttgtcatgtt ttgcagacat catcagtcgg tgtattcagg t 101
<210> 266
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 266
gcaaaaccat ttcaacaatg gaggtactay rttaagtcac tacctagctt ngttggctga 60
aattcccaca atacatcttt gtcaagggca ggaactgaaa c 101
<210> 267
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 267
catagagaaa ctgtttctat atgtagtgta atattctgrt tgtttggagc nctkctatgg 60
aaacatcata yggwtcaaga acwatatgat caaacactaa c 101
<210> 268
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 268
gaaccctgaa tcgagggagg cgaggagggc agcggaggag gggcgcggac nggaaggggg 60
aggcgttata taaagggacc aggccacagc ggcgaggagc g 101
<210> 269
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 269
ttcatgaaca gcatgcctat caaccttgtg tccatctcgt tccatmtcmt ntttaagtga 60
actcttcttt ggaagaycct gatggcaaar gaatgtgaag a 101
<210> 270
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 270
ccactagcag aggtgtggaa tggagctatt tgctttgcag taaattgaag nttaaaaagg 60
cttgtagaag taattagatg tattccttaa tgcatctgcc a 101
<210> 271
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 271
ccagtgaaaa tgcaargaat tctccttggg tatgttgcca tagcctttac ntatgagtaa 60
gacttttact ttgttgcatc cttggggcag caggcagctt t 101
<210> 272
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 272
gaaaatcaat aackgygttg acatacccag tatggaattc atgatggaag ntctaacaac 60
acatcatgtg cctagtgagg acatggcact tgttttatac a 101
<210> 273
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 273
gatcttgcta gctatcttst accaaattat ttccatgtct gattgatttc ntcatttttc 60
agaggttgca aagaaggctt agacaagaac agatcttttt t 101
<210> 274
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 274
caaactgggc ttcaatgtga acckggtgag caatgcgtgg araccatggg ncaaatgyct 60
tagcaagtta ccaatgcctc gggttgccgc ttgtygcaya c 101
<210> 275
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 275
gagattcagt aataaacttg ttcawaccag kaaattttgg raaaccaagg ngagtgcggt 60
tgacagatct gccagaatct agcagttgaa ttcaaaaaaa a 101
<210> 276
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 276
tgtgtgtcgc aacgctctca aagctgagac tgtatgtgta ctggtgtaat ncacttgtca 60
agatgagcac gtacgaactg ttctcttggt atccctcatt t 101
<210> 277
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 277
catccatatt ggcsaacagg gcatctgtac gtgaagagcg acgtgtacgg nttcggcgtg 60
gtgatgctgg agatgctgtc ggggcagcgr gcgctggacc c 101
<210> 278
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 278
tccacctttt tgctgscttt ggaaccatca ccatcttgct ctccttctgc nccgccttcc 60
tccgcctcag cttttgactc gtcgaactcc agcagctgca t 101
<210> 279
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 279
tacgcctccg agtggaacga cgacgagaag agcaagggac tccatagcgc nagcctcaag 60
ttcgccgaga acagccgctc agagcgcggc aagcgmaacg t 101
<210> 280
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 280
ttttcctttt cstttttatt tttaatttct tggttcggtt cttgatcacc ngttcttcct 60
tatccaggaa attagattat caggtgcttc tatttgtttg t 101
<210> 281
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 281
accggccaga cagcagctag ctatagcyct aaagattgcc ctgacctgat nagatgatat 60
gagctttttg caagatggtg gctatagcag ctagaktagt a 101
<210> 282
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 282
atcttccaaa gaagaaggaa gagaccatca ccctaaggcc gctgagcatg ncagatctga 60
aggaagcaaa gaaccaggtg gatcyatgcc ttaccaagyg c 101
<210> 283
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 283
cggcccgttc tttcccatca tttggggccc atctgagaat tctaaggccc ntcccgccgg 60
cccggctacc agcctactca ggcccttcaa tctcagccgt g 101
<210> 284
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 284
tttcgcctgt gtgtggaata aaatacaaag atcaggaccg cagaagtttg nagcagaaat 60
ggagtcagta gtgcatatga tggatgtata tgatgtttga a 101
<210> 285
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 285
gatagctgaa caaatcatgc aacmacaaay aaaacacacc aataactgaa ntatctaccs 60
caaatttaaa tccaggtaac attatatagc atgatacaat a 101
<210> 286
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 286
aacagtgtts tttggcaatg attattygag tgtatcttcc atgcttactt ntgttttaat 60
gctatgcagt tgctytagca agaatactgt ttcctatgga g 101
<210> 287
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 287
cggatcatgt argtcgggtc gatgtacttg agrgttatyg ggaaacgkgg nttcttcttg 60
aaatgatcct gcatgtcaaa gaaatgggat aaaattcagc a 101
<210> 288
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 288
attcaagtta tctgtgttac tgatggtgag cgaatcttgg gacttggaga nttgggttgt 60
caggtatgat tgtctcgtta gtttcttatt acttgagggc c 101
<210> 289
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 289
csgcacrccc agtctcgaag gttcgccaca gcccaacgtg ttcagcgagt nccccgtccg 60
tgtttcccag acgtggacct ggccgtccga cggcactccg g 101
<210> 290
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 290
atcacaaggc cggaatgccg gactggcatg ttctattacc tgacaatgga ntgtcatcag 60
caaaattagc ctttgacttg agtcccccaa cttgttactg a 101
<210> 291
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 291
cacatctgtt taaattttct aatggaaaat gacttatgca catatctcca ngttcaaatt 60
taggaagccc tcgrgtycgg ggagatgagg argaggatgg a 101
<210> 292
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 292
aaaaatttta agcttaggta tcaaataggg agcgcacata gtckcacttt nctgtactca 60
ttttcaacat ggataccarg aaatgtawtt tytctctctc t 101
<210> 293
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 293
aactggtcat catgtgscag gtacccacca cacggtcgac gaaccgtggt nttggaggat 60
ggcgtgcaat gggacagggt gagggcaccg cctgttgaca c 101
<210> 294
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 294
attcagaaac agacatttga tcgracagct tcatcgcata atctacaaat nycaaacaat 60
atggctgatt cccctcatgc atctaaagac atgtcattat a 101
<210> 295
