CN113025658B

CN113025658B - Delivery vector of neural stem cell specific gene and application thereof

Info

Publication number: CN113025658B
Application number: CN202110260257.0A
Authority: CN
Inventors: 刁勇; 盛晓菁
Original assignee: Huaqiao University
Current assignee: Huaqiao University
Priority date: 2021-03-10
Filing date: 2021-03-10
Publication date: 2022-04-22
Anticipated expiration: 2041-03-10
Also published as: CN113025658A

Abstract

The invention provides a delivery vector of a neural stem cell specific gene and application thereof, and relates to the technical field of molecular pharmacology and molecular medicine. The delivery vector is a novel rAAV vector obtained by carrying out random gene mutation on the basis of the recombinant adeno-associated virus 9 and carrying out multiple rounds of in-vitro screening by taking a neural stem cell sphere as a model. The amino acid sequence of the capsid protein of the delivery vector is as SED ID NO: 1, the gene transfer vector can efficiently deliver a transgenic element to a neural stem cell in a targeted manner, and compared with a rAAV9 vector commonly used for transducing a nervous system, the gene transfer vector provided by the invention has the advantages that the transduction efficiency of the neural stem cell is remarkably improved, and the gene transfer vector can be used for preparing medicines for treating diseases related to the nervous system.

Description

Delivery vector of neural stem cell specific gene and application thereof

Technical Field

The invention relates to the technical field of molecular medicine of molecular pharmacology, in particular to a delivery vector of a neural stem cell specific gene and application thereof.

Background

Neural Stem Cells (NSCs) are a class of multipotent cells that self-renew and can differentiate into different types of Neural cells. Under certain conditions, it can differentiate into different functional cells, including neurons, astrocytes and oligodendrocytes. Although the level of neuronal cell neogenesis is low in healthy adults, it has been found that neuronal cell neogenesis occurs in disease states such as stroke, epilepsy and huntington's disease. This finding gives an indication of the possibility of therapeutic intervention by inducing neuronal neogenesis in humans. Based on the above, the damaged nerve tissues or organs are replaced or repaired, and a treatment means is hopeful to be provided for the neurological diseases of which the treatment methods are not available at present.

Efficient and targeted gene transfer provides a means for researching the regulation and control mechanism of the resting, proliferation, self-renewal and differentiation of the neural stem cells. Nestin (Nestin) is an intermediate filament type of protein that is specifically expressed in Neural Stem Cells (NSCs) and is considered to be a molecular marker for NSCs. Nestin-CreERT2 transgenic mice express Cre recombinase under the control of the Nestin promoter and have been used to track NSCs and their progeny in vivo. In addition to basic research, gene delivery can also be used in gene or cell replacement therapy to treat neurodegenerative diseases or injuries. For example, the production of new neurons is regulated by the expression or knock-out of specific genes. In addition, gene delivery by neural stem cells has been used to express neurotrophic factors to protect against neurodegenerative diseases, and in the fragile X syndrome mouse model, it has been demonstrated that expression of fragile X mental retardation protein in adult neural stem cells can be restored.

Currently, several gene delivery vectors have been discovered that can deliver genes to NSCs. Such as replication-defective adenovirus vectors, can deliver transgenes into brain progenitor cells of developing 10.5-14.5 day mouse embryos for tracking progenitor cell differentiation, but it has not been demonstrated that genes can be delivered into adult NSCs (Hashimoto M, Mikoshiba K.J Neurosci.2004; 24(1): 286-96). Injection of plasmid-containing Polyethyleneimine (PEI) complexes into the lateral ventricles of mice also allowed for the selective delivery of transgenes to NSCs in the subventricular zone (SVZ), but with very low delivery efficiency (Falk et al, Exp Cell Res.2002; 279(1): 34-9). In addition, van Hooijdank et al used vesicular stomatitis virus G glycoprotein pseudotyped lentiviral vectors to target gene delivery to neural progenitor cells and immature neurons underlying the mouse hippocampal dentate gyrus granule (van Hooijdank et al, BMC Neurosci.200913; 10: 2). Although the lentiviral vector preferentially transduced neural progenitor cells and immature neurons, only 11% of positive cells were NSCs (Nestin positive) 1 week after administration. Injection of retroviral vectors into mouse hippocampus has been found to target the transduction of neural progenitors and neuroblasts in mitotic phase (Jessberger et al, Nat neurosci.2008; 11(8):888-93), but the NSCs in brain are rarely in mitotic phase. The lentiviral vector can only be used for gene therapy by an ex vivo method, and the operation is very complicated. In addition, clinical studies have also found that the random chromosomal insertion pattern of lentiviral vectors is at risk for carcinogenesis.

