CN116217658A - AAV vector for gene targeting and expression, construction method and application thereof - Google Patents

Abstract

The present invention provides a polypeptide for targeting and an AAV vector for gene targeting and expression. The AAV vector comprises a nucleotide sequence encoding an engineered capsid protein of an AAV-8 serotype, said engineered capsid protein being inserted between amino acid 590 and amino acid 591 of the AAV-8 serotype capsid protein. The invention also provides a recombinant adeno-associated virus particle comprising the engineered capsid protein. In addition, the invention also discloses a construction method and application of the polypeptide, the AAV vector and the recombinant adeno-associated virus particle. Compared with the vector for expressing AAV-8 serotype capsid protein, the AAV vector can obtain stronger fluorescence effect after being used for infecting cells and tissues, and has better expression effect than AAV-8 serotype under the condition of using the same virus amount.

Description

AAV vector for gene targeting and expression, construction method and application thereof

Technical Field

The invention belongs to the field of genetic engineering and biotechnology, and in particular relates to screening, construction and application of AAV vectors for gene targeting and expression

Background

Adeno-associated virus (AAV) is a DNA-deficient, nonpathogenic parvovirus, and recombinant adeno-associated viral vectors (rAAV) are derived from nonpathogenic, wild-type adeno-associated viruses, the natural avidity of which makes targeted delivery therapy using AAV possible. rAAV has many advantages in delivery systems as a small non-enveloped virus, such as efficient sustained expression, ease of handling, etc. After the therapeutic genes carried by the rAAV vector enter cells, the transcription and translation can be carried out to functional proteins, so that the aim of treating a series of diseases is fulfilled. Currently, rAAV has become the major platform for in vivo gene therapy delivery, and rAAV gene therapy has made great progress in a number of disease treatment fields. In the treatment of hemophilia, the biological product license application (BLA) of gene therapy drug Etranacogene dezaparvovec has been granted by the U.S. Food and Drug Administration (FDA) priority. In the treatment of eye diseases, there are class 1 biological new drugs such as KH631 ophthalmic injection for the treatment of neovascular (wet) age-related macular degeneration by rAAV delivery of target genes. In addition, many pharmaceutical companies are exploring the use of rAAV to deliver relevant therapeutic genes in the treatment of central nervous system diseases, lysosomal storage diseases, muscle diseases, heart diseases, and the like.

However, most AAV viral capsid proteins currently used in rAAV viral packaging systems are conventional wild-type AAV-1, 2, 5, 8, and 9 capsid proteins. Although the natural wild AAV capsid can effectively target rAAV to target tissues for expression of exogenous genes, the natural AAV capsid still has the problems of poor infectivity, weak targeting specificity and the like in a plurality of tissues and specific cells. In the clinic, when the rAAV system used has limited targeting and transduction capabilities, the dosage used has to be increased to achieve the desired effect, which increases the risk of eliciting an immune response. Therefore, in order to advance the application of gene therapy in clinical treatment, modification and optimization of targeting modification of a natural wild-type AAV capsid protein become urgent. Currently, there are many methods for modification and optimization of AAV capsid proteins, including DNA stuffer techniques, site-directed mutagenesis of capsid proteins, artificial insertion, deletion of amino acid sequence modified capsid protein modifications, and the like. Among them, in recent years, based on phage display system technology, the screening of specific targeted short peptide fragments from random peptide Duan Ku for insertion into specific sites of wild type AAV capsid proteins is a highly efficient and feasible screening method. In our prior application, a modified AAV-8 capsid protein for gene targeting and expression (application publication No. CN 115044614A), was obtained by screening polypeptide LARGDSTKSA using phage display system technology and inserting it into wild-type AAV-8 serotype capsid protein to form a modified AAV-8 capsid protein which exhibited greater infectivity when infecting some cells than wild-type AAV-8 serotype capsid protein, but could not efficiently infect motor cortex and leukemia-associated cells (JurKAT cells, K562 cells and THP1 cells).

Disclosure of Invention

In view of the above-mentioned shortcomings of rAAV systems, one of the technical problems to be solved by the present invention is to provide a polypeptide for targeting.

The second technical problem to be solved by the invention is to provide an AAV vector for gene targeting and expression and a construction method thereof.

The third object of the present invention is to provide a recombinant adeno-associated virus particle

The fourth technical problem to be solved by the present invention is to provide the polypeptide, the vector and the application of the recombinant adeno-associated virus particle based on the above two.

In order to solve the first technical problem, the present invention provides a targeting polypeptide, the amino acid sequence of which is as shown in SEQ ID NO:8, wherein the amino acids at positions 1, 2 and 10 are protective amino acids. The protected amino acid is represented by X, wherein the amino acid at position 1 is selected from L, I, V and the amino acid at position 2 is selected from A, G, S; the amino acid at position 10 is selected from A, G, S.

In some embodiments, the amino acid sequence of the polypeptide for targeting is as set forth in SEQ ID NO: 3. as shown.

To solve the second technical problem described above, the present invention provides an AAV vector for gene targeting and expression comprising a nucleotide sequence encoding an engineered capsid protein of AAV-8 serotype; the modified capsid protein of AAV-8 serotype is an AAV-8 serotype capsid protein having an amino acid sequence as shown in SEQ ID NO:8 for targeting; the amino acid sequence of the AAV-8 serotype capsid protein is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence homologous to SEQ ID NO. 7; the nucleotide sequence of the AAV-8 serotype capsid protein is the nucleotide sequence corresponding to SEQ ID NO:2, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%.