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 295
cccatttgta gtagttccct ctgmaagaaa tggaaagcga aaatcaattt nttcaaggga 60
caaaatgaag gaaaaaagat tgcatagaaa taagaatgct a 101
<210> 296
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 296
aacattatca caacctggta acaattaact gcaataaagt aaggagttaa nacgcatact 60
acaattgcgc ctcccaataa tctagttagg gccatgctat g 101
<210> 297
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 297
gatagaggat gtgagctaca amacttgaag gtcaaagtga catctggtat ntttctataa 60
ctacgatttt atgtatgtat gaagtgctgt aactctttct c 101
<210> 298
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 298
gtgctgtgta gaattttcag tagggaaagt atygtacacy gtttctattt ntaagcaatt 60
attttcaaga tccttacttt taccttgacc aggttcaaca a 101
<210> 299
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 299
tgtttctact tacattctct ggaccatact gcatcttttt tcyycctaat ntatgtacat 60
cttcattgtc atggttaagt cagatgcctc aagggcattg g 101
<210> 300
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 300
ttgccgttgc ttgggcgttc tcgcttctgt agtgcgtagt tggattcact nactcaatac 60
atagacattt atatatctga aatattaaat agacatttta t 101
<210> 301
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 301
ccgtwctttg tctgtcgctg gcggtgtgtt tcggtatgtt atttsagtyg ntcagatctg 60
ttaaaaattt tgtgagctat gcagttcagt tcagctctgt t 101
<210> 302
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 302
aaaggactaa aacatcrcac ctttctaccg ctttcccmaa ttccccaacc nctaaacata 60
tgggtcgaca gagatccccg gaattccatc caaaaacctt g 101
<210> 303
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 303
agaacttgct gccattctgc aactaaacta atagataatt cacttgctag natataaaac 60
taaagcacct gatattgccg atcttggaac actatctcaa y 101
<210> 304
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 304
aattaggtac ttaataaaar tgaattcatg acgcagtast acagaaatas ntgttaatca 60
ttgaaatgta ttttggacta tttctcgaaa cactgtaagt t 101
<210> 305
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 305
caggtcaagt atacacaaag taatagaaag gattctgttt ggcgtgtgtt ngattaagaa 60
atcgaaatac tagcaattag tacaaatgaa agaaacacgc a 101
<210> 306
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 306
gcctgatgaa cttgagcttc ttggaccatg gcttcttctc acaggctgcc ncytcctcgg 60
cagcatcact rccagtggat atgcamtcat ggaagtagta c 101
<210> 307
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 307
attatgtttc crgtccatcg ratcttcggg tacacgtctc agaagttytc nttgtggaaa 60
tggaaccggg ttgtggttgt ctggctgaat tctttcgaaa g 101
<210> 308
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 308
taagttatcg cgcagtggcc atacaaaaca cagagcagct tccttccatg ncacaccgta 60
tactagacaa accgtacatg catataaatg ggactgtctt c 101
<210> 309
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 309
ttacttattg gtatactgaa yctgggtaca gcgcggggag accaaccagg nactgttcca 60
tgctgccacg atatatagtg ctagtatcca acacggmaac a 101
<210> 310
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 310
ctcagtgraa aggcttgtca ccactgcatc aggcctgtcc ttctaacaaa ntacagtata 60
tatattcata actgattttt caacgaaaca tctcaaaatg a 101
<210> 311
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 311
ggaagcttct gctatgctaa gttgatarag ccaagttaag ttcyggcacg ngttaaacca 60
agctgattca gggggggttt ctctcaaagg aaaatcaaca a 101
<210> 312
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 312
caytgccgct tgacacaact tgttyagccg ccaaagaagc aaatcttygc ngcctcctgy 60
tgtcgcttca ratgcaagct cgcaaccctg atcaggcaac a 101
<210> 313
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 313
cctctcgccg ctttcgtcac cggggctctg agcggcctct tcggcatcgg nggagggctg 60
cttctgaacc ctgtccttct tcagatcgga attcccccgc a 101
<210> 314
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 314
agcttgcaat gtgtataata tatctacctg tttcttycca cawgttgcat natacaacas 60
gttcatgctr tgttattgct tcagcagcag ttgctagcta g 101
<210> 315
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 315
ctgatagcac ctgtgtataa agggaagttt ctcatggctg ctagaagatt naggcgtggt 60
ccccatactg agtacattat atctcttgat gcagaggact t 101
<210> 316
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 316
gccgaggatg cgattaaagc tgctgtaaaa gactacgaag ccaagaagtc naagatgggg 60
cagaagggtg aagacagccc ttcasagaag gctgctgaag c 101
<210> 317
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 317
agaattcttk cytatcattt tgcaacmtat ttcctccktt gcaaattata ngtcattata 60
gcttttytmg atacatgctt taactatgta tctagtttca a 101
<210> 318
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 318
gatggccgag cttctcgrac taggtgcaaa gaagttcggc atcaagcctg ncaaggtcct 60
gacagttggg ggtgctgaga ttgatgaggt ggagcttatc a 101
<210> 319
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 319
ggttagttag tcagttaccc tttcccaggg gccaaccctt cagcagctcc nctggaccca 60
catgcaacct cagcctgtag taggcacatg tcgtcasaga c 101
<210> 320
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 320
gattattact tctgaccagg ctaacttttc cacttgaata acaggaaccc nctttacctg 60
tttgccatat ttgtgatkta tctcgttgga aaagccattt g 101
<210> 321
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 321
ttygacagct ccgaaacccg tggacaaaaa actacactta agaactagtc nacaacaatc 60
rcgtctgttt cagaattcct tgaattaatc tcttcatgaa a 101
<210> 322
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 322
ggcaagtcgc cgctcatcat cttcgacgac gccgacgtcg acatggccgt naacctgtcg 60
aggcttgccg tcttcttcaa caaggtatgc tggcattgca t 101
<210> 323
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 323
aaaaggcaga agtaaaaaag atataccttt ataagcatat ctatatctcc nccactttga 60
ctaggagagc caatatttgg aataatatca ctaccactat t 101
<210> 324
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 324