Adeno-associated virus (AAV) is a non-pathogenic, non-enveloped virus belonging to the parvovirus family. AAV comprises a 4.7kb single-stranded DNA genome containing inverted flanking terminal repeats (ITRs), which are the replication and signal source of the genome package. Between ITRs, the Open Reading Frame (ORF) of the gene rep encodes four nonstructural proteins that are responsible for viral replication in the presence of helper virus, transcriptional regulation of rep and ORF of the gene cap, site-specific integration at the AAVS1 site, and virion assembly. The cap-ORF encodes three structural proteins (VP1, VP2, and VP3), which assemble to form a viral capsid composed of 60 structural proteins polymerized. The amino acid sequence translated from the cap-ORF determines the gene transfer properties of AAV, including antibody binding, cell surface receptor binding, glycan binding and endosomal escape.

Currently, 11 native serotypes and over 100 AAV capsid variants have been identified. These AAV and AAV capsid variants can be used as recombinant AAV vectors (rAAV) for gene delivery after gene recombination. In rAAV, the genes rep and cap are replaced by transgenes inserted between ITRs. The rAAV vector can transduce dividing cells and non-dividing cells simultaneously and is stably expressed in tissues after mitosis. To date, no native AAV has been associated with any human disease, and therefore rAAV has become an attractive key vector for gene therapy. However, to date, no rAAV of native serotype has been found, along with known AAV capsid variants, which are effective in delivering genes to NSCs. rAAV9 derived from type 9 serogroup was highly efficient in transduction of mature neurons, but lacked specificity for NSCs.

The SVZ of the lateral ventricle is the largest area of nerve cell regeneration in the adult mammalian brain. NSCs located in SVZ continue to produce new neurons and oligodendrocytes throughout a human life, and are of great therapeutic significance for brain injury and neurological disease. Therefore, direct in vivo genetic modification of NSCs would be the key to the maximum exploitation of the potential of gene therapy for neurological diseases. However, gene delivery directly to SVZ remains challenging, and currently there is no gene therapy vector that can target the transduction of NSCs within the SVZ microenvironment.

Disclosure of Invention

The invention aims to provide a delivery vector of a neural stem cell specific gene and application thereof, wherein the delivery vector is a novel recombinant adeno-associated virus vector, can be used for targeted and efficient delivery of transgenic element value neural stem cells, and can be used for preparing medicines for diseases related to a nervous system.

The technical problem to be solved by the invention is realized by adopting the following technical scheme.

The invention provides a delivery vector of a neural stem cell specific gene, which is a novel rAAV vector obtained by carrying out random gene mutation on the basis of a recombinant adeno-associated virus 9 and carrying out multi-round in-vitro screening by taking a neural stem cell sphere as a model, wherein the amino acid sequence of capsid protein of the delivery vector is as follows, SED ID NO: 1 is shown.

The invention also provides application of the delivery vector of the neural stem cell specific gene in preparation of medicines for treating diseases related to the nervous system.

The delivery vector of the neural stem cell specific gene and the application thereof have the beneficial effects that:

the delivery vector is a novel rAAV vector obtained by carrying out random gene mutation on the basis of the recombinant adeno-associated virus 9 and carrying out multiple rounds of in-vitro screening by taking a neural stem cell sphere as a model. The amino acid sequence of the capsid protein of the delivery vector is as SED ID NO: 1, the gene transfer vector can efficiently deliver a transgenic element to a neural stem cell in a targeted manner, and compared with a rAAV9 vector commonly used for transducing the nervous system, the transduction efficiency of the gene transfer vector to the neural stem cell is remarkably improved.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a diagram showing the transgene expression in neurospheres before the targeted screening of human NSCs and 2 and 4 rounds of screening of AAV9 capsid mutant library of example 4 of the present invention;

FIG. 2 is a graph comparing the efficiency of transforming human NSCs cells with the novel rAAV vector of example 5 of the present invention and the wild-type rAAV9 vector;

FIG. 3 is a graph showing the expression of green fluorescent protein in SVZ of mouse ventricles after the novel rAAV vector is injected into the lateral ventricle of C57BL/6 mouse.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The following provides a specific description of a delivery vector for neural stem cell-specific genes and applications thereof according to embodiments of the present invention.

