WO2020000641A1 - Nucleic acid for coding human nadh dehydrogenase sigmasubunit protein and application thereof - Google Patents

Abstract

Provided are a nucleic acid for coding a human NADH dehydrogenase sigmasubunit protein, a fusion nucleic acid comprising a mitochondrial targeting peptide coding sequence, a vector and a host cell comprising the nucleic acid or the fusion nucleic acid, a preparation method for a recombinant protein or the fusion protein, a pharmaceutical formulation, and a use of the vector or pharmaceutical formulation in treating hereditary optic neuropathy. The nucleic acid for coding the human NADH dehydrogenase sigmasubunit protein is a nucleic acid for coding a human NADH dehydrogenase sigmasubunit 6 protein having a nucleotide sequence as shown in SEQ ID No: 1 or 2, or having homology greater than or equal to 95% with respect to SEQ ID No: 1 or 2, or a nucleic acid for coding a human NADH dehydrogenase sigmasubunit 1 protein having a nucleotide sequence as shown in SEQ ID No: 3 or 4, or having homology greater than or equal to 95% with respect to SEQ ID No: 3 or 4.

Description

Nucleic acid encoding human NADH dehydrogenase subunit protein and application thereof Technical field

The invention relates to the technical field of genetic engineering, in particular to a nucleic acid encoding a human NADH dehydrogenase subunit protein and application thereof.

Background technique

Leber's hereditary optic neuroneopathy (LHON) is a mitochondrial hereditary disease that mainly affects the macular papillary bundle fibers and causes degeneration of the optic nerve. The disease is prevalent in young and middle-aged men, and the clinical manifestations are simultaneous or successive acute or subacute painless vision loss in both eyes, and may be accompanied by central visual field defect and color vision disorder.

Leber's hereditary optic neuropathy (LHON) is associated with mutations in mitochondrial DNA, and many mitochondrial DNA (mtDNA) mutations have been found to date. The mtDNA mutation affects the function of oxidative phosphorylation, resulting in a lack of ATP production and insufficient energy supply, which leads to the cell's inability to perform normal metabolism, cell degeneration, necrosis or death, tissue and organ function decline, and corresponding clinical symptoms. At present, more than 95% of LHON patients in China due to gene mutations are related to three primary sites of mitochondria, including: 11778 site mutations (human NADH dehydrogenase subunit 4, ND4), accounting for about 90%; 14484 Site mutation (human NADH dehydrogenase subunit 6, ie, ND6) accounts for about 4 to 5%; 3460 site mutation (human NADH dehydrogenase subunit 1, ie, ND1) accounts for about 1%. Position 14484 is one of the three high-incidence sites that can cause LHON in the Chinese population. It is mainly that the 14484 nucleotide of the ND6 gene is mutated from T to C. After mutation, the starting amino acid encoded by position 64 of the ND6 subunit is mutated. The replacement of methionine with valine is a low-conservation site. This mutation reduces the activity of respiratory chain complex I, thereby reducing the production of ATP in optic nerve cells, and the cells gradually apoptosis, which leads to LHON in patients. As one of the high incidence sites, the 3460 site has a poor prognosis, and many patients have a visual acuity below 0.1. The mutation at position 3460 is mainly the mutation of nucleotide 3460 of ND1 gene from cytosine (C) to adenine (A), causing alanine to threonine. This mutation makes the activity of complex I Loss of 20%, thereby reducing the production of ATP in the optic nerve cells, and the cells gradually apoptosis, which leads to LHON in patients.

LHON currently has no method of treatment, and it is one of the world's recognized adolescent blindness diseases. With the development of gene therapy, LHON gene therapy becomes possible. The difficulty is that the transfected gene enters the nucleus, and the mutation site of LHON Mitochondrial DNA is caused by abnormal proteins in the mitochondria. However, at present, there is no effective treatment for LHON caused by ND6 (14484 mutation) or ND1 (3460 mutation). ND4 is the focus of current domestic and foreign research. Due to the small number of cases related to ND6 and ND1, there are no separate research patents and literature.

Therefore, there is an urgent need in the art to develop an expression system and a preparation method for highly expressing human NADH dehydrogenase subunit 6 protein or human NADH dehydrogenase subunit 1 protein.

Summary of the invention

An object of the present invention is to provide an expression system and a preparation method for highly expressing human NADH dehydrogenase subunit 6 protein or human NADH dehydrogenase subunit 1 protein.

According to a first aspect of the present invention, a nucleotide sequence is provided, the nucleotide sequence is selected from the following group:

(a) a nucleotide sequence encoding a human NADH dehydrogenase subunit 6 protein, and the nucleotide sequence is shown in SEQ ID NO :: 1 or 2;

(b) a nucleotide sequence encoding a human NADH dehydrogenase subunit 1 protein, and the nucleotide sequence is shown in SEQ ID NO :: 3 or 4;

(c) has a homology of ≥95% (preferably ≥98%, more preferably ≥99%) with the nucleotide sequence shown in any one of SEQ ID NOs: 1-4, and encodes human NADH dehydrogenation The nucleotide sequence of an enzyme subunit 6 protein or a human NADH dehydrogenase subunit 1 protein; and

(d) A nucleotide sequence complementary to the nucleotide sequence of any one of (a) to (c).

In another preferred example, the nucleotide sequence includes a DNA sequence, a cDNA sequence, or an mRNA sequence.

In another preferred example, the nucleotide sequence includes a single-stranded sequence and a double-stranded sequence.

According to a second aspect of the present invention, there is provided a fusion nucleic acid comprising the nucleotide sequence according to the first aspect of the present invention.

In another preferred example, the fusion nucleic acid further comprises a sequence selected from the group consisting of a coding sequence of a mitochondrial targeting peptide, a UTR sequence, or a combination thereof.

In another preferred example, the coding sequence of the mitochondrial targeting peptide includes: a coding sequence of COX10 and / or a coding sequence of OPA1.

In another preferred example, the coding sequence of COX10 has a sequence as shown in SEQ ID NO .: 5 or 6.

In another preferred example, the coding sequence of OPA1 has the sequence shown in SEQ ID NO.:7.

In another preferred example, the UTR sequence includes 3'-UTR and / or 5'-UTR, preferably 3'-UTR.

In another preferred example, the UTR sequence has a sequence as shown in SEQ ID NO.:8.

In another preferred example, the fusion nucleic acid has the structure of Formula I from the 5 'end to the 3' end:

Z0-Z1-Z2-Z3 (I)

Where

Each "-" is independently a bond or a nucleotide linking sequence;

Z0 is none or 5'-UTR sequence;

Z1 is the coding sequence of the mitochondrial targeting peptide;

Z2 is a nucleotide sequence according to the first aspect of the invention; and

Z3 is a 3'-UTR sequence.

In another preferred example, the Z1 is a COX10 coding sequence or an OPA1 coding sequence.

In another preferred example, the structure of the fusion nucleic acid from the 5'-3 'end is COX10-ND6-UTR; preferably, the fusion nucleic acid sequence is shown as SEQ ID NO .: 9 or 10.

In another preferred example, the sequence is shown in the fusion nucleic acid shown in SEQ ID No .: 9 or 10,

Bits 1-84 are the COX10 coding sequence;

Positions 85-609 are nucleotide sequences encoding human NADH dehydrogenase subunit 6 protein;

Bits 610-2034 are 3'-UTR sequences.

In another preferred example, the structure of the fusion nucleic acid from the 5'-3 'end is COX10-ND1-UTR; preferably, the fusion nucleic acid sequence is shown as SEQ ID NO .: 11 or 12.

In another preferred example, the sequence is in the fusion nucleic acid shown in SEQ ID NO: 11 or 12,

Bits 1-84 are the COX10 coding sequence;

Positions 85-1035 are the nucleotide sequences encoding human NADH dehydrogenase subunit 1 protein;

Bits 1036-2460 are 3'-UTR sequences.

In another preferred example, the structure of the fusion nucleic acid from the 5'-3 'end is OPA1-ND6-UTR or OPA1-ND1-UTR.

In another preferred example, the length of each nucleotide linking sequence is 1-30 nt, preferably 1-15 nt, and more preferably 3-6 nt.

In another preferred example, the nucleotide linking sequence is derived from a nucleotide linker sequence formed by restriction enzyme digestion.

According to a third aspect of the present invention, there is provided a vector containing the nucleotide sequence according to the first aspect of the present invention or the fusion nucleic acid according to the second aspect of the present invention.

In another preferred example, the vector includes one or more promoters, and the promoters are operatively linked to the nucleic acid sequence, enhancer, transcription termination signal, polyadenylation sequence, origin of replication, and selectable marker. , Nucleic acid restriction sites, and / or homologous recombination sites.

In another preferred example, the vector includes a plasmid and a viral vector.

In another preferred example, the vector includes a DNA virus and a retrovirus vector.

In another preferred example, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated virus vector, or a combination thereof. Preferably, the vector is an AAV vector.

In another preferred example, the serotype of the AAV vector is selected from: AAV2, AAV5, AAV7, AAV8, or a combination thereof.

In another preferred example, the vector is an AAV vector containing or inserted with the nucleotide sequence according to the first aspect of the present invention or the fusion nucleic acid according to the second aspect of the present invention; preferably the AAV vector plasmid pSNaV .

In another preferred example, the backbone of the vector is an adeno-associated virus vector plasmid pSNaV.

In another preferred example, the vector is used for expressing recombinant human NADH dehydrogenase subunit 6 protein or human NADH dehydrogenase subunit 1 protein.

According to a fourth aspect of the present invention, there is provided a host cell containing the vector according to the third aspect of the present invention, or the genome of which the exogenous nucleotide sequence of the first aspect of the present invention is integrated Or the fusion nucleic acid according to the second aspect of the present invention.