taaaatgttg tgatgacata agggtgttcc ttttccattt agtatggcct nctgataaaa 60
tttctatctt attcaaccat tactcttgga attcagatat a 101
<210> 325
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 325
tcagctctct tattgcaacc tgggaccggc cattccttca attgacacta nctgctttct 60
cttttaaaak acagcaaatg ctgcttgaac tgtgatgtga t 101
<210> 326
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 326
saactgaagg ggagaaaaca acggagcgag atgcacagaa ttaagtaaaa nacattactt 60
ccaaagcatt ctttattttt ccactaagct ggttgacaga a 101
<210> 327
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 327
ctaataatcc tcactgatca ggcacgtgtc gtaggagaag agctatcctg nctgtcgtct 60
ctttatccca ggcataggca gggatgcccc tgatcttgac a 101
<210> 328
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 328
aagtgcttct gcagttctgc tagtgcccct cccgtcctct caatcttatg nagccatttg 60
gaccaatgaa tagcaatgtg caggtcaaca gtcaaatctt t 101
<210> 329
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 329
tgcagcaata acttgaagcg gtgtaacata gaagacaatt gctgctacca nacagaacag 60
gacaaagact gctgtggcac gagggtccct ccagctaagc a 101
<210> 330
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 330
ggatgtaatt ctttcagctt cagtacasac gaattcaatt ttaatcatgt nttatcagca 60
taaaacagaa agttagctca gctgtgaact tttagttttg t 101
<210> 331
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 331
tcatcgtcat catcgaaagc tatttcgctt ggctgatgag cggcaaccac ngaagcagtg 60
gcagcctctg ctttcctcat tagcgaattg tattgttcaa g 101
<210> 332
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 332
attgtttgyg ttgcatattg tatgtgacat accgacaagt ttctttattc natgtttttg 60
acaaaktcag tttttcgtgc aggaatgctt caatgcttgt g 101
<210> 333
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 333
aagtacaggt accttcacca tattgtacta ctattggttg ctcagacgtt ngagtttctg 60
atgatcgtca gtttagagtg aacatttgct tgtaaaatcc c 101
<210> 334
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 334
agcttaaaag tgcgaacgga gattatggaa taatagatyt acatgtgagr nagtcgatgg 60
tcgatgacac ggcaaagcat aaaggcatca cagctgaaac t 101
<210> 335
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 335
ccatatatca tttgcctgat caggctcktc ctcctacgca ggatcgatac nccatataat 60
ttgggattct aaggycccgg tgcagcttct tctcgcagaa g 101
<210> 336
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 336
aagcaaaaag gttggtttya tcacagctcc atgtcctcta gttcaggaag nggaaaacga 60
agtatagcyg ctattccwgt cagttgcgcc aactctgttc a 101
<210> 337
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 337
ccccgaagaa cggcacggcg atgccaacca gagctgtcag cactgcacgc ncgacaaaag 60
atgcatatgt aatcagatca gttcaatgcg tacgtacgtt g 101
<210> 338
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 338
ctggtgtagg gcaggaagac trcgatagag ttgcaatcag ramagtattg nagatctatt 60
tatragtgtc gwtggacatg ctttaaagat gtatatgttg g 101
<210> 339
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 339
aactkttgtt ggtatcctac agtttcagga aagaaacaag tattgatatc nttgtcggat 60
aaaackgayt tggcttatct tggcaatggt cttcagggtt t 101
<210> 340
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 340
wgtaacatyg agaataatct tttccaggat gtaatggggc ggacaatcaa ngtggagttt 60
tcwaagagct tcagaagacc agctccgcct cctcctccrg g 101
<210> 341
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 341
tcatcacaat aattcattaa aacayacata tattakcagt ccagcagcta ngtatgctaa 60
cgtgtagaca actggtgctt caatcacgtg acttaccttc a 101
<210> 342
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 342
gcgtcgcggt cgcggyccgc cgycgctcrg caccggcggc gtccctgctg ncatcgtccg 60
cgtcggcgtt cgcctgcctc aggcggctgc gggtgagcac g 101
<210> 343
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 343
gaacatacta aacccaatgg gccatggacg ytctgcccat aaatgtgcct naaaaagtta 60
caatttttca gagaggaagt tatggaacct aaaacgaaat t 101
<210> 344
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 344
agagaaccta acaaattagt agtagagaaa aagagtcagc aaaactgagc ngctagcrgt 60
aaaacacgta agaatgaaat wgacaatggg actataccaa c 101
<210> 345
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 345
aacttgacat acagctgtat tatattgaac ccatgcatct ctaataaagg nttaatttct 60
caccaycaat tcacgtcaat ctaaaccaca aaaaagaagc t 101
<210> 346
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 346
agtaaggaat atgcacatga aggagggttt tcagttcgta ttggttcaca naatgtactt 60
tttggtgaga tcatgaacaa gaggttcttg tgttcaagaa a 101
<210> 347
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 347
tcacatttgg gttccaaagg acgggacgct acctgccccc gactcyaggy nagctgsctg 60
aaggctcgag ggcaggcgga agggggaaag ctctagakga c 101
<210> 348
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 348
ggaggcgagg tggagcgcgg cggggacgtc gccggactcc agggacgaya ncgaggcgcg 60
gaggcggtgc agcgagaggg cgaggtggtc ggcgcagggy c 101
<210> 349
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 349
aagctacaag attaccattg gcagatactt tagtgggtgg aagaagtacc ngactctctt 60
caagacatct ttyttccttt gtgttcgaac cctgttcagg a 101
<210> 350
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 350
ttctgtctgc tccamggata cggattcatc ctgcacgcag gcaagcaacg ncgatcagac 60
ttgccagctt ccawgtacac ggttctgtaa tcaccacctg c 101
<210> 351
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or a
<400> 351
gattmatagm cgycrtgatg agakagcaga aaagttaaga tacagccacc ntttcctcta 60
tggatcaatt stcgcaggac ytwatctggt aagtgagcag g 101
<210> 352
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 352
attccacgaa tgttgtaacc caacctgcct ccaatctaca agaataagag nctaagataa 60
catataactt gcttatatgc aataaatgca aatgattttg t 101
<210> 353
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 353
caagttcggg ctcgaatcgg ctygkggtgg ctcggtattt agaactagct ntagctgagc 60