The delivery vector provided by the embodiment of the invention is a novel rAAV vector obtained by carrying out random gene mutation on the basis of recombinant adeno-associated virus 9 and carrying out multi-round in-vitro screening by taking a neural stem cell sphere as a model, wherein the amino acid sequence of capsid protein of the delivery vector is as follows, SED ID NO: 1 is shown.

NSCs are target cells that are very difficult to gene treat because they are protected by biological barriers, including the ventricular ependymal cell layer and the blood-brain barrier, in a small micro-ecological environment located in vivo in such a complex tissue of the brain. The in vivo screening can be directly carried out in the brains of animals such as mice and the like, and the micro-ecological environment of NSCs can be simulated. However, capsid variants, often selected in mice, may not be effective in humans due to the limitation of species-specific differences. Since NSCs form neurosphere structures when cultured in vitro, they mimic their in vivo state. To specifically select AAV variants targeting NSCs, the inventors designed a strategy of directed evolution and selection within the neurosphere to select AAV variants that can transduce NSCs with high efficiency.

Directed evolution is a high throughput molecular engineering approach that can be used to generate AAV variants. In an iterative process of directed evolution, libraries of gene variants are subjected to increasing selection pressure to allow key mutations to occur, thereby improving the function of a particular application. Through multiple, high-intensity, directed selection of randomly diverse gene libraries, it is possible to obtain AAV variants with novel targeting properties.

Further, in preferred embodiments of the invention, the delivery vector is useful for specifically transducing neural stem cells.

The delivery vector provided by the invention has the capability of being specifically combined with the neural stem cells, can be used for efficiently delivering the transgenic element to the neural stem cells in a targeted manner, and is remarkably improved in transduction efficiency on the neural stem cells compared with a rAAV9 vector commonly used for transducing the nervous system.

Further, in preferred embodiments of the present invention, the neurological-related disorders include stroke, epilepsy, and huntington's disease. The drug prepared by the delivery vector can also induce the regeneration of human nerve cells in the treatment of diseases such as stroke, epilepsy and Huntington disease.

The features and properties of the present invention are described in further detail below with reference to examples. The novel rAAV vector, namely a delivery vector of the neural stem cell specific gene, is finally obtained through the following examples.

Example 1

This example provides the construction of a library of random mutations in the AAV9 capsid protein gene, comprising the steps of:

(1) primer design

2 PCR primers for mutation modification of AAV9 capsid were designed, respectively:

primer F (TCAGGTGTTTACTGACTCGGAG, SED ID NO: 2);

primer R (CGTCACACATACGACACCGG, SED ID NO: 3).

(2) Error prone PCR

And (3) preparing the AAV9 capsid protein random mutation library by multiple error-prone PCR (polymerase chain reaction) by taking the plasmid pAAV9 as a template and taking the primers F and R as pairing primers. Plasmid pAAV9 used in this example was a plasmid carrying the entire gene of wild-type AAV9 virus, which was constructed by the medical college of Huaqiao university. Among them, the Cap gene is responsible for encoding the capsid protein of AAV9 virus.

The PCR kit is prepared by adopting an instant error-prone PCR kit produced by Beijing Tianenzze Gene science and technology Limited.

As shown in Table 1, the components shown in Table 1 were added to a PCR reaction tube, and after denaturation at 95 ℃ for 3 minutes, the reaction was repeated 30 times under the following cycle conditions: denaturation at 95 ℃ for 1 min, annealing at 46 ℃ for 1 min, and extension at 72 ℃ for 1 min.

TABLE 1 error-prone PCR reaction System

(3) Continuous error-prone PCR

And (3) taking the last error-prone PCR product as a template, and performing error-prone PCR by adopting the method in the step (2) for 5 times.

(4) Preparation of random mutation library pAAV9-lib of AAV9 capsid protein gene

Carrying out double enzyme digestion on the plasmid pAAV9 and the error-prone PCR product by using BsiWI and AscI enzymes, carrying out agarose gel purification on the enzyme digestion product, and cutting the gel to recover a linearized large fragment.

Taking 10U of recombinase, 500ng of linearized vector and 400ng of error-prone PCR product fragment after enzyme digestion, and adding ddH₂O constructing an in-vitro homologous recombination reaction system of 80 mu L, and heating the system for 1.5h in a metal bath at 50 ℃ to carry out recombination reaction.