In another preferred example, the host cell is a mammalian cell, and the mammal includes a human and a non-human mammal.

In another preferred example, the host cell is selected from the group consisting of HEK293 cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as biganglion cells), (optical) nerve cells, Or a combination.

In another preferred example, the host cell is selected from the group consisting of rod cells, cone cells, photophobic bipolar cells, photophobic bipolar cells, horizontal cells, ganglion cells, amacrine cells, or combination. Preferably, the host cell is a (retinal) ganglion cell.

According to a fifth aspect of the present invention, there is provided the use of the carrier according to the third aspect of the present invention for preparing a preparation or composition for restoring vision and / or treating eyes of a subject. disease.

In another preferred example, the eye disease is an optic nerve degenerative disease.

In another preferred example, the preparation or composition is used to treat focal degeneration of retinal ganglion cells.

In another preferred example, the preparation or composition is used for treating hereditary optic neuropathy, preferably Leber's hereditary optic neuropathy (LHON).

According to a sixth aspect of the present invention, there is provided a pharmaceutical preparation containing (a) the carrier according to the third aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred example, the dosage form of the pharmaceutical preparation is selected from the group consisting of a lyophilized preparation, a liquid preparation, or a combination thereof. Preferably, the dosage form of the pharmaceutical preparation is an injection dosage form.

In another preferred example, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated virus vector, or a combination thereof. Preferably, the vector is an AAV vector.

In another preferred example, the content of the carrier in the pharmaceutical preparation is 1 × 10 ⁹ -1 × 10 ¹⁶ , preferably 1 × 10 ¹² -1 × 10 ¹³ viruses / ml.

In another preferred example, the pharmaceutical preparation is used for treating ocular diseases, preferably treating optic nerve degenerative diseases, and more preferably treating focal degeneration of retinal ganglion cells.

In another preferred example, the pharmaceutical preparation is used for treating hereditary optic neuropathy, preferably Leber's hereditary optic neuropathy (LHON).

According to a seventh aspect of the present invention, there is provided a treatment method, which comprises applying the carrier according to the third aspect of the present invention to a subject in need.

In another preferred example, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated virus vector, or a combination thereof. Preferably, the vector is an AAV vector.

In another preferred example, the carrier is introduced into the eye of a desired subject.

In another preferred example, the required objects include humans and non-human mammals.

In another preferred example, the treatment method is a method for treating eye diseases.

In another preferred example, the eye disease is hereditary optic neuropathy, preferably Leber's hereditary optic neuropathy (LHON).

According to an eighth aspect of the present invention, a method for preparing a recombinant human NADH dehydrogenase subunit 6 protein or a human NADH dehydrogenase subunit 1 protein is provided, comprising the steps of: culturing the host cell according to the fourth aspect of the present invention, Thereby, a recombinant human NADH dehydrogenase subunit 6 protein or a human NADH dehydrogenase subunit 1 protein is obtained.

According to a ninth aspect of the present invention, there is provided a fusion protein encoded by the fusion nucleic acid according to the second aspect of the present invention.

It should be understood that, within the scope of the present invention, the above technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, I will not repeat them here.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the structure of the recombinant plasmid pSNaV / rAAV2 / 2-ND6, where MTS refers to the mitochondrial localization sequence.

Figure 2 shows an agarose gel electrophoresis image of the PCR product, where M is Marker and lanes 1 and 2 are both ND6.

Figure 3 shows fundus photography of rabbits, where A is the rAAV-ND6 injection group, B is the rAAV-GFP injection group, and C is the PBS injection group.

Figure 4 shows a retinal fluorescence photograph of rabbits, where A is the rAAV-GFP injection group and B is the PBS injection group.

Figure 5 shows the fundus photographs of rabbit eyes under glass microscope, where A is the rAAV2 / 2-optimized ND6 group (experimental group A1), B is the rAAV2 / 2-ND6 group (experimental group B1), and C is rAAV2- EGFP group (control group C1).

Figure 6 shows the relative expression levels of 293T cells infected with rAAV2 / 2-optimized ND6 group (experimental group A2), rAAV2 / 2-ND6 group (experimental group B2), rAAV2-EGFP group (control group C2), and ND6 gene. .

Figure 7 shows the relative expression levels of 293T cells infected with rAAV2 / 2-optimized ND6 group (experimental group A2), rAAV2 / 2-ND6 group (experimental group B2), rAAV2-EGFP group (control group C2), and ND6 protein.

Figure 8 shows the structure of the recombinant plasmid pSNaV / rAAV2 / 2-ND1, where MTS refers to the mitochondrial localization sequence.

Figure 9 shows an agarose gel electrophoresis picture of the PCR product, where M is Marker and lane 1 is ND1.

Figure 10 shows fundus photography of rabbits, where A is the rAAV2 / 2-ND1 injection group, B is the rAAV-GFP injection group, and C is the PBS injection group.

Figure 11 shows a retinal fluorescence photograph of rabbits, where A is the rAAV-GFP injection group and B is the PBS injection group.

Figure 12 shows the fundus photographs of rabbit eyes under glass microscope, where A is injected with rAAV2 / 2-optimized ND1 group (Experimental group A3), B is injected with rAAV2 / 2-ND1 group (Experimental group B3), and C is injected with rAAV2- EGFP group (control group C3).

Figure 13 shows the relative expression levels of 293T cells infected with rAAV2 / 2-optimized ND1 group (experimental group A4), rAAV2 / 2-ND1 group (experimental group B4), rAAV2-EGFP group (control group C4), and ND1 gene. .

Figure 14 shows the relative expression levels of 293T cells infected with rAAV2 / 2-optimized ND1 group (experimental group A4), rAAV2 / 2-ND1 group (experimental group B4), rAAV2-EGFP group (control group C4), and ND1 protein.

detailed description

After extensive and intensive research, the present inventors have targeted and optimized the coding sequence of the recombinant human NADH dehydrogenase subunit 6 or 1 protein gene, thereby obtaining a type that is particularly suitable for mammalian (such as human) cells. Efficient transcription and efficient expression of ND6 or ND1 protein and transfection into the mitochondrial nucleotide sequence and fusion nucleic acid, and a recombinant expression vector of recombinant human NADH dehydrogenase subunit 4 protein was constructed. After the specially optimized ND6 or ND1 coding sequence, the expression of recombinant human NADH dehydrogenase subunit 6 or 1 protein was significantly increased, at least more than twice. The transcription level of the optimized ND6 coding sequence is also slightly increased, and it can effectively enter the mitochondria, exert the physiological functions of normal mitochondrial ND6 or ND1 protein, and achieve the purpose of treating LHON. On this basis, the inventors have completed the present invention.

the term

In order that the present disclosure may be more easily understood, certain terms are first defined. As used in this application, unless expressly stated otherwise herein, each of the following terms shall have the meaning set out below. Other definitions are set forth throughout the application.

The term "about" may refer to a value or composition within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 and (eg, 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the terms "containing" or "including (comprising)" may be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

Sequence identity by comparing two aligned along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the length of a reference nucleotide sequence or protein) Sequence and determine the number of positions where identical residues occur. Generally, this is expressed as a percentage. The measurement of the sequence identity of a nucleotide sequence is a method well known to those skilled in the art.

As used herein, the terms "subject", "subject in need" refers to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cattle, horses, dogs, cats, pigs, sheep, goats.

The terms "NADH dehydrogenase subunit 6 protein", "human NADH dehydrogenase subunit 6 protein", "ND6 (protein)", "recombinant human NADH dehydrogenase subunit 6 protein" and "ND6 protein of the present invention" Used interchangeably.

The terms "NADH dehydrogenase subunit 1 protein", "human NADH dehydrogenase subunit 1 protein", "ND1 (protein)", "recombinant human NADH dehydrogenase subunit 1 protein" and "ND1 protein of the present invention" Used interchangeably.

Adeno-associated virus

Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Parvoviridae-dependent virus. It is the simplest single-stranded DNA-deficient virus found in the class and requires an auxiliary virus (usually an adenovirus). Virus) is involved in replication. It encodes the cap and rep genes in an inverted repeat (ITR) at both ends. ITRs are decisive for virus replication and packaging. The cap gene encodes a viral capsid protein, and the rep gene is involved in virus replication and integration. AAV can infect a variety of cells.

Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its good safety, a wide range of host cells (dividing and non-dividing cells), and low immunogenicity, it can express foreign genes in vivo. It is regarded as one of the most promising gene transfer vectors and has been widely used in gene therapy and vaccine research worldwide. After more than 10 years of research, the biological characteristics of recombinant adeno-associated viruses have been thoroughly understood, and in particular, a lot of data has been accumulated on its application effects in various cells, tissues and in vivo experiments. In medical research, rAAV is used for gene therapy research of various diseases (including in vivo and in vitro experiments); as a characteristic gene transfer vector, it is also widely used in gene function research, disease model construction, and gene preparation Knock out rats and so on.

In a preferred embodiment of the present invention, the vector is a recombinant AAV vector. AAVs are relatively small DNA viruses that can be integrated into the genome of the cells they infect in a stable and site-specific manner. They are able to infect a large array of cells without any effect on cell growth, morphology or differentiation, and they do not seem to involve human pathology. The AAV genome has been cloned, sequenced, and characterized. AAV contains approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as the origin of replication of the virus. The rest of the genome is divided into two important regions with capsidation: the left part of the genome containing the rep gene involved in viral replication and viral gene expression; and the right part of the genome containing the cap gene encoding the viral capsid protein.