ctgttttttt gctcgaaaag agcgagccca cgagctggtt a 101
<210> 354
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 354
attcggtcca tcatcatcac ccaccccggg ccgttgccaa ratgacaata natggccgca 60
tgcagggaag caggggtcgt cgccgatcaa cctcgggtgg a 101
<210> 355
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 355
ttgctgtttc tgcttgctgc atcacaggat tacttggata ataacggtac ntatttgtat 60
tggctgacat atcttgtgga aaggytgaca tactcgagaa t 101
<210> 356
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 356
tcgaggctcg agcggcrgcc gwgatcgcca gcaacaccgt acggttacgg nccgggaccg 60
tgccagattt ttctattrat tygtaggatg cgtccacttc g 101
<210> 357
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 357
ggcgtgcckg cgagcctcgc gcaggcccck agcctgcagg cggttgacct ntcgtayaac 60
aacctcaccg gcmccatccc caaggtgctg ttcgggctcc a 101
<210> 358
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 358
tctccagatc cgaaacccta tatcactgaa tcacaagcca aagcacgccg nartatcaca 60
cgattarcmc cgagacctga tcacaggatc tgaacgttct c 101
<210> 359
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 359
ctgackgcay cgtcagttcg ccacgtagat gtattacaag aaatgggaag nggtaataga 60
gtaacccccg cgcgcacctg gccaggctcc gacgagtccc g 101
<210> 360
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 360
yggtacgtga ctacctggaa accggtcgar aygtgctcac cggacgcggc ngcggaggct 60
ctggagagct gggaaaggga tggacggcgg csgatctgtr c 101
<210> 361
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 361
ttgtttcaac tattttgaac aggtgaagta gcaaagttat tttcagacgc nggccttgta 60
tgtattgcaa gtttgatatc tccatatagg agagaccgtg a 101
<210> 362
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 362
caccgggcac acgtttctgg acgccaaggg aagggccacc tagcgacctc naccaatgcg 60
ggagaagaga agaagagggg cgaagygacg gcacgaaatt a 101
<210> 363
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 363
atcacctcgt acgtagttat caacgtgtgg aattttacat gacgcccacc ntttttgtct 60
gaaaaaaatt catgctgctg gcacatctgt ggcaaatagc a 101
<210> 364
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 364
cttccatgaa ctgatawgcg actgatgaaa ctrcttttca ataacagcaa nttttcagat 60
gtmtttgatg aggagcactt cataaattct ttagcaaayt a 101
<210> 365
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 365
aattcaatac ggaagaacat tcaacctact agagtctaga gtgtattgac ntcagcccta 60
acatgtaacc tatgggaatt tcattaactw tattgcactg a 101
<210> 366
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 366
aaaattcact cccgttgttt acaccacctc aaactcaacc attaagacat ncacatctat 60
atccacctcc tggtcaaagc tatgaagatg ctgccataca a 101
<210> 367
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 367
atagttcaca accaactgaa agtatcaaga cagatgaata gtaaagcggt nggtagtaac 60
ttcacctgaa tgacccacat gctcagaaaa gcctccaggc a 101
<210> 368
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 368
gagaaagagg ggtarcatcc aacaggagat aattctggat ctcatagyca ncctctcsgc 60
tcawgatagc agcctgsata gtagctccgt aggcaacagc t 101
<210> 369
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 369
aggwggtggt ggtggtggag gatatggsgg atcrtcagga tacggtggtg nttatggygg 60
cggcggcagc agyggctatg gtggtggtca gagtacgagt t 101
<210> 370
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 370
acccactcct ckcgktttat tcctctgaaa tgagctgtta cccggctytg nagtctccca 60
agagtyagkt ggcratgttc gttcagcttt tctacttgtt t 101
<210> 371
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 371
gttatgctgc ttgctttcat gaatttttta atcaatatgt tttccaattt ncacagagca 60
gtgaaaaaga aattgaagga gcggatggat gactttcagg t 101
<210> 372
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 372
agagcccgat cgagttytca gggcacctgg agtaggatgg cggcggyggc ngtctcccag 60
tcgtcgccgc gagaactgag aattcccccc gcggggtagg a 101
<210> 373
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 373
ataagtatta tatcatctga ttcacaggcc atggggcgcg ttggagaggt ntgrcacata 60
aatcctaaaa atttcattct crttattaag aaattacata g 101
<210> 374
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 374
gtaccaaygt taaattctta cgtcgtttaa tgcatcagaa tcatactgtt naaatatact 60
tgtttgctkc atgctttgac akattgttac cagaatgatg g 101
<210> 375
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 375
actggatcga gttagggacc tgcattttgg gtgttatttc gggttggatg ntggtttcgt 60
cctactgttg ctcgatgygc ctgatgtctw gttcttaatc c 101
<210> 376
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 376
gctactgtaa gtaaaactga ctgayyttag tatccgaatt caggatcatg ngtagtggtt 60
gcaaaaggat gaatttacat gtctctttcc agtaattttc r 101
<210> 377
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 377
gcttcctgaa ttcaggatca acaatcccaa tcatggcact aagaacacgr nsatcatcgg 60
ttattttgga actggcctgc tcaacattat tctggctccc a 101
<210> 378
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 378
wagagcgcca acctacagaa aggtttattc atcccgttct catggctyga ntgtaacctg 60
gtttgctcgt ttgcttccag ttctaggggt aaactatttc c 101
<210> 379
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 379
ctgtaaaggt ttgtgaattc aagaaactat ataatccaaa tcgaaaatta naatcgggtg 60
atgaggtcac ataagatact cacatgaaga ttttttttat g 101
<210> 380
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 380
tagtgtgttt ctgactgagg gcaataggcg tgggggatag aaaatgcctt nyccccacca 60
cccatccacc acctaattaa aattaactgt tgtatgctgt g 101
<210> 381
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 381
gagcaaaaga ttcgcgcart tgtaacaaat gccaagcaaa tacagaaggt ncaggagtcc 60
gtgttattac agttatttgc atctgcatcg aatttttttc t 101
<210> 382
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 382
gatttactcc actgcatgca gtgaagaaag agcctgggyt gcytgatgtc natgagaccr 60
cagataakca cacactacat tmtttggcag ctgckgcagc t 101