In some embodiments, the amino acid sequence of the polypeptide for targeting is as set forth in SEQ ID NO: 3. as shown.

In some embodiments, the nucleotide sequence of the AAV vector is identical to SEQ ID NO:1, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence.

In order to solve the second technical problem, the invention also provides a construction method of the AAV vector for gene targeting and expression, which comprises the following steps: synthesizing a polypeptide encoding SEQ ID NO:8 and inserting the nucleotide sequence of the amino acid sequence shown in the figure into the nucleotide sequences corresponding to the 590 th and 591 th amino acids of the AAV-8 serotype capsid protein, thereby forming the AAV vector for gene targeting and expression. The AAV-8 serotype capsid protein is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence homologous to SEQ ID NO. 7; the nucleotide sequence of the AAV-8 serotype capsid protein is the nucleotide sequence corresponding to SEQ ID NO:2, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%.

In some embodiments, the inserted nucleotide sequence is a sequence encoding SEQ ID NO:3, and a nucleotide sequence of the amino acid sequence shown in 3.

To solve the third technical problem described above, the present invention provides a recombinant adeno-associated virus particle comprising an engineered capsid protein of the AAV-8 serotype; the modified capsid protein of AAV-8 serotype is the AAV-8 serotype capsid protein inserted between amino acid 590 and amino acid 591 as shown in SEQ ID NO:8 for targeting; the AAV-8 serotype capsid protein is an amino acid sequence that is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homologous to SEQ ID NO. 7. .

In some embodiments, the amino acid sequence of the polypeptide for targeting is as set forth in SEQ ID NO: 3. as shown.

In order to solve the third technical problem, the present invention further provides the following four applications:

p1, use in improving the capsid for AAV viral packaging,

p2, in connection and targeting of biological macromolecules, antibody drugs, peptide fragments and chemical small molecules,

p3, use in targeting cerebellum, motor cortex and/or striatum; or in the preparation of targeted cerebellum drugs, motor cortex drugs and/or striatal drugs,

p4, use in targeting retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells, and/or THP1 cells; or preparing targeted retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells and/or THP1 cells.

The four applications are in alternative relation, the polypeptide for targeting can realize the four applications, and the AAV vector for gene targeting and expression and the recombinant adeno-associated virus particle can realize the applications shown as P3 and P4.

Compared with the prior art, the invention has the following beneficial effects: the modified vector is effectively screened out by phage display system technology and in-vitro expression method. Compared with wild AAV-8 serotype capsid protein, the modified capsid protein expressed by the vector has better infection effect when the following tissues and cells are infected as shown in experimental results: cerebellum (fig. 3), motor cortex (fig. 4), and striatum (fig. 5) of the mouse brain; retinal ganglion isolated cells (fig. 6), neuro2A cells (fig. 7), MULLER cells (fig. 8), SH-SY-5Y cells (fig. 9), JURKAT cells (fig. 10), K562 cells (fig. 11), and THP1 cells (fig. 12). Compared with the prior patent CN115044614A, the AAV vector for gene targeting and expression provided by the invention has obviously improved capability of infecting sports cortex, jurkat cells, K562 cells and THP1 cells compared with wild AAV-8 serotype capsids, namely the AAV-8 serotype capsid proteins. The modified vector of the invention improves the infection effect of AAV-8, and forcefully promotes the application of gene therapy taking the rAAV system as a platform in clinical treatment, in particular to the treatment of sports cortex related diseases and leukemia.

Drawings

FIG. 1 is a schematic diagram of the structure of a vector expressing an engineered capsid protein of AAV-8 serotype (i.e., the AAV vector, hereinafter AAV8-590 NKV) of example 1.

FIG. 2 is a schematic diagram showing the results of AAV8-590NKV nucleotide sequencing in example 3.

FIG. 3 is a schematic diagram showing the infection of mice brains with AAV8-590NKV packaged virus and AAV-8 serotype capsid protein expression vector (hereinafter AAV-8 Cap) packaged virus according to example 5; wherein FIG. 3 (A) represents AAV-8Cap packaged virus; FIG. 3 (B) represents AAV8-590NKV packaged virus.

FIG. 4 is a schematic diagram showing the infection of mouse motor cortex by AAV8-590NKV packaged virus and AAV-8Cap packaged virus in example 5; wherein FIG. 4 (A) represents AAV-8Cap packaged virus; FIG. 4 (B) represents AAV8-590NKV packaged virus.

FIG. 5 is a schematic diagram showing infection of mouse striatum with AAV8-590NKV packaged virus and AAV-8Cap packaged virus in example 5; wherein FIG. 5 (A) represents AAV-8Cap packaged virus; FIG. 5 (B) represents AAV8-590NKV packaged virus.

FIG. 6 is a schematic representation of isolated cells from retinal ganglion infection with AAV8-590NKV packaged virus, and AAV-8Cap packaged virus, according to example 4; wherein FIG. 6 (A) represents AAV-8Cap packaged virus; FIG. 6 (B) represents AAV8-590NKV packaged virus.