AAV vectors can be prepared using standard methods in the art. Any serotype of adeno-associated virus is suitable. Methods for purifying vectors can be found in, for example, U.S. Patent Nos. 6566118, 6989264, and 6995006, the disclosures of which are incorporated herein by reference in their entirety. The preparation of hybrid vectors is described, for example, in PCT Application No. PCT / US2005 / 027091, the disclosure of which is incorporated herein by reference in its entirety. The use of AAV-derived vectors for in vitro and in vivo transport of genes has been described (see, for example, International Patent Application Publication Nos. WO91 / 18088 and WO93 / 09239; U.S. Patent Nos. 4,797,368, 6,596,535 and 5,139,941, and European Patent No. 0488528, all of which are incorporated herein by reference in their entireties). These patent publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced by the gene of interest, and these constructs are in vitro (into cultured cells) or in vivo (directly into organisms) ) Use of a gene of interest. Replication-deficient recombinant AAV can be prepared by co-transfecting the following plasmids into a cell line infected with a human helper virus (such as an adenovirus): The nucleic acid sequence of interest is flanked by two AAV inverted terminal repeats (ITR) Regional plasmids, and plasmids carrying AAV capsidization genes (rep and cap genes). The AAV recombinants produced are then purified by standard techniques.

In some embodiments, the recombinant vector is capsidized to a virion (e.g., including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 And AAV16 AAV virions). Accordingly, the disclosure includes a recombinant virion (recombinant because it comprises a recombinant polynucleotide) that contains any of the vectors described herein. Methods of generating such particles are known in the art and are described in U.S. Patent No. 6,596,535.

Nucleic acid coding sequence

The technical problem to be solved by the present invention is to overcome the technical problem that the NADH dehydrogenase subunit 6 (ND6) or NADH dehydrogenase subunit 1 (ND1) sequence cannot be transfected into the mitochondria in the prior art, and the treatment effect is poor. . In order to solve the above technical problem, a nucleotide sequence according to the first aspect of the present invention is provided.

Specifically, the present invention provides a coding sequence of NADH dehydrogenase subunit 6 protein and application thereof. It was found through research that the amount of ND6 protein transfected into the mitochondria of the ND6 coding sequence of the present invention is larger, and more ND6 proteins play a physiological role in the patient's optic ganglion cells. The nucleic acid encoding the human NADH dehydrogenase subunit 6 protein according to the present invention has a nucleotide sequence as shown in SEQ ID NO .: 1 or 2 and has a total length of 525 bp.

Specifically, the present invention provides a coding sequence of NADH dehydrogenase subunit 1 protein and application thereof. It has been found through research that the optimized ND1 coding sequence of the present invention makes the expression of ND1 protein more efficient, and more ND1 protein plays a physiological role in the patient's optic ganglion cells. The nucleic acid encoding the human NADH dehydrogenase subunit 1 protein according to the present invention has a nucleotide sequence as shown in SEQ ID NO :: 3 or 4, and has a full length of 951 bp.

The polynucleotide of the present invention may be in the form of DNA or RNA. In another preferred example, the nucleotide is DNA. The form of DNA includes cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The full-length nucleotide sequence of the present invention or a fragment thereof can usually be obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed based on published related nucleotide sequences, especially open reading frame sequences, and a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art can be used as a primer. Template, amplified to obtain the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then stitch the amplified fragments together in the correct order. At present, a DNA sequence encoding a polypeptide (or a fragment thereof, or a derivative thereof) of the present invention can be obtained completely through chemical synthesis. This DNA sequence can then be introduced into a variety of existing DNA molecules (or such as vectors) and cells known in the art.

The invention also relates to a vector comprising a polynucleotide of the invention, and to a host cell genetically engineered using the vector or polypeptide coding sequence of the invention. The aforementioned polynucleotides, vectors or host cells may be isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.

In a preferred embodiment of the present invention, the nucleotide sequence is as shown in any one of SEQ ID Nos .: 1-4.

Once the relevant sequences are obtained, the recombination method can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and then isolating the relevant sequence from the proliferated host cell by conventional methods. In addition, synthetic methods can also be used to synthesize related sequences, especially when the fragment length is short. Generally, long fragments can be obtained by synthesizing multiple small fragments first and then ligating them. A method of applying PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. Primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector or protein coding sequence of the present invention, and a method for utilizing the host cell to express ND6 or ND1 protein by recombinant technology.

A host cell (such as a mammalian cell) expressing the ND6 or ND1 protein of the present invention can be obtained by using the polynucleotide sequence of the present invention through conventional recombinant DNA technology. Generally, the method includes the steps of transducing a polynucleotide according to the first aspect of the present invention, a fusion nucleic acid according to the second aspect of the present invention, or a vector according to the third aspect of the present invention into a host cell.

Methods well known to those skilled in the art can be used to construct an expression vector containing a coding DNA sequence of a polypeptide of the present invention and a suitable transcription / translation control signal. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology. The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli. A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell so that it can express a polypeptide.

The host cell can be a prokaryotic cell, or a lower eukaryotic cell, or a higher eukaryotic cell, such as a mammalian cell (including human and non-human mammals). Representative examples include animal cells such as CHO, NSO, COS7, or 293 cells. In a preferred embodiment of the present invention, HEK cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as biganglion cells), and neural cells are selected as host cells. In another preferred example, the host cell is selected from the group consisting of rod cells, cone cells, photophobic bipolar cells, photophobic bipolar cells, horizontal cells, ganglion cells, amacrine cells, or combination.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Another method is to use MgCl ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, and liposome packaging. The obtained transformant can be cultured by a conventional method, and expresses the protein encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

The polypeptide in the above method may be expressed intracellularly, or on a cell membrane, or secreted extracellularly. If desired, proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation, treatment with a protein precipitant (salting out method), centrifugation, osmotic disruption, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

ND6 coding sequence optimization

The present invention changes the mitochondrial coding sequence of ND6 to a nuclear coding sequence (as shown in SEQ ID NO.:1), which encodes a normal ND6 protein in the nucleus, which is exactly the same as the protein encoded in its mitochondria.

In addition, the present invention also optimizes sequence fragments that affect gene expression and protein localization. These sequence fragments include, but are not limited to, codon usage preferences, eliminate secondary structures (such as hairpin structures) that are not conducive to expression, and change GC content. CpG dinucleotide content, mRNA secondary structure, concealed splice sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repeating sequences ( Direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning. Through analysis and experimental screening, a specially optimized DNA coding sequence as shown in SEQ ID No .: 2 is finally obtained. This sequence is specially optimized, the transcription level is slightly increased, and the expression of ND6 is significantly increased.

As used herein, the "optimized ND6 coding sequence", "ND6 optimized gene", "ND6 optimized gene nucleic acid" and "optimized ND6 coding gene" all refer to a specially optimized nucleotide sequence encoding an ND6 protein (such as SEQ ID No .: 2). The expression of the ND6 protein of the optimized ND6 coding sequence is significantly increased.

ND1 coding sequence optimization

In the present invention, the mitochondrial coding sequence of ND1 is changed to a nuclear coding sequence (as shown in SEQ ID NO.:3), which encodes a normal ND1 protein in the nucleus, which is exactly the same as the protein encoded in the mitochondria.

In addition, the present invention also optimizes sequence fragments that affect gene expression and protein localization. These sequence fragments include, but are not limited to, codon usage preferences, eliminate secondary structures (such as hairpin structures) that are not conducive to expression, and change GC content. CpG dinucleotide content, mRNA secondary structure, concealed splice sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repeating sequences ( Direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning. Through analysis and experimental screening, a specially optimized DNA coding sequence as shown in SEQ ID NO.:4 is finally obtained. This sequence is specially optimized, and the expression of ND1 is significantly increased.

As used herein, the "optimized ND1 coding sequence", "ND1 optimized gene", "ND1 optimized gene nucleic acid", and "optimized ND1 coding gene" all refer to a specially optimized nucleotide sequence encoding an ND1 protein (such as SEQ ID No .: 4). The expression of the ND1 protein of the optimized ND1 coding sequence is significantly increased.

Fusion nucleic acid

The invention also provides a fusion nucleic acid comprising the nucleotide sequence according to the first aspect of the invention.

As used herein, a "fusion nucleic acid" refers to a nucleic acid formed by joining two or more nucleotide sequences from different sources, or two or more nucleosides from the same source but whose natural positions are not linked to each other. Nucleic acid formed by linking acid sequences. The protein encoded by the fusion nucleic acid of the present invention is called a fusion protein, and in the present invention, it is an ND6 fusion protein or an ND1 fusion protein.

In a preferred embodiment of the present invention, the fusion nucleic acid is operably linked to the coding sequence and / or UTR sequence of the mitochondrial targeting peptide in a nucleic acid encoding a human ND6 or ND1 protein. The fusion nucleic acid terminal mitochondrial localization sequence (or mitochondrial targeting sequence, Mitochondrial targeting sequence, MTS) can guide the encoded ND6 or ND1 protein in the nucleus to the mitochondria, and exert the normal physiological characteristics of the mitochondrial ND6 or ND1 protein. Function to achieve the purpose of treating LHON.

Preferably, when the nucleic acid encoding the human ND6 or ND1 protein is linked to the coding sequence of the mitochondrial targeting peptide, the coding sequence of the mitochondrial targeting peptide is the COX10 gene as shown in SEQ ID NO: 5 or 6. The coding sequence of the mitochondrial targeting peptide (COX10 sequence for short), or the coding sequence of the mitochondrial targeting peptide of the OPA1 (optic atrophy 1) antibody shown in SEQ ID No .: 7 (referred to as OPA1) Sequence); when the nucleic acid encoding the ND6 or ND1 protein is linked to a UTR sequence, the UTR sequence is as shown in SEQ ID NO.:8. Among them, the COX10 sequence shown in SEQ ID NO.:5 is the original COX10 coding sequence, and the COX10 sequence shown in SEQ ID NO.:6 is the COX10 coding sequence obtained after targeted optimization.