<210> 383
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 383
tgtatccagt tgccytaaag tgatgctcaa agttctatac aggtggttgt naataagcta 60
catccattrg atggatcaaa ctggacaaac atcatcttca g 101
<210> 384
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 384
tttccgaggg ctcacggtcg ytgctggaca gcagaccrcc tagcaaagaa nggactgcct 60
caccctcaat tttgtcccct ctgtgatcaa gaggaagaga c 101
<210> 385
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 385
aaactaggca tattatatga aatatttacg tcaaaatcct gtggaatttg ngtgagtagc 60
cgacaaatgt tttgctggct gcttatttaa aaaatataaa a 101
<210> 386
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 386
acaactcttg taggaagaga tactmtattc atgwttaatg tattygaata nctacatcag 60
gacaatattt ataactttky gtagtaaagg taatgctcac t 101
<210> 387
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 387
tctccatttc tcctagatga tttacggatg gcagtgaaag aaattatatg ngacagcgag 60
actgggcgkc aggagtacga agaagcagtt atagcaatta c 101
<210> 388
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 388
ggcgaatgac tcctgtctct gtctctgtgg atgaacccat gatcaccttg nccacggtgt 60
ctatgggaat acggcataaa aaacctgtcg tccatcatgc t 101
<210> 389
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 389
tgtgaagaag tctcgctctc gcgcgcccac gctcactctc tcagtcacat nctgtgttcg 60
atgcgatttc cagggagcac cgcggaggcc gcgccgtcgg a 101
<210> 390
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 390
ctgggttgtg ggctattctg gaggtggcat gcatgcctgg agtgctcttc nttacattcc 60
tgatcgaatt gctggtacct acttcatttg gttttcttct a 101
<210> 391
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 391
ctggacatgg caattttgga acagaggaca accatgaggt tacaaccatg nctactcttt 60
gcgatgtttg atctgsrtac ytgaatctgt ttatgatacc c 101
<210> 392
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 392
gctagcctcg aagcttccag ggwgtaggag tccacggagt ccccgaagga ngcggggcgc 60
gtcggccaga agcgcgtgtc cctggcctcc ctcggctgca c 101
<210> 393
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or a
<400> 393
taccattgtc ggaaagcgyc catttcaaac tgtattgggt tgatctcaat nagatttcaa 60
gagactgata rcaaatttag cttatagtca tggcatacgc a 101
<210> 394
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 394
gtggacatga aarcggctgc atgcttgtgt cgacgacttc ttgctgaaaa nggtgttctg 60
tctacctcgt ctcgtatagg cctatctctg gcaagaagtg c 101
<210> 395
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 395
agtgaaacct tggcaaagga aattgytgtt aacataacak ttcttgtgcm natgaaacag 60
gcttactatc taccggagac cgagtacgtc cactgggcgc g 101
<210> 396
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 396
ttcttttacg cacagatttg ggatgcttca tcaccatatg aacagatgat ncggatcagt 60
taattctcga tygatgckgg tggttttygc tcaggcattc c 101
<210> 397
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 397
wcagagagat aacagcgaga aaggcckwgg tggaagaaag cactgacaag nccaaggccc 60
tkctcaccaa gctggaaatg racagtgtgc tcgaatcact g 101
<210> 398
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 398
cgtccgcctc gcyatgacgc atgtcgtygt ctttgatctc agtacctctt ncgatacgca 60
cctggccgtg ctttgcctcc tcgtggtcag caccatttgg g 101
<210> 399
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 399
tgaccaaaat gatttgataa tcgcaaattg gcgatgaatc atggtttggg nrttttgccg 60
aacactaagc ggatgctgca tgaaccttca ctgcctacgc c 101
<210> 400
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 400
gcactgaagg gatraaacat trtagagtta ttaggaacag ctatytgaaa naatgtccat 60
wcaataataa acctctygaa gaaaatacag agcgcgataa a 101
<210> 401
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 401
tccgtggggc gtggaggagt gggacgacgc acgcggaggc agccccggtc ngttgctgct 60
gtatccgtcc aggatcgggg gaattccagg aggcaggtga g 101
<210> 402
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 402
caggcaggac amggatcacc gattcttgcc agcacatcag agcgcctcct nctcgacttg 60
acgagatcag magaatcaga cggtgcccag gtrcggaaga a 101
<210> 403
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 403
aaggaaattc cttacagtcc gtgccgtctc caatttgttc ttgcagggcc ngacgtttcg 60
tcggtgaatc ctcgagctgc ygccgtcacg tatgaggaac t 101
<210> 404
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 404
aggatggttg aagaaagctc gctggaaagc cgcctgatga tggctctgcr ncatttgtac 60
ttcagttttc aacttttcat catgttattt crttgcatga g 101
<210> 405
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 405
taggatgyta ttatccctmt tgcgtggcac aagggaaagt tggtagcayg nrtgactggc 60
aaaaagactt grtctarcat mtttcatrat attcaggtaa t 101
<210> 406
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 406
ttatgcatcc tgcaagctcc taggagcgtt ctccagatga ctgaatctgg ntcgaggctc 60
ataccatgga tgaattccac ggmttcatcg agcttcccag c 101
<210> 407
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 407
tccgcacccg cctacgcctt cttccttggg acaaatcgat tcacggcaag ncaagagamg 60
catgcggcag catcagcttt gccgcgcccg gccttgcttt c 101
<210> 408
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 408
tgctcgctgc ccttgaattc cagggctacc agtgatgttt cttgaggggg ncagaaatcc 60
arcagagtcg tttctcctaa caggaggcaa tactccaggc a 101
<210> 409
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 409
cgattmaagg tatggaagag aacctcacca attcrcctaa ttaacmtgta ngtaaaaaca 60
cyttctcrcg ttaagccgcc accacggaaa tgccggtrat c 101
<210> 410
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 410
gatacgtagg atgatacatc raatgaacac cttggaacac cagatctaca naagttcctg 60
tgatgatctc cggtcagctc ctgcgtcgtc tccacacgct t 101
<210> 411
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 411
cycagtttaa tgtttgccac caatagaggt atcatgttgc atgcatttca nttttacaag 60
caaaygtcaa ctaggagtat tgcacaaaca aggctcwtaa c 101
<210> 412