And taking the recombinant product, and transforming the competent E.coli cells by an electroporation method. The transformed bacterial liquid is evenly spread on a solid medium plate, and cultured in an incubator at 37 ℃ overnight for about 16 h. Plasmids were extracted as random mutation library of AAV9 capsid protein gene pAAV 9-lib.

Example 2

Provided in this example is the preparation of a library of AAV9 capsid mutants, comprising the steps of:

293 cells were seeded in a culture dish and cultured overnight in DMEM medium containing 10% FBS to a confluency of about 80%.

Taking 1mL of serum-free culture medium, adding 8 mu g of pAAV9-lib and 10 mu g of helper plasmid pFd6, gently mixing uniformly, adding 1mg/mL of PEI solution according to the proportion of 1:3, and vortexing and mixing uniformly. Add dropwise and uniformly to the medium of 293 cells while gently shaking and mixing as soon as possible.

The cells were incubated at 37 ℃ with 5% CO₂16h after transfection, the old medium was discarded, and 10mL of fresh DMEM medium containing 10% FBS was added.

The culture was continued in the cell incubator for 72h, the cells were harvested into 15mL centrifuge tubes, centrifuged at 1000g, 4 ℃ for 15min, the supernatant was stored at 4 ℃ and the pellet was resuspended in 1.5mL PBS solution.

The collected cell suspension was frozen in a freezer at-80 ℃ for 1h and immediately placed in a metal bath at 37 ℃ for 1 h. And repeatedly freezing and thawing for 3-5 times to crack cells, centrifuging at 8000g and 4 ℃ for 15min, and collecting supernatant to a new centrifuge tube to obtain the AAV9-Lib of the AAV9 capsid mutant library.

The collected virus liquid is filtered by a 0.22 mu m needle filter membrane, and each 200 mu L of the virus liquid is subpackaged and stored to-80 ℃ for standby.

Example 3

This example provides the preparation of human neural stem cells, comprising the steps of:

the cerebral cortex tissue of the aborted fetus (3 months old) is obtained through a micro minimally invasive operation according to the general flow and standard of clinical neurosurgery operation. The plate with the brain placed thereon was placed under a dissecting microscope, a coronal incision was made behind the olfactory bulb with a scalpel, and then the choroid plexus remaining in the ventricle was removed with fine forceps. Thin layers of tissue around the ventricles, excluding the striatal parenchyma and corpus callosum, were then cut using a finely curved microsurgical scissors and the dissected tissue was placed into 6-well cell plates containing sterile PBS.

The 6-well cell plate was placed under a tissue culture laminar flow hood, 5ml of papain solution was added to each well, and cultured in a cell incubator at 37 ℃ for 30 min. The contents of each well were transferred to a 15ml sterile test tube using a P1000 pipette, the culture wells of the 6 well cell plate were washed with sterile DMEM, and the wash was added to the test tube. Centrifuge at 500 Xg for 10min and remove supernatant. And adding 500 mu L of DMEM by using a P1000 pipette, and repeatedly blowing, sucking and flushing for 20-30 times by using the same gun head. 12mL of fresh DMEM was added to each tube, centrifuged at 500 Xg for 10min, and the supernatant was removed. And adding 300 mu L of DMEM by using a P1000 pipette, and repeatedly blowing, sucking and flushing for 20-30 times by using the same gun head. And repeatedly blowing and separating for 30-40 times by using a P200 pipette tip to obtain the single cell suspension. 12mL of fresh DMEM was added to each tube and centrifuged at 500 Xg for 10min, and the supernatant was discarded. Adding 180 mu L of culture medium by using a P200 pipette, repeatedly blowing and flushing the culture medium by using the same tip for 20-30 times, and adding the culture medium to 1 mL. The samples were diluted with trypan blue for cell counting. According to the cell count results, 6-well tissue culture plates (5mL volume) or 25cm were used²The cells were seeded in a tissue culture flask (7mL volume) at a density of 5-10 cells/. mu.L, and 5% CO at 37 ℃%₂Cultured in an incubator.