FIG. 7 is a schematic diagram showing infection of Neuro2A cells with AAV8-590NKV packaged virus, and AAV-8Cap packaged virus, according to example 4; wherein FIG. 7 (A) represents AAV-8Cap packaged virus; FIG. 7 (B) represents AAV8-590NKV packaged virus.

FIG. 8 is a schematic diagram showing infection of Muller cells with AAV8-590NKV packaged virus, and AAV-8Cap packaged virus, according to example 4; wherein FIG. 8 (A) represents AAV-8Cap packaged virus; FIG. 8 (B) represents AAV8-590NKV packaged virus.

FIG. 9 is a schematic diagram showing infection of SH-SY-5Y cells with AAV8-590 NKV-packaged virus and AAV-8 Cap-packaged virus in example 4; wherein FIG. 9 (A) represents AAV-8Cap packaged virus; FIG. 9 (B) represents AAV8-590NKV packaged virus.

FIG. 10 is a schematic diagram showing infection of Jurkat cells with AAV8-590NKV packaged virus, AAV-8Cap packaged virus, according to example 4; wherein FIG. 10 (A) represents AAV-8Cap packaged virus; FIG. 10 (B) represents AAV8-590NKV packaged virus.

FIG. 11 is a schematic diagram showing infection of K562 cells with AAV8-590NKV packaged virus and AAV-8Cap packaged virus in example 4; wherein FIG. 11 (A) represents AAV-8Cap packaged virus; FIG. 11 (B) represents AAV8-590NKV packaged virus.

FIG. 12 is a schematic diagram showing infection of THP1 cells with AAV8-590NKV packaged virus, and AAV-8Cap packaged virus in example 4; wherein FIG. 12 (A) represents AAV-8Cap packaged virus; FIG. 12 (B) represents AAV8-590NKV packaged virus.

FIG. 13 is a schematic diagram showing the structure of AAV-8Cap in example 1.

Detailed Description

The invention is further illustrated below in connection with specific embodiments. It should be understood that the particular embodiments described herein are presented by way of example and not limitation. The principal features of the invention may be used in various embodiments without departing from the scope of the invention.

The invention screens out the polypeptide for targeting by utilizing phage display system technology, which comprises the specific steps of firstly constructing a random short peptide display library, namely synthesizing a plurality of random short peptides with different amino acid sequences, wherein the random short peptides comprise 7 random amino acid fragments and 3 protective amino acids; then, random short peptides with different amino acid sequences are respectively inserted between 590-591 amino acids of AAV-8 serotype capsid proteins, so as to obtain a plurality of AAV-8 modified capsid proteins with different random short peptides; secondly, screening AAV-8 modified capsid proteins which can be infected to retina through vitreous injection from the plurality of AAV-8 modified capsid proteins by an in vitro expression method, wherein the AAV-8 modified capsid proteins have good penetrability, strong infectivity and low immunogenicity; finally, the polypeptide for targeting was determined by sequencing to be the inserted short peptide sequence in the AAV-8 modified capsid protein with good penetrability, strong infectivity and low immunogenicity for the retina, which is shown in example 1 as SEQ ID NO:3, and 3.

Example 1: vector construction

The specific method and steps for preparing sequence design and synthesis are as follows:

(1) Synthesizing SEQ ID NO:3, the nucleotide sequence of the amino acid sequence shown in SEQ ID NO:4, a step of;

(2) PCR of the double stranded DNA molecule synthesized in step (1) was performed using the synthesized primers pAAV8-590-7aa-F and pAAV8-590-7aa-R, respectively, to obtain PCR products.

In the step (2), the PCR system is as follows: 32.5. Mu.LH 2O, 10. Mu.L of 5 XBuffer Buffer (containing Mg2+), 4. Mu.L of dNTPs (2.5 mM each), 1. Mu.L of forward Primer1 (+), 1. Mu.L of reverse Primer2 (-) (10. Mu.M), 1. Mu.L of target gene template DNA, and 0.5. Mu.L of PrimeSTAR enzyme constitute a reaction system;

the PCR procedure was as follows: denaturation at 98℃for 3 min; annealing at 98℃for 10 seconds, 55℃for 15 seconds, 72℃for 1 minute, repeating 30 cycles; extension was carried out at 72℃for 10 minutes.

The specific method and steps for inserting the sequence into the site are as follows:

1) The viral vector AAV-8Cap is digested with restriction enzyme BsmBI, which is shown in FIG. 13, and has the nucleotide sequence shown in SEQ ID NO:2, the amino acid sequence is shown as SEQ ID NO:7, recovering a carrier framework;

2) And (3) recombining the PCR product of the step (2) and the vector skeleton of the step (1), converting into escherichia coli, screening positive bacteria and extracting plasmids thereof to obtain a recombinant vector.

In the step 1), the enzyme digestion system is as follows: bsmBI (NEB, R0739L) 1. Mu.L, buffer 3. Mu.L, AAV-8Cap plasmid 1. Mu.g, make up water to 30. Mu.L; the enzyme was digested at 37℃for 4 hours.