In another preferred example, in the fusion nucleic acid, the coding sequence of COX10, the nucleic acid encoding human ND6 or ND1 protein, and the UTR sequence are sequentially arranged from the 5 'end to the 3' end.

In another preferred example, the sequence of the fusion nucleic acid is shown as SEQ ID NO .: 9 or 10. The COX10 gene is a mitochondrial targeting sequence that guides the ND6 protein into the mitochondria and exerts its physiological functions. The 3'UTR is a non-coding sequence designed behind the ND6 protein. Its role is to stabilize the expression of the COX10 gene mitochondrial targeting sequence and the ND6 sequence. .

In the sequence shown in SEQ ID No .: 9, the total length of the nucleic acid sequence of the ND6 fusion protein is 2034bp, from 1bp to 84bp is the mitochondrial targeting sequence of the COX10 gene (84bp in total) (underlined); 85bp to 609bp is ND6 gene (525bp in total), 610bp to 2034bp is 3'UTR (1425bp in total).

In the sequence shown in SEQ ID NO.:10, the length of the optimized nucleic acid sequence of the ND6 fusion protein is 2034bp, from 1bp to 84bp is the optimized mitochondrial targeting sequence of the COX10 gene (84bp in total) (underlined part); 85bp to 609bp are ND6 optimized genes (525bp in total), and 610bp to 2034bp are 3'UTRs (1425bp in total).

In another preferred example, the sequence of the fusion nucleic acid is shown as SEQ ID NO .: 11 or 12. The COX10 gene is a mitochondrial targeting sequence, which guides the ND1 protein into the mitochondria and exerts its physiological functions. The 3'UTR (Untranslated Region) is a non-coding region and is designed behind the ND1 protein to stabilize the expression of mitochondrial targeting sequences and ND1 .

In the sequence shown in SEQ ID No .: 11, the full length of the ND1 fusion nucleic acid sequence is 2460bp, from 1bp to 84bp is the mitochondrial targeting sequence of the COX10 gene (a total of 84bp) (underlined); 85bp to 1035bp is the ND1 gene The sequence (total 951bp), 1036bp to 2460bp is 3'UTR sequence (total 1425bp).

In the sequence shown in SEQ ID NO .: 12, the total length of the optimized nucleic acid sequence of the ND1 fusion protein is 2460bp, from 1bp to 84bp is the optimized mitochondrial targeting sequence of the COX10 gene (84bp in total) (underlined part); 85bp to 1035bp is the ND1 gene sequence (a total of 951bp), and 1036bp to 2460bp is a 3'UTR sequence (a total of 1425bp).

Expression vectors and host cells

The present invention also provides an expression vector for ND6 or ND1 protein, which contains the optimized ND6 or ND1 coding sequence of the present invention.

By providing the sequence information, a skilled artisan can use available cloning techniques to generate a nucleic acid sequence or vector suitable for transduction into a cell.

Preferably, a nucleic acid sequence encoding a ND6 or ND1 protein is provided as a vector, preferably an expression vector is provided. Preferably, it is provided as a gene therapy vector that is preferably suitable for transduction and expression in retinal target cells. The vector can be viral or non-viral (e.g., a plasmid). Viral vectors include those derived from: adenovirus, adeno-associated virus (AAV) including mutant forms, retroviruses, lentivirus, herpes virus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV) , HIV, pox virus, and SV40. Preferably, the viral vector is replication-defective, although it is envisaged that it may be replication-deficient, capable of replication or conditionally replicating. Viral vectors can often maintain an extrachromosomal state without integrating into the genome of target retinal cells. A preferred viral vector for introducing a nucleic acid sequence encoding an ND6 or ND1 protein to a retinal target cell is an AAV vector, such as a self-complementary adeno-associated virus (scAAV). Selective targeting can be achieved using specific AAV serotypes (AAV serotype 2 to AAV serotype 12) or modified versions of any of these serotypes (including AAV 4YF and AAV 7m8 vectors).

Viral vectors can be modified to delete any non-essential sequences. For example, in AAV, the virus can be modified to delete all or part of the IX gene, Ela, and / or Elb gene. For wild-type AAV, there is no helper virus such as adenovirus, and replication is very inefficient. For a recombinant adeno-associated virus, preferably, the replication gene and the capsid gene are provided in trans (in the pRep / Cap plasmid), and only the 2ITR of the AAV genome is retained and packaged into the virion, while the adenovirus gene is required Provided by adenovirus or another plasmid. Similar modifications can also be made to lentiviral vectors.

Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be complexed with agents to facilitate uptake of the viral vector by target cells. Such agents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems can be used. The carrier for use in the present invention is preferably suitable for use in vivo or in vitro, and is preferably suitable for use in humans.

The vector will preferably contain one or more regulatory sequences to direct expression of the nucleic acid sequence in a retinal target cell. Regulatory sequences may include promoters, enhancers, transcription termination signals, polyadenylation sequences, origins of replication, nucleic acid restriction sites, and homologous recombination sites operably linked to a nucleic acid sequence. The vector may also include a selectable marker, for example, to determine expression of the vector in a growth system (e.g., a bacterial cell) or in a retinal target cell.

"Operably linked" means that the nucleic acid sequences are functionally related to their operably linked sequences such that they are linked in a manner such that they affect each other's expression or function. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern that is affected by the promoter.

The promoter mediates expression of the nucleic acid sequence to which it is linked. The promoter may be constitutive or may be inducible. Promoters can direct ubiquitous expression in internal retinal cells, or neuron-specific expression. In the latter case, the promoter can direct cell-type-specific expression, such as for optic ganglion cells. Suitable promoters will be known to those skilled in the art. For example, a suitable promoter may be selected from the group consisting of: L7, thy-1, restorer protein, calcium-binding protein, human CMV, GAD-67, chicken beta actin, hSyn, Grm6, Grm6 enhancer SV40 fusion protein . Targeting can be achieved using cell-specific promoters, such as Grm6-SV40 for selective targeting to optic nerve cells. The Grm6 promoter is a fusion of the 200 base pair enhancer sequence of the Grm6 gene and the SV40 eukaryotic promoter. The Grm6 gene encodes a specific glutamate receptor mGluR6 that is specific to optic nerve cells. The preferred sources of the Grm6 gene are mouse and human. Ubiquitous expression can be achieved using a pan-neuronal promoter, examples of which are known and available in the art. One such example is CAG. CAG is then a fusion of the early CMV enhancer and the chicken β-actin promoter.

An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strongly constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences can also be used, including but not limited to the simian virus 40 (SV40) early promoter, mouse breast cancer virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Russ sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter , Myosin promoter, heme promoter, and creatine kinase promoter. Further, the present invention should not be limited to the application of a constitutive promoter. Inducible promoters are also considered as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of a polynucleotide sequence operably linked to an inducible promoter when such expression is desired, or turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter. Many expression vectors can be expressed in mammalian cells (preferably human, more preferably human optic nerve cells or photoreceptor cells) using ND6 or ND1 protein. The present invention preferably uses an adeno-associated virus as an expression vector.

The invention also provides a host cell for expressing ND6 or ND1 protein. Preferably, the host cell is a mammalian cell (preferably a human, more preferably a human optic nerve cell or a photoreceptor cell), which increases the expression of the ND6 or ND1 protein.

Formulations and compositions

The invention provides a formulation or composition comprising (a) the carrier according to the third aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred example, the pharmaceutical preparation is used to treat ocular diseases; preferably, the pharmaceutical preparation is used to treat hereditary optic neuropathy, preferably Leber's hereditary optic neuropathy (LHON).

The "active ingredient" in the pharmaceutical composition according to the present invention refers to a vector according to the present invention, such as a viral vector (including an adeno-associated virus vector). The "active ingredients", formulations and / or compositions described herein can be used to treat ocular diseases. A "safe and effective amount" means that the amount of the active ingredient is sufficient to significantly improve the condition or symptoms without causing serious side effects. "Pharmaceutically acceptable carrier or excipient" means: one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must be of sufficient purity and sufficient Low toxicity. "Compatibility" here means that each component in the composition can blend with the active ingredient of the present invention and each other without significantly reducing the medicinal effect of the active ingredient.

The composition may be a liquid or a solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

In the present invention, the carrier may be administered to the eye by subretinal or intravitreal administration. In either mode of administration, the carrier is preferably provided as an injectable liquid. Preferably the injectable liquid is provided as a capsule or syringe.

Examples of pharmaceutically acceptable carriers are cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, and solid lubricants (such as stearic acid). , Magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as

), Wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

The composition may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into a sterile injectable solution or dispersion. Suitable aqueous and non-aqueous vehicles, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

The ND6 or ND1-encoding nucleic acid or fusion nucleic acid provided by the present invention can produce ND6 or ND1 protein or ND6 or ND1 fusion protein in vitro or in vivo. The fusion protein or the preparation containing the fusion protein can be used to prepare Leber's genetics. For neuropathic optic neuropathy.

The optimized nucleic acid encoding human ND6 or ND1 protein has a higher expression level, which translates more ND6 or ND1 fusion proteins, while the COX10 sequence can accurately locate the ND6 or ND1 fusion protein on the mitochondrial inner membrane, so there are more Many ND6 or ND1 proteins are transfected into mitochondria. The agent for fusion nucleic acid of the present invention is injected into the vitreous cavity of a rabbit eye, and the agent maintains viability in the vitreous cavity and is transfected into optic nerve cells. Optimized ND6 or ND1 nucleic acid encodes more ND6 or ND1 protein than the prior art, which has higher transfection efficiency and can better treat Leber hereditary optic neuropathy.