Cell cultures were examined daily. Neurospheres began to form after 2-3 days. When the sphere diameter reached about 100 μm, the contents of the well were transferred to a 15mL sterile conical tube using a sterile pipette. 5mL of fresh medium was used for rinsingThe culture wells were washed and the washes were combined and added to a sterile conical tube. The cell suspension was prepared by centrifugation at 110 Xg for 10 min. The supernatant was removed, leaving about 50. mu.L. Add 180 μ L of fresh complete medium using a sterile p200 pipette. And gently and repeatedly blowing and beating the cell suspension for 40-50 times. Viable cells were counted by trypan blue at 1X 10⁴Cells/cm²Is inoculated into an unused cell culture flask. Adding fresh culture medium to continue culturing, and growing the spheroids to 100 mu m in about 5-7 days. Continue at 25cm²Subculturing in a cell culture flask with an inoculum size of 2 × 10⁵And (4) cells. The total number of the living cells is counted once per passage (5-7 days), and the passage process is repeated for at least 5-20 times.

Example 4

This example provides a directed screening of human NSCs for a library of AAV9 capsid mutants comprising the steps of:

taking human NSCs according to the ratio of 5 × 10⁴Inoculating the cells/hole in a 6-hole plate, adding a fresh culture medium for culturing, and adding AAV9-Lib to infect neurospheres (MOI is 10000) after forming neurospheres for about 5-7 days.

After 6h of infection, cells are collected and centrifuged at low speed, the culture medium containing AAV9 capsid mutant library AAV9-Lib is discarded, cell sediment is resuspended and rinsed by PBS solution, centrifuged at low speed again, supernatant is discarded, and fresh 1640 culture medium is supplemented.

Adding Ad5(1000pfu/cell) into the culture medium, and incubating with NSCs neurosphere cells for about 60-72 h. And collecting the cells, repeatedly freezing and thawing for 3-5 times, and lysing the cells to obtain virus-containing supernatant. Ad5 in the virus-containing supernatant was heat-inactivated at 56 ℃ for 30min, 8000g, centrifuged at 4 ℃ for 15min, and the supernatant was collected into a new centrifuge tube. The collected virus solution was sterilized by passing through a 0.22 μm needle filter in a clean bench.

And (4) taking the collected virus liquid, and repeating the steps for repeatedly screening for 3-5 rounds.

The transgene expression of neurospheres before and after 2 nd and 4 th rounds of targeted screening of human NSCs for AAV9 capsid mutant libraries is shown in FIG. 1. In fig. 1, the transgene expression level of neurospheres before screening, the transgene expression level of neurospheres after second round of screening, and the transgene expression level of neurospheres after fourth round of screening are sequentially shown from left to right. From FIG. 1, it can be seen that the transgene expression efficiency is gradually improved after screening, which indicates that the targeted transduction ability of the screened vector is improved.

Example 5

This example provides the construction of a human neural stem cell targeting vector, comprising the steps of:

the Cap sequence selected in example 4 was inserted into the Cap gene of rAAV vector packaging plasmid pH29 by the homologous recombination method (the homologous recombination method was the same as the recombination step in step (4) of example 1), to give a pH29 mutant plasmid. Among them, rAAV vector packaging plasmid pH29 contains rep and cap genes of AAV9, which was constructed by the medical college of the university of chinese qiao.

NSCs cell targeting vectors are prepared according to a three-plasmid cotransfection method. First, a mixed solution of three plasmids (pH29 mutant plasmid, pheloper plasmid and recombinant AAVgenome plasmid (recombinant AAVgenome plasmid is available from the medical college of the university of Huaqiao)) was prepared using DMEM, polyJet reagent was diluted using DMEM, the polyJet diluent was rapidly added to the plasmid mixed solution after sufficiently mixing, shaking and mixing were performed, the mixed solution was allowed to stand at room temperature for 10min (not more than 20min), and the mixed solution was uniformly added dropwise to the cultured cells using a pipette. And (5) placing the mixture into a carbon dioxide incubator for cultivation for 24-72 h. Cells were collected and cultured in 50mL centrifuge tubes. The cells were pelleted by centrifugation at 1000g for 10min at 4 ℃. The collected cells were resuspended in 10 mM PBS (0.001% pluronic F68+200mM NaCl), disrupted by sonication, centrifuged at 3220g at 4 ℃ for 15min, and the supernatant was collected. 5 units of Benzonase (NEB) were added per ml of supernatant and incubated at 37 ℃ for 45 min. Centrifuging at 4 deg.C at rotation speed 2415g for 10min, and subjecting the supernatant to iodixanol density gradient centrifugation purification to obtain novel rAAV vector.