In step 2), the recombination system is: 15. Mu.L of recombinase (St. Job Gene GmbH, GB 2002), 40ng of recovered PCR product DNA, 20ng of recovered plasmid; after 30min in a water bath at 42 ℃, E.coli was transformed.

pAAV8-590-7aa-F: AGGACCCTGTTACCGCCAAC as shown in SEQ ID NO. 5

pAAV8-590-7aa-R: GATGTTTCAGGCCAAAGCCG as shown in SEQ ID NO. 6

As shown in FIG. 1, the constructed pAAV8-590NKV vector structure comprises an ampicillin resistance gene, an AAV replication gene and an AAV-8 capsid protein gene, and comprises 10 amino acid sequences shown in SEQ ID NO: 3: LANKVVDKWA.

Example 2: AAV viral packaging

Cryopreservation of AAV-293 cells

With increasing passage times, AAV-293 cells may exhibit decreased growth status, mutations, and the like. To prevent this, we need to freeze the cells in large quantities at the beginning to ensure the stability and persistence of the experiment. Freezing and preserving in the logarithmic growth phase of the cells, and increasing the survival rate of cell resuscitation.

1. Removing

Adding PBS into the cell culture supernatant to wash off residual culture medium;

2. adding 0.25% pancreatin, digesting for 1-2min, observing cell rounding under a microscope, removing pancreatin when the intercellular space is enlarged, adding fresh culture medium, blowing, mixing, and transferring into a centrifuge tube.

3. Counting cells, namely shaking all the cells, adding 3mL of 10% DMEM preheated at 37 ℃, blowing with a 10mL pipette, blowing with a large force for 6-8 times without dead angle, sucking all the cells out, placing the cells in a 15mL centrifuge tube, taking 50 mu L of the uniformly mixed cells in a 1.5mLeppendorf tube, adding 450 mu L of 10% DMEM, namely diluting by 10 times, uniformly mixing, and taking 10 mu L of the cells for counting in a counting plate. The counting plate is provided with 4 big lattices and 16 small lattices each. When counting, the number of cells is 4, the total number is divided by 4 (the number of cells per cell is obtained), and then multiplied by 10 (10 times dilution), namely the actual concentration of cells in n ten thousand/mL.

4. Cells were centrifuged at 1000rpm/min for 5min. The supernatant was removed.

5. Based on the cell count, the cells were resuspended at a density of 3X10 by adding cell cryopreservation (70% complete medium+20% FBS+10% DMSO) to the results ⁶ And each mL.

6. Subpackaging into cell freezing tube, placing into freezing box, and placing into ultralow temperature refrigerator at-80deg.C.

7. The following day, the cells were stored in a liquid nitrogen tank for a long time and recorded. In the preservation process, cells are recovered from time to detect the cell survival rate, observe the cell state and the like.

Passage of (II) AAV-293 cells

When the cell grows to reach 80% -90% of the confluence rate, the cell needs to be subjected to passage operation so as to expand the number of the cells and maintain the good growth state of the cells.

1. The cells are digested and stored in the same way as the cells are frozen.

2. After the cell centrifugation is completed, complete medium is added for resuspension.

3. The cells were split into 10cm dishes, each with a make up of 10mL of medium, as the case may be.

Resuscitation of (III) AAV-293 cells

When the number of passages of the cells is too large, the cell state becomes poor, or pollution accidents occur to the cells, the cells which are frozen initially need to be discarded and recovered.

1. Setting water bath at 37-42 deg.c.

2. Checking the record of the cell bank, taking out the frozen cells from the liquid nitrogen tank according to the record (cotton gloves are needed to be worn to prevent the frozen cells from being damaged), rapidly throwing the frozen cells into a water bath kettle, rapidly shaking the frozen cells, and completely dissolving the frozen cells within 1 to 2 minutes as much as possible

Dissolving.

3. The cell solution was transferred to a 15mL centrifuge tube, and 1mL of fresh complete medium was added thereto, and after mixing, the mixture was centrifuged at 1000rpm/min for 5min.

4. The supernatant was removed, 5mL of fresh complete medium was added, and after mixing well, the pellet was transferred to a 6cm dish.

5. The dishes were incubated at 37℃in an incubator with 5% CO2 and 95% relative humidity.

6. Cell viability was observed the next day. The cells were replaced with medium. Cell growth was observed daily afterwards.

(IV) AAV packaging and concentration

1. Plasmid amplification

The constructed AAV vectors, packaging plasmids and helper plasmids need to be subjected to large-scale extraction, the concentration is more than 1 mug/mu L, and A260/280 can be used for virus packaging in a range of 1.7-1.8. A Qiagen large extraction kit is recommended for the large-scale endotoxin removal extraction of plasmids.

2. AAV-293 cell transmission

Sucking up the culture medium in a T75 bottle for culturing AAV-293 cells, adding 2mL of 0.25% pancreatin taken out by a 4-degree refrigerator to uniformly cover the bottle bottom, placing the bottle bottom in a 37-degree incubator for 3-5min, taking out, shaking to find the cells to separate from the bottom, shaking down all the cells, adding 3mL of 10% DMEM preheated in a 37-degree water bath, blowing the pipette with a 10mL pipette, blowing with a large force for 6-8 times, keeping no dead angle, ensuring that the pipette is difficult to blow at the bottle mouth, aligning the pipette with the culture port, and blowing the culture medium with small force to cover the cells close to the bottle mouth. After that, all cells were aspirated, placed in a 15mL centrifuge tube, 50 μl of the homogenized cells were taken in a 1.5mL eppendorf tube, 450 μl of 10% dmem was added, i.e. 10-fold dilution, homogenized, and 10 μl of cells were counted in a counting plate. The counting plate is provided with 4 big lattices and 16 small lattices each. When counting, the number of cells is 4, the total number is divided by 4 (the number of cells per cell is obtained), and then multiplied by 10 (10 times dilution), namely the actual concentration of cells in n ten thousand/mL. Passaging when the astronomical is the first day, if transfection is carried out the next day, spreading 900-1000 ten thousand/T75; if transfected on the third day, 350-400 ten thousand/T75 was spread. 10mL of 10% DMEM medium was added to each flask of T75. The transfection was performed by observing the cell density on the day of transfection, 80-90% full. Culture medium is not required to be changed before transfection.

3. Make lipofection complex

Reagent name number of reagents

Vector plasmid 5. Mu.L (1.0. Mu.g/. Mu.L)

Packaging plasmid 5. Mu.L (1.0. Mu.g/. Mu.L)

Helper plasmid 5. Mu.L (1.0. Mu.g/. Mu.L)

Note that: lipofiter transfection reagent is a Henry biological product, and the instructions for use refer to Lipofiter instructions.

Aav virus detoxification:

viral particles are present in both packaging cells and culture supernatants. Both the cells and the culture supernatant can be collected to obtain the best yields.

1) Preparing a dry ice ethanol bath (the ethanol is poured into a foam box filled with dry ice, or liquid nitrogen is used for replacing the dry ice ethanol bath) and a water bath at 37 ℃;

2) The toxigenic cells were collected along with the medium in a 15mL centrifuge tube. When collecting cells, the culture plate is inclined at a certain angle to scrape the cells into the culture medium;

3) 1000rpm/min, centrifugation for 3 minutes, separation of cells and supernatant, additional storage of supernatant, cell resuspension with 1mL PBS;

4) The cell suspension was repeatedly transferred in a dry ice ethanol bath and a 37 ℃ water bath, frozen and thawed four times. Slightly shaking after each melting. Note that: each setting and thawing takes approximately ten minutes.

Aav virus concentration:

1) Cell debris was removed by centrifugation at 10,000g and the supernatant was transferred to a new centrifuge tube.

2) Mixing the two supernatants, and filtering with 0.45 μm filter to remove impurities

3) Adding 1/2 volume of 1M NaCl,10%PEG8000 solution, mixing well, and standing at 4deg.C overnight

4) Centrifugation at 12,000rpm for 2h, discarding the supernatant, dissolving the viral pellet with an appropriate amount of PBS solution, and filtering and sterilizing with 0.22 μm filter after complete dissolution.

5) The residual plasmid DNA (final concentration 50U/mL) was removed by digestion with Benzonase nuclease. The tube cap was closed and inverted several times to mix thoroughly. Incubation at 37 ℃ for 30 min;

6) Filtering with 0.45 μm filter head, and collecting filtrate to obtain concentrated AAV virus.

Purification of AAV

1) To the virus concentrate was added solid CsCl to a density of 1.41g/mL (refractive index 1.372);

2) Adding the sample into an overspeed centrifuge tube, and filling the residual space of the centrifuge tube with a pre-prepared 1.41g/mL CsCl solution;

3) Centrifuge at 175,000g for 24 hours to develop a density gradient. Samples of different densities were collected in sequential steps and sampled for titer determination. Collecting the fraction enriched in AAV particles;

4) The above procedure was repeated once.

5) The virus was packed into 100kDa dialysis bags and desalted by 4 degree dialysis overnight. This is the purified AAV virus

AAV virus packaging titre assay (Q-PCR method)

1) mu.L of concentrated virus solution is taken, 1 mu.L of RNAse-free DNAse is added, and the mixture is uniformly mixed and reacted in a water bath at 37 ℃ for 30min.

2) Centrifuge at 12000rpm/min for 10min at 4℃and take 10. Mu.L of supernatant into another sterile 1.5mL EP tube.

3) Mu. L Dilution Buffer (1 mM Tris-HCl, pH 8.0,0.1mM EDTA,150mM NaCl) was added, mixed well and reacted in a metal bath at 37℃for 30min.

4) Naturally cooling to room temperature, adding 1 mu L of proteinase K, and reacting for 1h in a water bath at 65 ℃.

5) The metal bath is reacted for 10min at the temperature of 100 ℃, and the reaction is naturally cooled to the room temperature.

6) The titer was detected by Q-PCR.

Storage and dilution of AAV viruses

1. Storage of virus:

after the virus liquid is received, the experiment is carried out by using adeno-associated virus in a short time, and the virus can be temporarily stored at 4 ℃; if long-term preservation is required, placing the virus in-80deg.C (frozen storage tube), and sealing with sealing film.

1) The virus can be stored at-80 ℃ for more than 6 months; however, if the virus is stored for more than 6 months, it is recommended that the virus titer be re-determined before use.

2) Repeated freeze thawing reduces viral titers: each freeze thawing reduces viral titer by 10%; therefore, repeated freeze thawing should be avoided as much as possible in the use process of the virus, and in order to avoid repeated freeze thawing, split charging is recommended according to the usage amount of each time after the virus is received.