Compared with the prior art, the present invention mainly has the following advantages:

1. The present invention improves the nucleotides of ND6 and ND1 by changing the mitochondrial coding sequence of ND6 and ND1 to a nuclear coding sequence so that it encodes the normal ND6 or ND1 protein in the nucleus of the ND6 and ND1, and interacts with the protein encoded by mitochondria. Exactly the same, it is very effective in treating Leber's hereditary optic neuropathy.

2. The present invention connects the mitochondrial localization sequence at the ends of the coding sequences of ND6 and ND1, which can guide the encoded ND6 or ND1 protein in the nucleus into the mitochondria, exert the normal physiological function of mitochondrial ND6 or ND1 protein, and achieve the treatment of LHON. purpose.

3. The present invention specifically optimizes the sequences of the recombinant human ND6 and ND1 coding genes. Compared with the unoptimized DNA coding sequences of ND6 and ND1, the optimized sequences of ND6 and ND1 have significantly higher protein expression and higher biological activity. Among them, the transcription level of the optimized ND6 coding sequence was also slightly increased.

4. The optimized COX10 sequence or OPA1 sequence of the present invention can accurately locate the ND6 or ND1 fusion protein on the mitochondrial inner membrane, so more ND6 or ND1 proteins are transfected into the mitochondria.

5. The ND6 or ND1 encoding gene or fusion nucleic acid optimized by the present invention can treat Leber hereditary optic neuropathy very effectively, and has good safety.

The present invention will be further described below in combination with specific implementation. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally based on conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions Conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

Example 1 Construction of pSNaV / rAAV2 / 2-ND6 plasmid and preparation of recombinant adeno-associated virus

1.Construction of pSNaV / rAAV2 / 2-ND6 plasmid

Obtain the nucleotide sequence of human NADH dehydrogenase subunit 6 (ND6) (NCBI reference sequence: NC_024511.2). The present invention changes the mitochondrial coding sequence of ND6 to a nuclear coding sequence (as shown in SEQ ID NO.:1 ), And connect the mitochondrial coding sequence of COX10 at the 5 'end of the ND6 gene (as shown in SEQ ID NO.:5), and the UTR sequence of the 3' end of the ND6 gene (as shown in SEQ ID NO.:8), the resulting The sequence of the fusion gene (or fusion nucleic acid) is shown in SEQ ID NO.:9, and all gene sequences were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.

The recombinant human NADH dehydrogenase subunit 6 fusion gene was amplified by PCR with primers added to the two restriction sites of Kpn I and Sal I, and the full length gene was digested by Kpn I / Sal I. Form a cohesive end, and insert the fusion gene into the plasmid vector pSNaV (BioVector) with the Kpn I / SalI digestion site to obtain a recombinant adeno-associated virus expression vector, named pSNaV / rAAV2 / 2-ND6 (referred to as rAAV2 / 2-ND6) (As shown in Figure 1).

2.Recombinant screening and identification

The pSNaV / rAAV2 / 2-ND6 obtained above was coated on a plate, and the LB plate cultured at 37 ° C showed blue spots and white spots, of which white was a recombinant clone. Pick white colonies and add them to LB liquid medium containing 100 mg / L Amp, and incubate at 37 ° C and 200 rpm for 8 h. After culturing, the bacterial solution was taken, and the plasmid pSNaV / rAAV2 / 2-ND6 was extracted. For the plasmid extraction procedure, refer to Biomiga's instructions and use ND6 full-length primers for PCR identification.

The ND6 full-length primer design is as follows:

ND6 full length-forward primer: 5'-ATGATGTATGCTTTGTTTCTG-3 '(SEQ ID NO .: 13)

ND6 full length-reverse primer: 5'-CTAATTCCCCCGAGCAATCTC-3 '(SEQ ID NO.:14)

After PCR, agarose gel electrophoresis (as shown in Figure 2) was found to have a ND6 target band at about 525 bp, indicating that the selected plasmid was the target plasmid.

Cell transfection

One day before transfection, HEK293 cells were seeded in a 225cm ² cell culture flask with a density of 3.0 × 10 ⁷ cells / mL. The culture medium was DMEM + 10% bovine serum and placed in a 37 ° C incubator containing 5% CO ₂ . Cultivate overnight; change the medium on the day of transfection and continue the culture with fresh DMEM medium containing 10% bovine serum. When the cells grow to 80-90%, the medium is discarded and transfected with PlasmidTrans II (VGTC) transfection kit. The specific steps are:

(a) Take pAd Helper (purchased from BioVector), pAAV-r2c2 (purchased from BioVector), pSNaV / rAAV2 / 2-ND6 plasmid and DMEM + PlasmidTrans II (VGTC) (transfection reagent) according to the required ratio for each transfection bottle Mix in a 1.5mL sterile Ep tube, numbered as Reagent A, and let stand at room temperature for 10-15 minutes;

(b) Mix reagent A with 30mL DMEM + 10% bovine serum, and number it as reagent B;

(c) Add reagent B evenly to the cell culture flask, and continue the cultivation in an incubator at 37 ° C containing 5% CO ₂ ;

(d) 16 hours after transfection, change to complete medium (DMEM + 10% bovine serum).

48 hours after transfection, the cells were harvested, and the harvested cells were resuspended in PBS and repeatedly frozen and thawed 3 times.

4.Isolation, concentration and purification of recombinant adeno-associated virus rAAV2 / 2-ND6

Recombinant adeno-associated virus rAAV2 / 2-ND6 was obtained by three steps of chloroform treatment-PEG / NaCl precipitation-chloroform extraction. The specific steps were as follows:

4.1 Virus collection: 1) Prepare a dry ice ethanol bath (or liquid nitrogen) and a 37 ° C water bath; 2) collect the cells collected in 1.3 above together with the culture medium into a 15 ml centrifuge tube; 3) centrifuge at 1000 rpm / min 3 minutes, the cells and supernatant were separated, the supernatant was stored separately, and the cells were resuspended in 1 ml of PBS; 4) the cell suspension was repeatedly transferred in a dry ice ethanol bath and a 37 ° C water bath, and freeze-thaw four times, freeze and thaw each 10 Minutes, with slight shock after each melt.

4.2 Concentration of virus: 1) Remove cell debris by centrifugation at 10,000 g, and transfer the supernatant obtained by centrifugation to a new centrifuge tube; 2) filter out impurities with a 0.45 μm filter; 3) add 1/2 volume of 1M NaCl, 10 % PEG8000 solution, mix evenly at 4 ° C overnight; 4) Centrifuge at 12,000 rpm for 2 hours, discard the supernatant, and dissolve the virus pellet with an appropriate amount of PBS solution. After complete dissolution, filter through a 0.22 μm filter to remove bacteria; 5) Add Benzonase nuclease Residual plasmid DNA was removed (final concentration 50 U / ml). Close the tube cap and invert several times to mix thoroughly. Incubate at 37 ° C for 30 minutes; 6) Filter through a 0.45 μm filter and take the filtrate, which is the concentrated rAAV2 / 2-ND6 virus solution.

4.3 Virus purification: 1) Add solid CsCl to the concentrated rAAV2 / 2-ND6 virus solution until the density is 1.41 g / ml (refractive index is 1.372); 2) Add the sample to the ultracentrifuge tube and prepare it with The 1.41 g / ml CsCl solution filled the remaining space of the centrifuge tube; 3) centrifuged at 175,000 g for 24 hours to form a density gradient. Samples of different densities were collected in sequence, and samples were taken for titer determination. Collect the components enriched with rAAV2 particles; 4) Repeat the above process once. The virus was loaded into a 100 kDa dialysis bag and dialyzed and desalted overnight at 4 ° C. Thus, a concentrated and purified recombinant adeno-associated virus rAAV2 / 2-ND6 was obtained.

Example 2 Titer determination of rAAV2 / 2-ND6

Digoxin-labeled H1 probe point hybridization was used to detect the physical titer of rAAV2 / 2-ND6 in the virus solution. The plasmid pSNAV-ND6 was accurately quantified, and diluted with a series of dilutions in a dilution buffer and spotted on a nylon membrane; a virus solution rAAV2 / 2-ND6 sample to be tested was digested with DNase I and RNase at 37 ° C for 1 h. The rAAV2 / 2-ND6 virus genome was extracted, denatured in a boiling water bath for 5 minutes, and then placed in an ice bath. Use the dilution buffer provided by the kit to make a series of dilutions and spot the membrane. Pre-hybridization, hybridization, membrane washing, and color development were performed according to the kit instructions of Boehringer Mannheim Company. The genome titer of rAAV2 / 2-ND6 was 2.0 × 10 ¹¹ vg / mL by calculating the copy number of pSNAV-ND6, and then multiplying it by the dilution factor of the virus liquid sample consistent with its hybridization signal intensity.

Example 3 rabbit eye vitreous cavity injection rAAV2 / 2-ND6 test

1. 24 rabbits were divided into 3 groups: experimental group 1-1, experimental group 1-2 and control group. Use rAAV2 / 2-ND6, rAAV-GFP and PBS to puncture the flat part of the ciliary body into the vitreous cavity at a distance of 3 mm from the limbus, and inject the vitreous cavity.

2. IOP and fundus photography examination

Three groups of rabbits were examined for intraocular pressure at 1, 7, and 30 days after operation. All rabbits had no obvious abnormalities, no conjunctival hyperemia, secretions, no endophthalmitis, and no increase in intraocular pressure. The fundus photographs at 30 days after the operation are shown in Fig. 3. All rabbits had no obvious complications or damage to the retinal blood vessels and optic nerve. Show that the normal standard vitreous cavity injection will not occur obvious inflammation or other complications.