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 412
ccaatcagcg ctcacctctc gcgtcctata ataaacgcac crccccmytg ncttcyctmc 60
cagcaacagc caacatatct cctcgcattt tccttgcaac c 101
<210> 413
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 413
cctacagata gtccacgagt cctgcttgcg ccaaaarcca cgtttggaat ntagctcttg 60
gactgtacag taatgtgaam ttgcctgcag acgctagcta c 101
<210> 414
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 414
ccaaggccta cccagacagt acgcattaac aggacagaac catatactca naaacatata 60
ggtractttg ggggaccttc atctcctgca ggaagagtgt c 101
<210> 415
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 415
tgtccagctg agtkartraa tattacagat taaaagtagt attacagatt ngctgagtta 60
agaacttgca ttgcatctat aacctgcagg cttttaatgg t 101
<210> 416
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 416
tgcaggggag gagattagga gaagcacctg ttctggggtc cacttgtctg nggtcgtagg 60
aaccagggcg cggcgcattg gtcactgacc caagcggccc a 101
<210> 417
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or g
<400> 417
caatggcaga aataagmttt gaaaccatat tcaccttgaa cttgaagtcc nccaccacca 60
aaaaataggt gatctgttct tgataagcac tgctccttca a 101
<210> 418
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 418
cagttttctc caacatctta tcttcagctc ctctatcrgt agcygttgca nagtgaagta 60
catgtgatga gttagcttgg ttagggtgag cactctgtty g 101
<210> 419
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 419
tcccatccgg actataaata aaagcttcca ttattttgtg ttgcaatgta ntgttaatgt 60
gcatgcatca aaaaattaaa ttaaaagata cagttccttt t 101
<210> 420
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 420
ccctccctct gctcctctct ctctctctct acacattcca aagtgcacaa ngaacactcc 60
atgcaccatc atcaycacct cacatgtctc aatgcaaaag a 101
<210> 421
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 421
agcgckgcgc tcctayayag catagcatag ycaatcgcyg ttcagygaac ncttctgytc 60
caaataactg ccagagcctc aaaacaaaac tggtcttgac c 101
<210> 422
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 422
tatgcaacca agtctcagaa atacttttca caaccaccat catagaaaaa nttggtgaat 60
agaaaatata cccagtcata attgaagata ccaataactt g 101
<210> 423
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 423
cctaccgcat ctgtatggag gccattggcc aacaactaca cttttttagc nagagtccgc 60
tgttttgtgc catgctccac aactttctct tcgacatgca g 101
<210> 424
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 424
gtgtgcaagt tcagcgaact cccggagccc tcgtcgccgt cgatccttcc ncggctctat 60
ccgctgggcc gtcgaccatg gtgaaccaca ctttcacact c 101
<210> 425
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 425
aattgctaat arcaatcgga aatttaggga acgctgtaga tamygagact ntatgttgca 60
agttagtcay gaaagaaatt aagtattgca gtgcgtagga c 101
<210> 426
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 426
aaaagagcag caccatcaca cttaacgagg tccatgatat ttggactccc ngatacgata 60
ctcaagggag atgmttcctt gaatagcatg tcagagagca t 101
<210> 427
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 427
cccgcgccac tgttttaaat cccctgccgc cgctcaaccc cgccgtcccc nctctccggc 60
tctccgcgac gagatcctct gcaccggctc tyccccmttc c 101
<210> 428
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 428
arattgtgcg ggatcacaaa taacacgaag attagtcatt tttacagcac ngagactagc 60
ataggtgtca accaaagggg ctatacatgg caatttctat a 101
<210> 429
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or t
<400> 429
gtttatgaag tatgcaatga tttggttaga gttttgcatg actggaggtt naagaataat 60
aaagctgtaa tcaaatggtc tgagttccgt gagatatgtc a 101
<210> 430
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 430
ttcccccctt tcccgcggtc cgtcctagtc tcctagagat ttagctccga ncattgaaca 60
gtgtcctccg ccctagtccg aatcggcttt aycgcctagg t 101
<210> 431
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 431
cggtatgatc accagaaaag gcctacagcc aaggaaacca tggtacatct ngcctacatt 60
cttgaagcaa rttactggat tagtatgaca tgcataacst c 101
<210> 432
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or c
<400> 432
cttgtcccat tgtctaaaaa atgatcagta ggaggcaact catgctggtc nctagaaaaa 60
tcagtaacag aacmaaaatt acatatttat tttgctctaa a 101
<210> 433
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 433
accctacaga gaaagtcctc acgaatgcac ggaagaagcg cgtacgtacc nctggagccg 60
gagaccgacg cggcggcggc ggaggcggcg ggcgagcagg a 101
<210> 434
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 434
aagattctaa ataacgcacc ctatgtgtgg ctggatagcg aattgtttga ngccaagctc 60
agaggggaac aaccaccraa agagtcggcg tgcaataata g 101
<210> 435
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 435
gagattctcg tgcaaatcct aaaggaaacc ttcttactag ccatataagt ngtactgatt 60
tcactgaaga cggtgsatcc attcagtctc cgagctcaaa a 101
<210> 436
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 436
gatctgcttc tggctgagat aaggctctaa gttcgctctg ttgatggggc naccatgarc 60
cacgggaacg ggatgttgaa ttctgtcaar gtggagaggt g 101
<210> 437
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 437
gatctgttag catgtattaa ccttttggst gtattgmaat ttaattmata ntcctaygtt 60
attatatatr tctatccwrt gcsattcata agccatctgg t 101
<210> 438
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 438
ggtcacatta aaagaaaaaa arggwggcaa tagaaaagra aaaatttatg ncggagatga 60
aagcgaggtg aacaacgrta gtacatcaac caacagcaag g 101
<210> 439
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 439
atcgaagagc ttagrgaggc actggctgat gaactggagg gaaccgatga ngacatcatc 60
aatggcatca tccgagacgt ggacacrgat aaggtcagca a 101
<210> 440
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or g
<400> 440
ctgtcggtaa cattttggtt gttgtagcca agttttactt amacagaggt ngasgctttc 60
attccttgca acgcactgta ggccaagttt tatttctgtt a 101
<210> 441
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 441