2. Dilution of virus:

if dilution of the virus is desired, please remove the virus and thaw it in ice bath, then use PBS buffer or culture target cells serum-free medium (serum or dual antibody containing does not affect virus infection). Mixing, packaging, storing at 4deg.C (please use up in three days), and packaging.

AAV safety precautions

1. Biological safety cabinets are preferably used for virus handling. If the virus is operated by using the common ultra-clean bench, the exhaust fan is not required to be turned on.

2. When the virus is operated, the experiment clothes are worn, and the mask and the glove are taken.

3. Special care is taken not to generate aerosol or splash when handling the virus. If the ultra clean bench is contaminated by virus during operation, the ultra clean bench is immediately wiped clean with 70% ethanol and 1% SDS solution. The tips, centrifuge tubes, culture plates, culture media, etc. that had been exposed to the virus were immersed in 84 disinfectant or 1% SDS overnight and discarded.

4. The following steps should be followed when observing the infection of cells with a microscope: screw down the flask or cover the plate. The outer wall of the culture flask is cleaned by 70% ethanol, and then observed and photographed by a microscope. Before leaving the microscope stand, the microscope stand was cleaned with 70% ethanol.

5. If centrifugation is required, a centrifuge tube with good sealing performance is used, or a centrifuge tube in a tissue culture chamber is used as much as possible after sealing by a sealing film.

6. After removing the glove, both hands are washed with soap and water.

Example 3: the mouse vitreous cavity injection and retina extraction of the recombinant adeno-associated virus particle containing AAV8-590NKV capsid protein

1. Anesthesia: 4.3% chloral hydrate 0.01mL/g;

2. mydriatic fluid mydriatic, methyl cellulose keeps the ocular surface moist;

3. adjusting the head position of the mouse and injecting position: about 1mm posterior to the limbus;

4. making a notch by using a 33G injector, enabling a needle point to vertically enter, then tilting, slowly pushing and injecting the recombinant adeno-associated virus particles into a vitreous cavity of a mouse, and after injection, keeping a needle for 0.5-1min and rapidly taking out the needle;

5. about one week later, the mice are anesthetized and sacrificed, the retina and retinal pigment epithelium of the target tissue are taken, the genome thereof is extracted, and the AAV capsid sequence penetrating into the target tissue is sequenced and analyzed;

analysis of the AAV sequence contained in the genome from the sequencing results (see FIG. 2), the boxes represent the inserted nucleotide sequences obtained by sequencing, and the reading analysis gave the sequence shown in SEQ ID NO:4, and a nucleotide sequence shown in seq id no.

Example 4: AAV-8Cap and AAV8-590NKV capsid separately packaged virus, cell infection and fluorescence comparison

1. Inquiring the position of the required cells in the cell bank table;

2. taking out the cells from the liquid nitrogen tank, rapidly placing the cells in a 37-DEG water bath kettle, and gently shaking the cells continuously;

3. placing the frozen storage tube with the completely melted internal liquid in a centrifuge, and centrifuging at 800RPM for 5min;

4. after centrifugation, the supernatant in the centrifuge tube is poured out;

5. adding 1mL of corresponding culture medium into the freezing tube, and lightly blowing and beating uniformly to form single-cell suspension;

6. taking a dish with a proper size (usually 10cm or 6cm dish), and adding the culture medium;

7. adding the cell suspension which is blown uniformly in the freezing tube into a dish;

8. shaking the cell culture dish by rice shape method to mix them uniformly;

9. placing the shaken cell culture dish in a 37-degree incubator;

10. the next day, taking out the dish, observing under a microscope, and carrying out subsequent operations such as liquid exchange;

11. removing cells having a density of 80% from the incubator;

12. sucking the original culture medium in the dish;

13. adding 3mLPBS buffer solution, and uniformly shaking the dish to enable PBS to be washed to each corner of the dish;

14. washing off the PBS buffer for washing;

15. adding 1mL of pancreatin, and uniformly shaking the dish to ensure that the pancreatin can uniformly contact each corner of the dish;

16. placing the uniformly shaken dish after adding pancreatin back to a 37-degree incubator;

17. digesting for a certain time (generally between 1min and 2 min), and taking out the cell dish;

18. the dish is taken in the left hand, and the right hand is used for gently beating along the wall of the dish, so that the cells are well digested after sliding off;

19. the previous operation can be changed into cell rounding under a microscope;

20. digestion was terminated by adding 2mL of the corresponding medium to a 10cm dish;

21. shaking the cell dish to which the stop solution has been added uniformly;

22. blowing the cells into single cell suspension by using a 1mL pipette;

23. after blowing, sucking all liquid to a 5mL centrifuge tube;

24. after marking the centrifuge tube, placing the centrifuge tube into a centrifuge for centrifugation at 800RPM for 5min;

25. after centrifugation, the supernatant in the centrifuge tube is poured out;

26. adding 2mL of corresponding culture medium to resuspend the cells into single cell suspension;

27. dividing the cells into well plates in a number;

28. mixing cells in the pore plate and the culture medium uniformly;

29. placing the pore plate in a 37-degree incubator for culture;

30. the day before infection, cells were plated (see above steps);

31. infection can be carried out 12 hours after cell plating;

32. after 12 hours of cell plating, the corresponding virus/sodium butyrate was prepared;

33. according to the MOI value corresponding to the cells, a proper amount of virus is taken and evenly mixed in a culture medium of 2% serum;