3.Fluorescence photography of the retina

30 days after the vitreous cavity injection, the fluorescence photograph of the retina in the GFP group is shown in Figure 4. GFP was successfully expressed on the retina, indicating that rAAV was used as a vector and the GFP gene was transfected into the rabbit eye vitreous, which indirectly proved that rAAV2 / The 2-ND6 recombinant gene can be expressed on the retina.

4.Real-time PCR detection of ND6 expression

The total RNA of rabbit neuronal cells in rAAV2 / 2-ND6 group and PBS group was extracted with TRIZOL kit and reverse-transcribed to synthesize cDNA template. Then, based on the primer design principles of real-time PCR, primers were designed using primer 5 (β-actin as internal reference):

β-actin-forward primer: CGAGATCGTGCGGGACAT (SEQ ID NO.:15)

β-actin-reverse primer: CAGGAAGGAGGGCTGGAAC (SEQ ID NO.:16)

ND6-forward primer: AGTGTGGGTTTAGTAATG (SEQ ID NO .: 17)

ND6-Reverse Primer: TGCCTCAGGATACTCCTC (SEQ ID NO.:18)

Real-time PCR was performed on a Real-time PCR Detection System instrument. In a 0.2 mL PCR reaction tube, 12.5 μL of SYBR Green mix, 8 μL of ddH ₂ O, 1 μL of each primer, 2.5 μL of cDNA sample, and 25 μL of the total system were added. Each sample was used to amplify both the target gene and the internal reference gene rabbit β-actin. Each gene was amplified in triplicate. In order to reduce the error during the actual loading, the reagents common to each PCR reaction tube can be added together and then aliquoted. After loading, perform Real-time PCR. Amplify according to 40 cycles of pre-denaturation at 95 ° C for 1 s, followed by denaturation at 94 ° C for 15s, annealing at 55 ° C for 15s, and extension at 72 ° C for 25s for 40 cycles, and collect fluorescence signals during the extension phase of each cycle. After the reaction, a melting curve analysis of 94 ° C to 55 ° C was performed.

The relative quantitative method was used to study the difference in gene expression. This method does not need to make a standard curve. The housekeeping gene rabbit β-actin is used as the internal reference gene. The analysis software that comes with the instrument can automatically generate expression values. RAAV2 / 2-ND6 group and The PBS group was 0.59 ± 0.06 and 0.41 ± 0.03, respectively, indicating that the expression of ND6 on the retina of the rAAV2 / 2-ND6 experimental group was significantly higher than that of the control group (P <0.01).

Example 4 Construction of pSNaV / rAAV2 / 2-optimized ND6 plasmid and preparation of recombinant adeno-associated virus

In this example, the ND6 coding sequence (SEQ ID NO.:1) of Example 1 is specially optimized to obtain an optimized ND6 coding sequence (SEQ ID NO.:2), and the 5 'gene of ND6 is optimized. The optimized mitochondrial coding sequence of COX10 (as shown in SEQ ID NO.:6) is ligated to the end, and the UTR sequence of 3 'end of ND6 optimized gene is shown (shown as SEQ ID NO.:8). The resulting optimized ND6 fusion The sequence of the gene (or fusion nucleic acid) is shown in SEQ ID No .: 10, and all gene sequences were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. The homology between the specially optimized coding sequence shown in SEQ ID No.:10 and positions 1-609 of SEQ ID No.:9 (that is, the COX10-ND6 coding sequence) is only 70.28% (428/609 ).

The optimized ND6 fusion nucleic acid was amplified by PCR using primers with two restriction sites of Kpn I and Sal I, and the sticky ends were formed on the fusion gene by digestion with Kpn I / Sal I, and A recombinant adeno-associated virus expression vector was obtained by inserting the fusion gene into the plasmid vector pSNaV (BioVector) of the Kpn I / SalI digestion site, and named it pSNaV / rAAV2 / 2-optimized ND6 (referred to as rAAV2 / 2-optimized ND6).

The experimental method was the same as in Example 1. The pSNaV / rAAV2 / 2-optimized ND6 plasmid was used in place of the pSNaV / rAAV2 / 2-ND6 plasmid in Example 1. Finally, a concentrated and purified recombinant adeno-associated virus rAAV2 / 2-optimized ND6 was obtained.

Example 5 Rabbit Safety Experiment

1 rabbit eye vitreous cavity injection

Twenty-four rabbits were divided into three groups, and the flat part of the ciliary body was penetrated into the vitreous cavity at a distance of 3 mm from the limbus. The vitreous cavity was injected and divided into the experimental group A1 (10 ¹⁰ vg / 50ul rAAV2 / 2-optimized ND6 ), Experimental group B1 (injected 10 ¹⁰ vg / 50ul rAAV2 / 2-ND6) and control group C1 (injected 10 ¹⁰ vg / 50ul rAAV2-EGFP).

2 Slit lamp, intraocular pressure, fundus photography examination

Two groups of rabbits were examined by slit lamp and intraocular pressure at 1, 7, and 30 days after surgery.

Examination results showed that all rabbits had no obvious abnormalities, no conjunctival congestion, secretions, no endophthalmitis, and no increase in intraocular pressure. Fundus photography one month after surgery showed. As shown in Figure 5, there were no obvious complications or damage to the retinal blood vessels and optic nerve in all rabbits, indicating that there is no obvious inflammatory reaction or other complications in the normal standard vitreous cavity injection.

Example 6 In vitro Cell Effectiveness Test

1.Cell infection

Take 6-well plates and divide them into 3 groups, and inoculate 5 × 10 ⁵ cells in each well. After one day of inoculation, the cell count is about 1 × 10 ⁶ and inoculate 10 ¹⁰ vg / 50ul rAAV2 / 2-optimized ND6 and rAAV2. / 2-ND6 and rAAV2-EGFP are labeled as experimental group A2, experimental group B2, and control group C2. Two days after infection, mRNA and total protein were extracted and analyzed.

2.Real-Time PCR detection of ND6 gene expression

First, use NCBI's conservative domain analysis software to analyze the conserved structure of ND6 to ensure that the amplified fragments of the designed primers are located in the non-conserved region. Then, based on the primer design principles of fluorescent quantitative PCR, use primer 5 to design primers:

β-actin-F: CTCCATCCTGGCCTCGCTGT (SEQ ID NO.:19)

β-actin-R: GCTGTCACCTTCACCGTTCC (SEQ ID NO.:20)

ND6-F: GGGTTTTCTTCTAAGCCTTCTCC (SEQ ID NO.:21)

ND6-R: CCATCATACTCTTTCACCCACAG (SEQ ID NO.:22)

Optimize ND6-F: CGCCTGCTGACCGGCTGCGT (SEQ ID NO.:23)

Optimize ND6-R: CCAGGCCTCGGGGTACTCCT (SEQ ID NO.:24)

1) RNA extraction and reverse transcription

The total RNA of rabbit retina was extracted by TRIZOL kit and the cDNA template was synthesized by reverse transcription.

2) Reaction system and reaction program for real-time PCR

Real-time PCR was performed on a Real-time PCR Detection System instrument. In a 0.2 mL PCR reaction tube, 10.0 μL of SYBR Green mix, 8 μL of dd H ₂ O, 0.5 μL of each pair of primers, 1 μL of cDNA sample, and 20 L of the total system were added. Each sample was used to amplify both the target gene and the internal reference gene rabbit-actin. Each gene was amplified in triplicate. In order to reduce the error during the actual loading, the reagents common to each PCR reaction tube can be added together and then aliquoted. After the sample is loaded, perform quantitative PCR. According to the reaction procedure of pre-denaturation at 95 ° C for 1 s, denaturation at 94 ° C for 15 s, annealing at 55 ° C for 15 s, and extension at 72 ° C for 45 s, a total of 40 cycles were performed, and fluorescence signals were collected during the extension phase of each cycle. After the reaction, a melting curve analysis of 94 ° C to 55 ° C was performed. The 2- △△ CT relative quantification method (Livak et al., 2001) was used to study the difference in gene expression. This method does not need to make a standard curve, and uses housekeeping rabbit-actin as the internal reference gene. The analysis software that comes with the instrument can automatically generate Express the value.

The results are shown in Figure 6. The relative expression levels of ND6 mRNA in experimental group A2 and experimental group B2 were higher than those in control group C2 (P <0.05), indicating that infection with rAAV2 / 2-optimized ND6 and rAAV2 / 2-ND6's 293T cells expressed the ND6 gene; the relative expression level of mRNA in the experimental group A2 was slightly higher than that in the experimental group B2.

3.Western blot detects ND6 protein expression

Isolate 293T cells from different experimental groups, extract the total protein with a total protein extraction kit, add 100 μL / 50 mg of tissue to the corresponding volume of RIPA lysate, and mix. Take an appropriate amount of lysate and add PMSF within minutes before use, so that the final concentration of PMSF is 1 mM. For adherent cells: Remove the culture medium and wash it with PBS, physiological saline or serum-free culture medium (if the protein in the serum is not disturbed, do not wash). Add lysate at a ratio of 150-250 microliters of lysate to each well of a 6-well plate. Blow with the gun several times to make the lysate and cells fully contact. Usually the cells are lysed after the lysate has been in contact with the cells for 1-2 seconds. For suspended cells: Collect the cells by centrifugation and use your fingers to force the cells apart. Add lysate at a rate of 150-250 microliters of lysate per cell in a 6-well plate. Flick with your fingers to fully lyse the cells. There should be no significant cell pellet after sufficient lysis. If the number of cells is large, it is necessary to aliquot into 500,000 to 1 million cells / tube, and then lyse. After full lysis, centrifuge at 10000-14000g for 3-5 minutes, and take the supernatant. After the protein concentration was determined by the BCA method, the loading volume of the experimental group and the control group was calculated based on the total protein of 50 μg, and then subjected to SDS-PAGE gel electrophoresis and Westernblot. Chemiluminescence imaging was performed after the primary and secondary antibodies were incubated.

The results are shown in Figure 7. The relative expression level of ND6 in the experimental group A2 was significantly higher than that in the experimental group B2 and the control group C2, with a significant difference P> 0.05, indicating that the optimized ND6 sequence can be translated into the ND6 protein normally, and more It is suitable for expression in human cells, and the relative expression is significantly increased.

Example 7 Construction of pSNaV / rAAV2 / 2-ND1 plasmid and preparation of recombinant adeno-associated virus

1.Construction of plasmid

After obtaining the nucleotide sequence of human NADH dehydrogenase subunit 1 (ND1) (NCBI reference sequence: NC_011137.1), change the mitochondrial coding sequence of ND1 to a nuclear coding sequence (as shown in SEQ ID NO .: 3) , And connect the mitochondrial coding sequence of COX10 at the 5 'end of the ND1 gene (as shown in SEQ ID NO.:5), and the UTR sequence of the 3' end of the ND1 gene (as shown in SEQ ID NO.:8), the resulting fusion The sequence of the gene (or fusion nucleic acid) is shown in SEQ ID NO.:11, and all gene sequences were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.

The recombinant human ND1 fusion gene was amplified by PCR with primers added to the two restriction sites of Kpn I and Sal I, and digested with Kpn I / Sal I to form a sticky end on the fusion gene, and A recombinant adeno-associated virus expression vector was obtained by inserting the fusion gene into a plasmid vector pSNaV (BioVector) with a Kpn I / Sal I restriction site, and named it pSNaV / rAAV2 / 2-ND1 (referred to as rAAV2 / 2-ND1) (Figure 8) As shown).

2. Screening and identification of recombinant clones

The pSNaV / rAAV2 / 2-ND1 obtained above was coated on a plate, and the LB plate was taken out after incubation at 37 ° C. Blue spots and white spots appeared, and white was a recombinant clone. Pick white colonies and add them to LB liquid medium containing 100 mg / L Amp, and incubate at 37 ° C and 200 rpm for 8 h. After culturing, the bacterial solution was taken, and the pSNaV / rAAV2 / 2-ND1 plasmid was extracted. For the plasmid extraction procedure, refer to Biomiga's instructions and use the ND1 full-length primer for PCR identification.

The ND1 full-length primer design is as follows:

ND1 full length-forward primer: 5'-ATGGCCGCATCTCCGCACACT-3 '(SEQ ID NO.:25)

ND1 full length-reverse primer: 5'-TTAGGTTTGAGGGGGAATGCT-3 '(SEQ ID NO.:26)

After PCR, agarose gel electrophoresis (as shown in Figure 9) found that the ND1 target band was around 950bp, indicating that the selected plasmid was the target plasmid.

3. Collection, concentration, purification and titer of cell transfection and recombinant adeno-associated virus

The method was the same as in Example 1-2, and the pSNaV / rAAV2 / 2-ND1 plasmid was used in place of the pSNaV / rAAV2 / 2-ND6 plasmid in Examples 1 and 2. Finally, a concentrated and purified recombinant adeno-associated virus rAAV2 / 2-ND1 was obtained. The detection and calculation showed that the genomic titer of rAAV2 / 2-ND1 was 2.0 × 10 ¹¹ vg / mL.

Example 8 Test of Injecting rAAV2 / 2-ND1 into the Vitreous Cavity of Rabbit Eyes

1.Intravitreal injection

Twenty-four rabbits were divided into three groups: experimental group 2-1, experimental group 2-2, and control group. 0.1% rAAV2 / 2-ND1, 0.1% rAAV-GFP, and PBS were used at a distance of 3 mm from the limbus. The flat part of the ciliary body is punctured into the vitreous cavity, and the vitreous cavity is injected.

2. IOP and fundus photography examination

Three groups of rabbits were examined for intraocular pressure at 1, 7, and 30 days after operation. All rabbits had no obvious abnormalities, no conjunctival hyperemia, secretions, no endophthalmitis, and no increase in intraocular pressure. Fundus photography at 30 days after surgery is shown in Figure 10. All rabbits had no obvious complications or damage to the retinal blood vessels and optic nerves, indicating that the normal standard vitreous cavity injection will not cause significant inflammation or other complications.

3.Fluorescence photography of the retina

30 days after the vitreous cavity injection, the fluorescence photographs of the retinas of the rAAV-GFP group and the PBS control group are shown in Figure 11. GFP was successfully expressed on the retina, indicating that the rAAV was used as a vector and the GFP was transfected into rabbit eye vitreous. Indirectly proved that the rAAV2 / 2-ND1 recombinant gene can be expressed on the retina.

4.Real-time PCR detection of ND1 expression

The total RNA of rabbit neuronal cells in rAAV2 / 2-ND1 group and PBS control group was extracted with TRIZOL kit and reverse-transcribed to synthesize cDNA template. Then, according to the primer design principles of real-time PCR, primers were designed with primer 5 (β-actin was used as an internal reference, and the forward and reverse primers of β-actin were shown as SEQ ID NO .: 15 and 16 respectively):

ND1-forward primer: AACCTCAACCTAGGCCTCCTA (SEQ ID NO.:27)

ND1-Reverse primer: TGGCAGGAGTAACCAGAGGTG (SEQ ID NO.:28)

Real-time PCR was performed on a Real-time PCR Detection System instrument. In a 0.2 mL PCR reaction tube, 12.5 μL of SYBR Green mix, 8 μL of ddH ₂ O, 1 μL of each primer, 2.5 μL of cDNA sample, and 25 μL of the total system were added. Each sample was used to amplify both the target gene and the internal reference gene rabbit β-actin. Each gene was amplified in triplicate. In order to reduce the error during the actual loading, the reagents common to each PCR reaction tube can be added together and then aliquoted. After loading, perform Real-time PCR.

Amplify in accordance with a 40-cycle reaction procedure following pre-denaturation at 95 ° C for 1 s, followed by denaturation at 94 ° C for 15 s, annealing at 55 ° C for 15 s, and extension at 72 ° C for 30 s, and collect fluorescence signals during the extension phase of each cycle. After the reaction, a melting curve analysis of 94 ° C to 55 ° C was performed. The relative quantitative method was used to study the difference in gene expression. This method does not need to make a standard curve. The housekeeping gene rabbit β-actin is used as the internal reference gene. The analysis software that comes with the instrument can automatically generate expression values. The rAAV2 / 2-ND1 group and The results of the PBS control group were 0.62 ± 0.07 and 0.36 ± 0.05, respectively, indicating that the expression of ND1 on the retina of the rAAV2 / 2-ND1 experimental group was significantly higher than that of the control group (P <0.01).

Example 9 Construction of pSNaV / rAAV2 / 2-optimized ND1 plasmid and preparation of recombinant adeno-associated virus

In this embodiment, the coding sequence of ND1 (SEQ ID No .: 3) of Example 7 is specially optimized, and the optimized ND1 coding sequence (SEQ ID No .: 4) is obtained, and the 5 'of the gene is optimized at ND1. The optimized mitochondrial coding sequence of COX10 (as shown in SEQ ID NO.:6) is ligated to the end, and the UTR sequence of 3 'end of ND1 optimized gene is shown (shown as SEQ ID NO.:8). The sequence of the gene (or fusion nucleic acid) is shown in SEQ ID NO.:12. All gene sequences were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. The homology between the specially optimized coding sequence shown in SEQ ID No.:12 and SEQ ID No.:11 at position 1-1035 (that is, the COX10-ND1 coding sequence) is only 77.68% (804/1035). ).

The optimized ND1 fusion nucleic acid was amplified by PCR with primers added to the two sites of Kpn I and Sal I. The full length gene was amplified by Kpn I / Sal I to form a sticky end on the fusion gene, and A recombinant adeno-associated virus expression vector was obtained by inserting the fusion gene into the plasmid vector pSNaV (BioVector) of the Kpn I / SalI digestion site, and named it pSNaV / rAAV2 / 2-optimized ND1 (referred to as rAAV2 / 2-optimized ND1).

The experimental method was the same as in Example 7. The pSNaV / rAAV2 / 2-optimized ND1 plasmid was used in place of the pSNaV / rAAV2 / 2-ND1 plasmid in Example 7. Finally, a concentrated and purified recombinant adeno-associated virus rAAV2 / 2-optimized ND1 was obtained.

Example 10 Rabbit Safety Experiment

1 rabbit eye vitreous cavity injection

Take 24 rabbits divided into 3 groups, 3mm away from the limbal puncture pars into the vitreous cavity, for intravitreal injection, were divided into experimental groups A3 (injected ¹⁰ 10 vg / 50ul rAAV2 / 2- optimization ND1 ), Experimental group B3 (injected 10 ¹⁰ vg / 50ul rAAV2 / 2-ND1) and control group C3 (injected 10 ¹⁰ vg / 50ul rAAV2-EGFP).

2 Slit lamp, intraocular pressure, fundus photography examination

Two groups of rabbits were examined by slit lamp and intraocular pressure at 1, 7, and 30 days after surgery.

Examination results showed that all rabbits had no obvious abnormalities, no conjunctival hyperemia, secretions, no endophthalmitis, and no increase in intraocular pressure. Fundus photography one month after surgery showed. As shown in Figure 12, there were no obvious complications or damage to the retinal blood vessels and optic nerves in all rabbits, indicating that there is no obvious inflammatory response or other complications in the normal standard vitreous cavity injection.