Application example 1

Mechanically separating NSCs neurosphere, and collecting 3 × 10⁵Individual NSCs cells were placed on glass 12mm diameter coverslips coated with polylysine and 1% Fetal Bovine Serum (FBS) was added to 1mL of complete medium overnight for cell attachment to the coverslips. On day 2, the medium was replaced with fresh complete medium to prevent NSCs from differentiating. The culture medium is cultured every 2 daysAnd completely replaced once. The cells are divided into two groups of novel rAAV vectors and wild type rAAV9 vectors to carry out in vitro transduction experiments, and the MOI is 10000. On day 3 of transduction, transgene expression was observed under a fluorescent microscope. Fig. 2 is a graph showing the comparison of the efficiency of the novel rAAV vector and the wild-type rAAV9 vector in the transduction of human NSCs. Wherein, fig. 2A is a comparison of expression levels of Green Fluorescent Protein (GFP) and Nestin observed 3 days after the novel rAAV vector and the wild-type rAAV9 vector were transduced with human NSCs, and DAPI counterstained nuclei. As can be seen from fig. 2, the transduction efficiency of the novel rAAV vector on NSCs cells is significantly higher than that of the wild-type rAAV9 vector.

Cells were fixed with 4% paraformaldehyde overnight. After PBS wash, 3% H₂O₂Treatment for 10min, followed by PBS wash and permeation with 0.2% Triton X-100 for 10 min. After washing with PBS, the sections were incubated in blocking buffer (5% goat serum in PBS) at 37 ℃ for 30 min.

To identify the cells as indeed undifferentiated NSCs, the sections were incubated with mouse anti-human Nestin antibody (1: 100; milecore, USA) overnight at 4 ℃. The following day, wash with PBS and Alexa

594 goat anti-mouse IgG (H + L) (1: 200; Invitrogen, USA) was cultured at room temperature for 1H, the sections were washed and the nuclei were stained with DAPI (Vector Laboratories, Burlingame, Calif., USA). From fig. 2B, it can be seen that the transduction efficiency of the novel rAAV vector on NSCs cells reaches 82%, which is significantly higher than that of the wild-type rAAV9 vector.

Application example 2

The novel rAAV vector expressing GFP (1X 1010 vp/. mu.L) was stereotactically injected into the right ventricle of the C57BL/6 mouse, behind and 1.0mm to 2.5mm deep from bregma, to confirm the efficiency of NSCs transduction in vivo by the selected novel rAAV vector. After 14 days of sacrifice, frozen brain sections were removed and GFP expression was observed in the ventricles of the C57BL/6 mouse SVZ. As shown in FIG. 3, the expression of green fluorescent protein in SVZ of mouse ventricle is shown after the novel rAAV vector is injected into C57BL/6 mouse ventricle. As can be seen from fig. 3, the novel rAAV vector expressed the transgene GFP at high levels near the injection site, while the transgene expression level of rAAV9 injected as a control was very low.

The embodiments described above are some, but not all embodiments of the invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

SEQUENCE LISTING

<110> university of Chinese

<120> delivery vector of neural stem cell specific gene and application thereof

<130> 20210108

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 736

<212> PRT

<213> Artificial Synthesis

<400> 1

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Arg Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Val Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly

145 150 155 160

Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn

260 265 270

Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp

370 375 380

Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu

405 410 415

Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser

435 440 445

Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser

450 455 460

Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Ser Ala Asp Asn

485 490 495

Asn Asn Ser Glu Tyr Ser Trp Thr Gly Ala Thr Ser Tyr Ala Leu Asn

500 505 510

Gly Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys

515 520 525

Asp Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ser Gly Lys Asp Asn Val Asp Ile Glu Lys Val Met Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln

565 570 575

Tyr Gly Ser Val Ala Thr Asn His Gln Arg Ala Gln Ala Asn Ala Gln

580 585 590

Thr Gly Asp Val Asn Asn Gln Gly Val Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

tcaggtgttt actgactcgg ag 22

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

cgtcacacat acgacaccgg 20

Claims

1. A delivery vector of a neural stem cell specific gene is a novel rAAV vector obtained by random gene mutation on the basis of recombinant adeno-associated virus 9 and multiple rounds of in vitro screening by taking a neural stem cell sphere as a model, wherein the amino acid sequence of capsid protein of the delivery vector is as follows: 1 is shown.

2. The neural stem cell-specific gene delivery vector according to claim 1, wherein the delivery vector is used for specifically transducing neural stem cells.

3. Use of the neural stem cell-specific gene delivery vector of any one of claims 1-2 in the preparation of a medicament for treating a disease associated with the nervous system.

4. The use of claim 3, wherein the neurological related disorder comprises stroke, epilepsy, and Huntington's disease.