34. adding sodium butyrate according to the proportion of 1:1000; the method comprises the steps of carrying out a first treatment on the surface of the

35. The well plate was changed to 2% serum medium

36. Adding the virus-sodium butyrate mixed solution into a pore plate, and uniformly shaking;

37. placing the pore plate in a 37 ℃ incubator for culture;

38. after culturing for 6 hours, taking out the pore plate, and sucking all liquid in the pore plate;

39. adding a certain amount of fresh culture medium, and continuously placing the culture medium in a 37 ℃ incubator for culture;

40. taking a (fluorescence) picture after a certain time, and delivering a sample;

FIGS. 6-12 represent fluorescence of AAV-8Cap (A) and AAV8-590NKV (B) capsids of the same viral load, respectively, infected retinal ganglion isolated cells (FIG. 6), neuro2A cells (FIG. 7), muller cells (FIG. 8), SH-SY-5Y cells (FIG. 9), jurkat cells (FIG. 10), K562 cells (FIG. 11), THP1 cells (FIG. 12). AAV8-590NKV capsid-packaged virus infects retinal ganglion isolated cells (FIG. 6), neuro2A cells (FIG. 7), muller cells (FIG. 8), SH-SY-5Y cells (FIG. 9), jurkat cells (FIG. 10), K562 cells (FIG. 11), THP1 cells (FIG. 12) with better infection efficiency than AAV-8 capsid-packaged virus.

Example 5: AAV-8Cap and AAV8-590NKV capsid packaged virus, mouse intravitreal injection, brain localized injection, infection area comparison

Vitreous cavity injection (see example 3)

The stereotactic injection procedure for the mouse brain is as follows:

1. anesthesia

1) Anesthetizing the mice with a anesthetic such as sodium pentobarbital, chloral hydrate or isoflurane/oxygen mixture, with moderate anesthesia;

2. fixing

1) Turning on a cold light source to provide illumination, and fixing the anesthetized mice on a brain stereotactic injector;

2) Fixing the skull: firstly, one side ear rod is gently inserted into the external auditory canal, the ear rod is fixed after touching the bottom of the osseous external auditory canal, then the other ear rod is also inserted and fixed, whether the fixing of the head of the mouse is stable or not is checked, the head is loose and oblique, the scales of the two sides ear rod are symmetrical or not, the ear rod is slightly moved to enable the head positions with the same scales on the two sides to be completely centered, and the ear rod is fixed again;

3) Fixing the upper jaw: the upper incisors of the mice are plugged into the grooves of the upper tooth fixing plate, and the screws are screwed. No movement should occur by pushing the animal's head from all directions. Adjusting the front and back fontanels on the same sagittal line by measuring with a positioning needle, and enabling the front fontanel (Bregma) and the back fontanel (Lambda) to be on the same horizontal plane as much as possible;

3. drilling holes

1) Shaving the hair of the head of the mouse by using a pet shaver, and then sterilizing the head by using medical alcohol and iodine to prevent infection;

2) The eye ointment is smeared on the eyes of animals to keep the eyes moist and prevent the eyes of the animals from blindness due to long-time dryness;

3) Shearing the scalp from the two eyes to the two earroots by using medical scissors;

4) The opening is enlarged by hemostatic forceps, and the Dura mater (Dura) on the surface of the skull is wiped and removed by cotton sticks dipped with hydrogen peroxide;

5) Using a positioner to ensure that Bregma (x=0, y=0, z=0) and Bregma (Lambda) are on the same horizontal plane (X, Z values differ by less than 0.1);

6) Determining the position parameters of a brain region to be injected according to the brain map;

7) The position of the virus to be injected is found by using a locator, and marks are made on the skull by using a marker pen;

8) The skull is turned at the injection site to lightly grind the skull, the skull is thinned slowly, and when the skull is cracked, the needle of the medical injector is carefully used for bursting, so as to prevent damage;

4. virus injection

1) Washing the microinjector (5. Mu.L specification) 3-5 times with PBS;

2) Firstly sucking about 1 mu L of air, then sucking about 1 mu L of diluted virus, and testing whether the syringe is unobstructed in the air;

3) Assembling a microinjection pump, placing the microinjection pump above the drilled hole, enabling the needle point to be parallel to the skull (Z=0), and finely adjusting the position of the microinjection pump to be the same as that of the microinjection pump when drilling the hole;

4) Slowly descending the injection needle according to the determined depth;

5) Injecting the virus at a rate of 0.05 μl/min, stopping the injection when 0.5 μl remains;

6) After the injection is finished, the injection needle is kept at the injection position for 10min to spread viruses, and then the needle is slowly lifted;

7) Washing the microinjector with PBS for 5 times for standby;

8) Note that if bleeding occurs during injection, the bleeding is immediately sucked away by a cotton swab so as to avoid virus carry-over;

5. stitching

1) After the injection needle is completely pulled out, the scalp is sutured;

2) After the experiment is finished, the mice are put in a place (such as a constant temperature heating plate) with proper temperature (about 25 ℃) for recovery, and the mice can be put back into a cage for breeding after being awake;

6. detection of

1) After 3-4 weeks of feeding the virus-injected mice, the brains were sacrificed by cervical removal and fixed with 4% paraformaldehyde for about 1 day, and 20% and 30% sucrose solutions were dehydrated;

2) Frozen sections were 10 μm thick. Observing fluorescence under a fluorescence microscope;

FIGS. 3, 4 and 5 represent the fluorescence of AAV-8 (A) and AAV8-590NKV (B) capsids of the same viral load, packaged separately, from mice infected by brain-localized injection (FIG. 3), motor cortex (FIG. 4) and striatum (FIG. 5). Experimental results showed that AAV8-590NKV capsid-packaged virus infects mice brains (fig. 3), motor cortex (fig. 4) and striatum (fig. 5) with better infection efficiency than AAV-8 capsid-packaged virus.

It should be understood that the structures, proportions, sizes, etc. shown in the drawings are for illustration purposes only and should not be construed as limiting the invention to the extent that it can be practiced, since modifications, changes in the proportions, or otherwise, used in the practice of the invention, are not intended to be critical to the essential characteristics of the invention, but are intended to fall within the spirit and scope of the invention.

The foregoing describes in detail preferred embodiments of the present invention. It should be understood that numerous modifications and variations can be made in accordance with the concepts of the invention without requiring creative effort by one of ordinary skill in the art. Therefore, the technical solutions obtained by logic analysis, reasoning or limited experiments based on the prior art by those skilled in the art according to the present invention should be within the scope of protection defined by the claims.

Claims (12)

1. A polypeptide for targeting, characterized in that it has an amino acid sequence as set forth in SEQ ID NO:8, wherein the amino acids at positions 1, 2 and 10 are protecting amino acids; the protected amino acid is represented by X, wherein the amino acid at position 1 is selected from L, I, V, the amino acid at position 2 is selected from A, G, S, and the amino acid at position 10 is selected from A, G, S.

2. The polypeptide for targeting according to claim 1, characterized in that it has the amino acid sequence as set forth in SEQ ID NO: 3.

3. Use of a polypeptide for targeting according to claim 1 or 2, characterized in that the use is any of the following:

p1, use in improving the capsid for AAV viral packaging,

p2, in connection and targeting of biological macromolecules, antibody drugs, peptide fragments and chemical small molecules,

p3, use in targeting cerebellum, motor cortex and/or striatum; or in the preparation of targeted cerebellum drugs, motor cortex drugs and/or striatal drugs,

p4, use in targeting retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells, and/or THP1 cells; or preparing targeted retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells and/or THP1 cells.

4. An AAV vector for gene targeting and expression, comprising a nucleotide sequence encoding an engineered capsid protein of an AAV-8 serotype; the modified capsid protein of AAV-8 serotype is a polypeptide for targeting according to claim 1 inserted between amino acid 590 and amino acid 591 of AAV-8 serotype capsid protein; the AAV-8 serotype capsid protein is an amino acid sequence that is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homologous to SEQ ID NO. 7.

5. The AAV vector for gene targeting and expression according to claim 4, wherein the polypeptide for targeting has an amino acid sequence as set forth in SEQ ID NO: 3.

6. The AAV vector for gene targeting and expression according to claim 5, wherein the AAV vector for gene targeting and expression is a vector identical to the vector of SEQ ID NO:1, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence.

7. Use of an AAV vector according to claim 4 or 5 for gene targeting and expression, wherein the use is any of the following:

p5, use in targeting cerebellum, motor cortex and/or striatum; or in the preparation of targeted cerebellum drugs, motor cortex drugs and/or striatal drugs,

p6, use in targeting retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells and/or THP1 cells; or preparing targeted retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells and/or THP1 cells.

8. The method for constructing an AAV vector for gene targeting and expression according to claim 4, comprising the steps of: synthesizing a polypeptide encoding SEQ ID NO:8 and inserting the nucleotide sequence of the amino acid sequence shown in the sequence No. 590 and the nucleotide sequence corresponding to the amino acid 591 of the AAV-8 serotype capsid protein, thereby forming the AAV vector for gene targeting and expression; the AAV-8 serotype capsid protein is an amino acid sequence that is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homologous to SEQ ID NO. 7.

9. The method of constructing an AAV vector for gene targeting and expression according to claim 8, wherein the inserted nucleotide sequence is a sequence encoding SEQ ID NO:3, and a nucleotide sequence of the amino acid sequence shown in 3.

10. A recombinant adeno-associated virus particle comprising an engineered capsid protein of said AAV-8 serotype; the altered capsid protein of AAV-8 serotype is the polypeptide for targeting of claim 1 inserted between amino acid 590 and amino acid 591 of said AAV-8 serotype capsid protein; the AAV-8 serotype capsid protein is an amino acid sequence that is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homologous to SEQ ID NO. 7.

11. The recombinant adeno-associated virus particle of claim 10, wherein the polypeptide for targeting has an amino acid sequence as set forth in SEQ ID NO: 3.

12. Use of a recombinant adeno-associated virus particle according to claim 10 or 11, wherein the use is any of the following:

p7, use in targeting cerebellum, motor cortex and/or striatum; or in the preparation of targeted cerebellum drugs, motor cortex drugs and/or striatal drugs,

p8, use in targeting retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells, and/or THP1 cells; or preparing targeted retinal ganglion isolated cells, neuro2A cells, MULLER cells, SH-SY-5Y cells, jurkat cells, K562 cells and/or THP1 cells.

Images