gggccactct cagagctggg tctttttctg tggtttgtaa gaaatggtcc ngtctcatgg 60
agtccagggg cgccttactc ccggtgttga tcaatgttga g 101
<210> 442
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or a
<400> 442
gcagaagagc cgttctatgg atttggtact gaattctctc cccgytgtca ntaaaaacta 60
gatcgttgat gtgaccaaag gggtygagtg aggttycatt g 101
<210> 443
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=t or c
<400> 443
aaaamgtgac atggtcaacg agtggccatg ggccatggct ttgcaccmtg nagaacaagg 60
cgagtgacta caaaacagct ctgttyggca tatggagaga g 101
<210> 444
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or g
<400> 444
gaacaatagc aastcactgc ggtaccacag gccattcagg aattctggcc ntatttattr 60
caactctttt acagacaaca gcagcatggt ttagctcttg a 101
<210> 445
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 445
gaattcagay ggacaacaca ggaaacctca aactgaacgt acactcagga ngtgagagga 60
tgttcagaca aygcaaaaca acagagcacc ataarctaaa g 101
<210> 446
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=g or c
<400> 446
gcgtacgamt gtgggtggac cgacccttgt gtgattgtgt cggcccrgct nagcttgagc 60
gatsgccatc rtcgatcgga ggagcggaga acgggagaag g 101
<210> 447
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=c or t
<400> 447
agggtttcgt tcttggtgcg gcggccggcg ggctcgtagt cgtaacctct ntggcccgac 60
cggatcagga attcaggatc cacccttgag ccggcccagc c 101
<210> 448
<211> 101
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<213>N=a or t
<400> 448
catgaccagt ccctctaaga attccctccc tttcccctct aaaactccaa nctcccgcaa 60
aaaaatattg catgttattg tgtctggatc acacatttga t 101
Claims (8)
1. the SNP marker for corn gene parting is combined, it is characterised in that be made up of 448 SNP markers, the SNP
The numbering of mark is respectively ZmSNP001~ZmSNP448, and nucleotide sequence is respectively such as SEQ ID NO:Shown in 1-448, they
Information is as shown in table 1.
2. SNP marker described in claim 1 combines the application in corn molecular mark.
3. SNP marker described in claim 1 combines the application in corn full-length genome breeding chip is prepared.
4. utilize the method for KASP technology for detection maize genotypes, it is characterised in that comprise the following steps:
1) KASP primers are separately designed according to 448 each 50bp of the flank of SNP site two nucleotide sequence;
2) representational corn material is chosen, genomic DNA is extracted, enters performing PCR reaction, the result verification reacted according to PCR
The availability of KASP primers;
3) genotyping is carried out to corn material to be measured using authenticated KASP primers and SNP high-pass typings equipment, from
And identify the genotype of corn to be measured.
5. application of claim 4 methods described in corn variety identification.
6. application of claim 4 methods described in detection corn breeding material.
7. application of claim 4 methods described in corn whole-genome association.
8. application of claim 4 methods described in corn molecular mark.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710304942.2A CN107090504B (en) | 2017-05-03 | 2017-05-03 | SNP molecular marker combination for corn genotyping and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710304942.2A CN107090504B (en) | 2017-05-03 | 2017-05-03 | SNP molecular marker combination for corn genotyping and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107090504A true CN107090504A (en) | 2017-08-25 |
CN107090504B CN107090504B (en) | 2020-05-15 |
Family
ID=59637155
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710304942.2A Active CN107090504B (en) | 2017-05-03 | 2017-05-03 | SNP molecular marker combination for corn genotyping and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107090504B (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108060261A (en) * | 2018-01-30 | 2018-05-22 | 袁隆平农业高科技股份有限公司 | A kind of method and its application that capture sequencing is carried out to the combination of corn SNP marker |
CN108998550A (en) * | 2018-07-17 | 2018-12-14 | 袁隆平农业高科技股份有限公司 | SNP marker and its application for paddy gene parting |
CN109593871A (en) * | 2018-12-27 | 2019-04-09 | 江苏省农业科学院 | Corn KASP molecular labeling for distinguishing Heterosis of Maize Hybrid group combines and its development approach and application |
CN109609676A (en) * | 2018-12-25 | 2019-04-12 | 袁隆平农业高科技股份有限公司 | The SNP marker and application isolated with the anti-graywall main effect QTL-qRgls1 of corn |
CN110257547A (en) * | 2019-07-11 | 2019-09-20 | 袁隆平农业高科技股份有限公司 | Based on the corn core SNP marker of KASP technological development and its application |
CN110777216A (en) * | 2019-11-27 | 2020-02-11 | 北京市农林科学院 | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker |
CN116287423A (en) * | 2023-05-17 | 2023-06-23 | 黑龙江省农业科学院农产品质量安全研究所 | SNP molecular marker related to corn kernel oil content and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106282394A (en) * | 2016-10-28 | 2017-01-04 | 中玉金标记(北京)生物技术股份有限公司 | The method of high throughput testing Semen Maydis south rust resistance gene type and test kit thereof |
CN106544425A (en) * | 2016-11-02 | 2017-03-29 | 中国农业科学院作物科学研究所 | A kind of DNA chip and its application in corn variety identification and breeding |
CN106591470A (en) * | 2017-01-11 | 2017-04-26 | 北京市农林科学院 | Set of chloroplast SNP and INDEL molecular marker combination for maternal traceability of maize |
-
2017