Example 11 In vitro Cell Effectiveness Test

1.Cell infection

Take 6-well plates and divide them into 3 groups, and inoculate 5 × 10 ⁵ cells in each well. After one day of inoculation, the cell count is about 1 × 10 ⁶ and inoculate 10 ¹⁰ vg / 50ul rAAV2 / 2-optimized ND1 and rAAV2. / 2-ND1 and rAAV2-EGFP are labeled as experimental group A4, experimental group B4, and control group C4. Two days after infection, mRNA and total protein were extracted and analyzed.

2.Real-Time PCR detection of ND1 gene expression

First, use NCBI's conservative domain analysis software to analyze the conserved structure of ND1 to ensure that the amplified fragments of the designed primers are located in the non-conserved region. Then, according to the primer design principles of fluorescent quantitative PCR, use primer 5 to design primers (β-actin as internal reference, The forward and reverse primers of β-actin are shown in SEQ ID NO .: 19 and 20, respectively):

ND1-F: AGGAGGCTCTGTCTGGTATCTTG (SEQ ID NO.:29)

ND1-R: TTTTAGGGGCTCTTTGGTGAA (SEQ ID NO.:30)

Optimize ND1-F: GCCGCCTGCTGACCGGCTGCGT (SEQ ID NO.:31)

Optimize ND1-R: TGATGTACAGGGTGATGGTGCTGG (SEQ ID NO.:32)

1) RNA extraction and reverse transcription

The total RNA of rabbit retina was extracted by TRIZOL kit and the cDNA template was synthesized by reverse transcription.

2) Reaction system and reaction program for real-time PCR

Real-time PCR was performed on a Real-time PCR Detection System instrument. In a 0.2 mL PCR reaction tube, 10.0 μL of SYBR Green mix, 8 μL of dd H ₂ O, 0.5 μL of each pair of primers, 1 μL of cDNA sample, and 20 L of the total system were added. Each sample was used to amplify both the target gene and the internal reference gene rabbit-actin. Each gene was amplified in triplicate. In order to reduce the error during the actual loading, the reagents common to each PCR reaction tube can be added together and then aliquoted. After the sample is loaded, perform quantitative PCR. According to the reaction procedure of pre-denaturation at 95 ° C for 1 s, denaturation at 94 ° C for 15 s, annealing at 55 ° C for 15 s, and extension at 72 ° C for 45 s, a total of 40 cycles were performed, and fluorescence signals were collected during the extension phase of each cycle. After the reaction, a melting curve analysis of 94 ° C to 55 ° C was performed. The 2- △△ CT relative quantification method (Livak et al., 2001) was used to study the difference in gene expression. This method does not need to make a standard curve, and uses housekeeping rabbit-actin as the internal reference gene. The analysis software that comes with the instrument can automatically generate Express the value.

The results are shown in Figure 13. The relative expression levels of ND1 gene mRNA in experimental group A4 and experimental group B4 were higher than those in control group C4 (P <0.05), indicating that infection with rAAV2 / 2-optimized ND1 and rAAV2 / 2-ND1's 293T cells expressed the ND1 gene; there was no significant difference in the relative expression levels of mRNA between the experimental group A4 and the experimental group B4 (P> 0.05).

3.Western blot detects ND1 protein expression

Blow with the gun several times to make the lysate and cells fully contact. Usually the cells are lysed after the lysate has been in contact with the cells for 1-2 seconds. For suspended cells: Collect the cells by centrifugation and use your fingers to force the cells apart. Add lysate at a rate of 150-250 microliters of lysate per cell in a 6-well plate. Flick with your fingers to fully lyse the cells. There should be no significant cell pellet after sufficient lysis. If the number of cells is large, it is necessary to aliquot into 500,000 to 1 million cells / tube, and then lyse. After full lysis, centrifuge at 10000-14000g for 3-5 minutes, and take the supernatant. After the protein concentration was determined by the BCA method, the loading volume of the experimental group and the control group was calculated based on 50 μg of total protein, and SDS-PAGE gel electrophoresis and Western blot were performed. Chemiluminescence imaging was performed after antibody incubation.

The results are shown in Figure 14. The relative expression level of ND1 in the experimental group A4 was significantly higher than that in the experimental group B4 and the control group C4, with a significant difference P> 0.05, indicating that the optimized ND1 sequence can be normally translated into the ND1 protein, and more It is suitable for expression in human cells, and the relative expression is significantly increased.

Example 12

The sequences such as the COX10 sequences (positions 1-84) in SEQ ID No.:9 and 10 are replaced with the OPA1 mitochondrial targeting peptide coding sequence (SEQ ID ID.:7), respectively Fusion nucleic acid and OPA1-optimized ND6-UTR fusion nucleic acid.

The method is the same as that of Examples 1-3, and the fusion nucleic acid shown in SEQ ID NO .: 9 is replaced with the above-mentioned two fusion nucleic acids. The results showed that the expression levels of ND6 protein of OPA1-ND6-UTR fusion nucleic acid and OPA1-optimized ND6-UTR fusion nucleic acid were significantly increased, and both of them can effectively treat Leber hereditary optic neuropathy and have good safety.

Example 13

The sequences such as the COX10 sequences (positions 1-84) in SEQ ID No.:11 and 12 are replaced with the OPA1 mitochondrial targeting peptide coding sequence (SEQ ID No.:7), and the structures with OPA1-ND1-UTR are obtained Fusion nucleic acid and OPA1-optimized ND1-UTR fusion nucleic acid.

The method is the same as that in Example 7-8, and the fusion nucleic acid shown in SEQ ID NO .: 11 is replaced with the two fusion nucleic acids described above. The results showed that the expression levels of ND1 protein of OPA1-ND1-UTR fusion nucleic acid and OPA1-optimized ND1-UTR fusion nucleic acid were significantly increased, and both of them can effectively treat Leber hereditary optic neuropathy and have good safety.

All documents mentioned in the present invention are incorporated by reference in this application, as if each document was individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (17)

1. A nucleotide sequence, wherein the nucleotide sequence is selected from the following group:

   (a) a nucleotide sequence encoding a human NADH dehydrogenase subunit 6 protein, and the nucleotide sequence is shown in SEQ ID NO :: 1 or 2;

   (b) a nucleotide sequence encoding a human NADH dehydrogenase subunit 1 protein, and the nucleotide sequence is shown in SEQ ID NO :: 3 or 4;

   (c) has a homology of ≥95% (preferably ≥98%, more preferably ≥99%) with the nucleotide sequence shown in any one of SEQ ID NOs: 1-4, and encodes human NADH dehydrogenation The nucleotide sequence of an enzyme subunit 6 protein or a human NADH dehydrogenase subunit 1 protein; and

   (d) A nucleotide sequence complementary to the nucleotide sequence of any one of (a) to (c).
2. A fusion nucleic acid, wherein the fusion nucleic acid comprises the nucleotide sequence according to claim 1.
3. The fusion nucleic acid of claim 2, further comprising a sequence selected from the group consisting of a coding sequence of a mitochondrial targeting peptide, a UTR sequence, or a combination thereof.
4. The fusion nucleic acid according to claim 3, wherein the coding sequence of the mitochondrial targeting peptide comprises a coding sequence of COX10 and / or a coding sequence of OPA1.
5. The fusion nucleic acid according to claim 4, wherein the coding sequence of COX10 has a sequence shown in SEQ ID No .: 5 or 6; the coding sequence of OPA1 has a sequence shown in SEQ ID No .: 7 And / or the UTR sequence has a sequence as shown in SEQ ID NO.:8.
6. The fusion nucleic acid according to claim 2, wherein the fusion nucleic acid has a structure of formula I from the 5 'end to the 3' end:

   Z0-Z1-Z2-Z3 (I)

   Where

   Each "-" is independently a bond or a nucleotide linking sequence;

   Z0 is none or 5'-UTR sequence;

   Z1 is the coding sequence of the mitochondrial targeting peptide;

   Z2 is the nucleotide sequence of claim 1; and

   Z3 is a 3'-UTR sequence.
7. The fusion nucleic acid according to claim 2, wherein the fusion nucleic acid has a sequence shown in any one of SEQ ID Nos .: 9-12.
8. A vector, wherein the vector contains the nucleotide sequence according to claim 1 or the fusion nucleic acid according to claim 2.
9. The vector of claim 8, wherein the vector is an adeno-associated virus vector, and preferably, the backbone of the vector is an adeno-associated virus vector plasmid pSNaV.
10. A host cell, characterized in that the host cell contains the vector according to claim 8, or the exogenous nucleotide sequence according to claim 1 or the fusion according to claim 2 is integrated into its genome. Nucleic acid.
11. The host cell according to claim 10, wherein the host cell is selected from the group consisting of HEK293 cells, photoreceptor cells (including cone cells and / or rod cells), and other visual cells (such as biganglocytes). , (Optical) nerve cells, or a combination thereof.
12. The use of the carrier according to claim 8, characterized in that it is used for preparing a preparation or composition for restoring vision and / or treating ocular diseases in a subject.
13. The use according to claim 12, wherein the preparation or composition is used for treating hereditary optic neuropathy, preferably Leber's hereditary optic neuropathy (LHON).
14. A pharmaceutical preparation, characterized in that the preparation contains (a) the carrier according to claim 8 and (b) a pharmaceutically acceptable carrier or excipient.
15. A treatment method, characterized in that the method comprises applying the carrier according to claim 8 to a subject in need.
16. A method for preparing recombinant human NADH dehydrogenase subunit 6 protein or human NADH dehydrogenase subunit 1 protein, comprising the steps of: culturing the host cell according to claim 10, thereby obtaining recombinant human NADH dehydrogenase. Enzyme subunit 6 protein or human NADH dehydrogenase subunit 1 protein.
17. A fusion protein encoded by a fusion nucleic acid according to any one of claims 3-7.

Images