- 2017-05-03 CN CN201710304942.2A patent/CN107090504B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106282394A (en) * | 2016-10-28 | 2017-01-04 | 中玉金标记(北京)生物技术股份有限公司 | The method of high throughput testing Semen Maydis south rust resistance gene type and test kit thereof |
CN106544425A (en) * | 2016-11-02 | 2017-03-29 | 中国农业科学院作物科学研究所 | A kind of DNA chip and its application in corn variety identification and breeding |
CN106544425B (en) * | 2016-11-02 | 2019-05-14 | 中国农业科学院作物科学研究所 | A kind of DNA chip and its application in corn variety identification and breeding |
CN106591470A (en) * | 2017-01-11 | 2017-04-26 | 北京市农林科学院 | Set of chloroplast SNP and INDEL molecular marker combination for maternal traceability of maize |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108060261B (en) * | 2018-01-30 | 2021-01-15 | 袁隆平农业高科技股份有限公司 | Method for capturing and sequencing corn SNP marker combination and application thereof |
CN108060261A (en) * | 2018-01-30 | 2018-05-22 | 袁隆平农业高科技股份有限公司 | A kind of method and its application that capture sequencing is carried out to the combination of corn SNP marker |
CN108998550A (en) * | 2018-07-17 | 2018-12-14 | 袁隆平农业高科技股份有限公司 | SNP marker and its application for paddy gene parting |
CN108998550B (en) * | 2018-07-17 | 2021-09-03 | 袁隆平农业高科技股份有限公司 | SNP molecular marker for rice genotyping and application thereof |
CN109609676A (en) * | 2018-12-25 | 2019-04-12 | 袁隆平农业高科技股份有限公司 | The SNP marker and application isolated with the anti-graywall main effect QTL-qRgls1 of corn |
CN109609676B (en) * | 2018-12-25 | 2021-12-14 | 袁隆平农业高科技股份有限公司 | SNP (Single nucleotide polymorphism) marker co-separated from corn gray spot resistant major QTL-qRgls1 and application |
CN109593871A (en) * | 2018-12-27 | 2019-04-09 | 江苏省农业科学院 | Corn KASP molecular labeling for distinguishing Heterosis of Maize Hybrid group combines and its development approach and application |
CN110257547A (en) * | 2019-07-11 | 2019-09-20 | 袁隆平农业高科技股份有限公司 | Based on the corn core SNP marker of KASP technological development and its application |
CN110257547B (en) * | 2019-07-11 | 2023-04-11 | 袁隆平农业高科技股份有限公司 | Corn core SNP marker developed based on KASP technology and application thereof |
CN110777216A (en) * | 2019-11-27 | 2020-02-11 | 北京市农林科学院 | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker |
CN110777216B (en) * | 2019-11-27 | 2022-07-01 | 北京市农林科学院 | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker |
CN116287423A (en) * | 2023-05-17 | 2023-06-23 | 黑龙江省农业科学院农产品质量安全研究所 | SNP molecular marker related to corn kernel oil content and application thereof |
CN116287423B (en) * | 2023-05-17 | 2023-08-04 | 黑龙江省农业科学院农产品质量安全研究所 | SNP molecular marker related to corn kernel oil content and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN107090504B (en) | 2020-05-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107090504B (en) | SNP molecular marker combination for corn genotyping and application thereof | |
CN108779459B (en) | Cotton whole genome SNP chip and application thereof | |
JP5960917B1 (en) | Rice whole genome breeding chip and its application | |
US20210285063A1 (en) | Genome-wide maize snp array and use thereof | |
CN110050092B (en) | Rice whole genome breeding chip and application thereof | |
CN110846429A (en) | Corn whole genome InDel chip and application thereof | |
CN108486266A (en) | The molecular labeling of DCIPThe chloroplast of maize genome and the application in cultivar identification | |
KR102121570B1 (en) | KASP primer set based on SNP for discriminating or classifying Panax ginseng cultivar or resource and uses thereof | |
CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
CN112813186A (en) | Soybean core SNP marker based on KASP and application thereof | |
CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
CN113151560B (en) | Molecular marker for screening poplar with high pore density and high photosynthetic efficiency as well as method and application thereof | |
CN109161609B (en) | SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application | |
CN113881802A (en) | SNP molecular marker KQ8-3918 linked with gene for controlling Vc content of pepper fruits, application and special primer | |
CN113981126A (en) | SNP molecular marker KQ8-4472 linked with gene for controlling Vc content of pepper fruits, application and special primer | |
CN108866225B (en) | Screening method for genetic background of genetically modified rice | |
CN114457180B (en) | MNP core primer combination for molecular identification of kiwi variety and application thereof | |
CN115011720B (en) | SNP molecular marker combination for constructing rubber tree variety DNA fingerprint, application and method | |
CN110423826A (en) | A kind of C57BL/6 subbreed mouse KASP genetic detection kit and primer | |
CN109913575A (en) | A kind of KASP molecular labeling, kit and its application for identifying capsicum CMS fertility restorer gene | |
KR102335934B1 (en) | SNP marker set for scanning genotypic composition in each chromosome of Perilla and uses thereof | |
CN107354203A (en) | Primer for identifying flue-cured tobacco Bi Na 1 combines and kit, application and detection method | |
CN107354200B (en) | Primer combination and kit for identifying flue-cured tobacco turquoise No. 1, application and identification method | |
KR20220051998A (en) | SNP genetic markers and primer sets for discriminating domestic wheat cultivar and uses thereof | |
CN117487947A (en) | Rice photo-thermo-sensitive male sterile KASP molecular marker, kit and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |