CN116179739A - PCR primer probe composition and kit for identifying histoplasma capsulatum - Google Patents
PCR primer probe composition and kit for identifying histoplasma capsulatum Download PDFInfo
- Publication number
- CN116179739A CN116179739A CN202211115164.XA CN202211115164A CN116179739A CN 116179739 A CN116179739 A CN 116179739A CN 202211115164 A CN202211115164 A CN 202211115164A CN 116179739 A CN116179739 A CN 116179739A
- Authority
- CN
- China
- Prior art keywords
- histoplasma capsulatum
- probe
- primer
- primer probe
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Paints Or Removers (AREA)
Abstract
The invention relates to a PCR primer probe composition and a kit for identifying histoplasma capsulatum. The invention relates to a primer probe composition F1/R1, P1 designed aiming at mitochondria of histoplasma capsulatum; through optimization of a reaction system, the kit disclosed by the invention not only can be used for rapidly detecting the histoplasma capsulatum, but also can be used for detecting the histoplasma capsulatum at a minimum detection limit of 20copies/mL, and meanwhile, the primer probe designed by the invention does not cross react with other related strains, and the specificity reaches 100%.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a PCR primer probe composition and a kit for identifying histoplasma capsulatum.
Background
Histoplasma capsulatum (Histoplasma capsulatum, darling 1906) is an environmentally pathogenic fungus and infection of humans is mainly caused by inhalation. The histoplasma capsulatum exhibits typical biphasicity, and humans inhale hyphae or fragments of the histoplasma capsulatum through the respiratory tract, and then reach alveoli to transform into yeast cell morphology, causing histoplasmosis capsulatum. The histoplasmosis capsular is very contagious and is often transmitted through the respiratory tract, which first invades the lung and then affects other mononuclear macrophage systems such as the liver and spleen, and also can invade the kidneys, the central nervous system and other viscera. Clinically, it is manifested as cough without phlegm, chest pain, dyspnea, hoarseness, moderate infection, fever, cyanosis, hemoptysis, etc.
Most histoplasma capsulatum is recessive infection, asymptomatic, few have mild symptoms, but a large amount of inhaled spores can cause more serious symptoms, and have high mortality rate.
Conventional etiology diagnosis uses methods of culture and microscopic examination, the culture takes a long time, generally 4 weeks, and the microscopic examination has low detection rate and specificity, which can be observed only in the progressive stage of the disease.
The current PCR technology molecular diagnosis method is used for detecting the histoplasma capsulatum, and can effectively improve the sensitivity and specificity of infection detection. However, the long-term stability of the mixed storage of the primer probe and the enzyme in the reagent is still a problem, and the reagent has the defect of insufficient sensitivity. The conventional use of ITS2 region has improved sensitivity, but the specificity is reduced because the ITS region is not greatly different in different strains.
As a novel probe, the molecular beacon has the advantages of higher stability and stronger specificity than the Taqman probe. The locked nucleotide has the advantages of improving reaction stability, sensitivity and specificity. The manner in which molecular beacons and locked nucleotides bind provides, on the one hand, a broader probe selection region and, on the other hand, improved detection specificity and sensitivity.
In addition, the conventional kit is relatively complex in practical application because of the fact that the enzyme reaction solution and the primer probe mixed solution are required to be provided separately due to the fact that the enzyme stability and the reaction solution cannot be fully applied to enzymes and the like.
Disclosure of Invention
Aiming at the detection requirement, the invention provides a PCR primer probe composition for identifying histoplasma capsulatum, which adopts a mitochondrial specific region of the histoplasma capsulatum to carry out primer design, adopts a design method of combining molecular beacons with locked nucleotides as probes, reduces fluorescent background in reaction by the design of the molecular beacons, increases reaction specificity, and simultaneously can effectively improve reaction specificity and stability by doping the locked nucleotides.
A PCR primer probe composition for identifying histoplasma capsulatum comprising two primers and a probe, the sequences of the primers and probe being as follows:
F1：AAAGGTGAATGGATTATCGC，
R1：TTCTAGGCAACTAAGAGCACA，
P1：cgaccgCAGTAC(LNA)CGTCTG(LNA)CTCGTTcggtcg。
one end of the probe P1 is added with a fluorescent label, and the other end is added with a quenching group, and the structure is as follows:
5’-FAMcgaccgCAGTAC(LNA)CGTCTG(LNA)CTCGTTcggtcg-3’Tamra。
a detection kit comprises a PCR premix, wherein the premix contains a primer probe composition.
The primer F1/R1 concentration was 250nM and the probe P1 concentration was 500nM.
The pre-mixed solution also comprises a reaction buffer solution 2x, taq enzyme, dNTP and Mg 2+ The total amount of the ion and the premix was 10. Mu.L.
Taq enzyme (Takara 9152 AM) 1U, 200. Mu.M dNTP,2mM Mg in the premix 2+ Ions.
The invention adopts the design method that the specific areas of mitochondria, genome and ITS of histoplasma capsulatum are respectively adopted for primer design, and a molecular beacon is selected as a probe to combine with a locked nucleotide. The locked nucleotide is a substitute for normal nucleotide, can improve the effective combination of the primer and the template, and does not affect normal amplification. The specific incorporation position is determined by the synthesis company on the basis of the nucleotide sequence. The primer probe composition with the best sensitivity is preferably obtained through experiments, wherein the primer probe composition is designed aiming at mitochondria, and one group of F1/R1 and P1 (see SEQ ID No.4, 5 and 6); through optimization of a reaction system, the kit disclosed by the invention not only can be used for rapidly detecting the histoplasma capsulatum, but also can be used for detecting the histoplasma capsulatum at a minimum detection limit of 20copies/mL, and meanwhile, the primer probe designed by the invention does not cross react with other related strains, and the specificity reaches 100%.
The fluorescent quantitative PCR kit for detecting the histoplasma capsulatum adopts the design primer of the histoplasma capsulatum specific region, designs the probe by combining the locked nucleotide and the molecular beacon, comprehensively adjusts the salt ion concentration and dNTP concentration in amplification by using the primer and the probe, designs a PCR program, and pre-mixes all components required by the reaction into one tube, thereby being capable of rapidly detecting the histoplasma capsulatum. Has important significance for clinically detecting the histoplasma capsulatum infection.
Drawings
FIG. 1 shows the alignment of F1, F2, P1, P2, R1, R2 primers and probes in the sequence,
FIG. 2 shows the alignment of F3, P3, R3, primers, probes in the sequence,
FIG. 3 shows the alignment of F4, F5, P4, P5, R4, R5 primers and probes in the sequence,
FIG. 4 shows the alignment of the ITS sequences and primer probes of histoplasma capsulatum,
FIG. 5 shows blast results of the ITS region of histoplasma capsulatum,
FIG. 6 shows the amplification curves of different primer tests,
FIG. 7 shows amplification curves for different dNTP concentrations,
FIG. 8 shows the amplification curves of Mg ion tests with different concentrations,
FIG. 9 shows a gradient dilution amplification curve and a minimum detection limit amplification curve of histoplasma capsulatum,
FIG. 10 shows a 5LOD amplification curve of histoplasma capsulatum,
FIG. 11 shows other specific detection species or DNA amplification curves.
Detailed Description
The present invention will be described in further detail with reference to examples.
Biological materials in the following experiments are all commercially available.
1. Experimental materials and methods:
1.1 specificity verification samples are shown in Table 1.
TABLE 1 specificity verification of species and nucleic acids
| Specificity verification Using nucleic acids | Latin name | Remarks |
| Human DNA | Extraction of human genome | |
| Mouse DNA | Extraction of mouse genome | |
| Candida tropicalis | C.tropicalis | ATCC 750 |
| Pseudomonas aeruginosa | Pseudomonas aeruginosa | ATCC 00017 |
| Staphylococcus aureus | Staphylococcus aureus | ATCC 00018 |
| Streptococcus agalactiae | Streptococcus agalactiae | ATCC 53045 |
| Yersinia pneumospori | Pneumocystis jirovecii | Synthetic plasmid |
| Novel cryptococcus | Cryptococcus neoformans | ATCC77618 |
| Histoplasma capsulatum (Bt) | Histoplasma capsulatum | Synthetic plasmid |
1.2 primer design
Primers are typically designed using ITS regions, but due to their high homology in different fungi, detection specificity is reduced. To solve this problem, the present application looks up specific sequences of histoplasma capsulatum via the NCBI database. Since mitochondria are multicopy in fungi, the sensitivity of detection can be improved. The application takes the specific sequence of mitochondria as a detection target. Meanwhile, a section of genome specific sequence and a section of ITS sequence are selected as detection targets according to a conventional design method. According to blast alignment, three sets of specific primers (F1/R1, F2/R2, F3/R3) were designed for mitochondrial specific sequences, two sets of primers (F4/R4, F5/R5) were designed for genomic sequences, and one set of primers (F6/R6) was designed for ITS sequences using primer5 primer design software. The designed primers were then subjected to a dimer formation assay to ensure that no dimer was formed between the primers. Meanwhile, through sequence comparison and Tm comparison, corresponding probes (see Table 2) are designed, and mitochondria, genome specific sequence fragments and ITS zone fragments are respectively shown in SEQ ID No.1-3. The sequence alignment of the designed primer probe is shown in figures 1-4, and the result of the blastITS region is shown in figure 5.
Table 2: selected primer and Probe List
1.3 DNA template preparation
1.3.1 sample pretreatment:
fragments of histoplasma capsulatum were extracted using a plasmid containing the mitochondrial sequence of interest, the plasmid of the ITS segment sequence of interest, and the plasmid of the genomic sequence of interest using the root cell extraction kit (DP 304).
1.3.2 subjecting the three plasmid DNAs containing the target sequence obtained by extraction to 10-fold gradient dilution with a gradient of 2×10 6 copies/mL、2*10 5 copies/mL、2*10 4 copies/mL、2*10 3 copies/mL、2*10 2 copies/mL、2*10 1 Copies/mL, 6 gradients total.
1.3.3 primer screening results
Six sets of primer probes in Table 2 were used, respectively, using 2X10 4 The amplification efficiency of the different primers was measured using copies/mL as template, 1U/reaction of the enzyme was amplified using PCR reaction buffer with a PCR reaction system, primers (300 nM), probes (500 nM) Mg (2 mM), dNTPs (200. Mu.M), the amplification procedure was 95℃for 10 min,40 cycles (95℃for 20 seconds, 60℃for 20 seconds). The amplification curve is shown in FIG. 6.
The detection results (table 3) show that the ct value of the primer probe set 1 for the mitochondrial target is the smallest, and that the ct values of the primer probe sets 1, 2, 3 for the mitochondrial target are significantly better than the ct values of the primer probe sets 4,5 and the ITS primer probe set 6 for the chromosomal target. According to the exponential amplification theory, the sensitivity of the primer probe set 1 is approximately 10 times better than that of the primer sets 2 and 3, the sensitivity of the primer set 1 is approximately 20 times better than that of the primer set 6 and approximately 100 times better than that of the genome primer set, so that the first pair of primer probe sets is selected to optimize the fluorescent quantitative condition.
TABLE 3 amplified ct values for different primer probe sets
| |
|
|
Primer set 4 | Primer set 5 | Primer set 6 | |
| ct value | 21.42 | 24.23 | 24.77 | 28.78 | 29.53 | 26.84 |
1.4 Condition optimization of fluorescence quantification
1.4.1 primer probe concentration optimization:
the important reaction materials in the PCR reaction are optimized, and the primer concentration (between 200nM and 350 nM) and the probe concentration (between 400nM and 600 nM) are optimized, using the template concentration2*10 4 The copies/mL are shown in Table 4.
TABLE 4 different primer probe concentration ct values
The condition with the smallest ct value was selected as the optimal condition, the optimal primer concentration was 250nM, and the optimal probe concentration was 500nM.
1.4.2dNTP concentration optimization
Under the condition of optimal primer probe concentration, dNTP concentration is optimized (the test range is 100 mu M to 400 mu M), and the template concentration is 1 x10 3 The results of the tests are shown in FIG. 7.
The results demonstrate that the 200. Mu.M dNTP concentration has the smallest ct value, and that the present application selects 200. Mu.M dNTP concentration as the final dNTP concentration.
1.4.3 optimizing the Mg concentration based on the above test optimum conditions, the test template concentration was 2.10 4 The concentration of Mg ions was selected in the range (1 mM,2mM,3mM,4 mM) of copies/mL. The test results are shown in FIG. 8.
The results indicated that the ct value was lowest at 2mM Mg ion concentration. The final Mg concentration was determined at 2 mM.
1.4.4 amplification procedure optimization
In order to shorten the reaction time, the present application optimizes the pre-denaturation time, (selection range 2min to 10 min), denaturation time 95℃in the amplification procedure (selection range 10 sec to 1 min), cycles number 40 cycles. The test results show that shortening the reaction time in the pre-denaturation and amplification procedure has no effect on the CT value. The shortest reaction time was chosen as the program end-use time in this application. I.e., a pre-denaturation time of 2 minutes, was used for 10 seconds at 95℃in the cycling program.
1.4.5 selection of amplification enzymes
In the application, amplification reaction buffer solution, probes, primers, enzyme, dNTP and Mg ions are mixed into a tube, and taq enzymes purchased by different manufacturers are tested, wherein the taq enzymes of different manufacturers are not very different, but a system using the taq enzyme (Takara 9152 AM) in the process of mixing and preserving the primer probes and the enzymes in the reagent is the most stable. The final taq enzyme used was Takara 9152AM.
Through the above series of optimization experiments, the results that all the reaction substances including primers, probes and amplification reagents are mixed in one tube and long-term stability can be maintained are achieved. Therefore, at the user end, the user can detect the sample to be tested only by adding the sample to be tested into the detection reagent, and the complexity of clinical operation is greatly reduced.
1.5 optimal reaction conditions
Finally, a primer pair No.1 aiming at the mitochondrial fragment is selected, and the mitochondria are in a multicopy state in fungi, so that the detection sensitivity is greatly improved. The specific reaction conditions are as follows: amplification reaction buffer 2X,250nM amplification primer, 500nM probe, mg ion concentration 2mM, dNTP concentration 200uM, taq enzyme (Takara 9152 AM) 1U. The amplification procedure was 95℃2min,40 cycles (95℃10 sec, 60℃20 sec, 72℃10 sec), under which the highest fluorescence values, the smallest Ct values, were seen without amplification of the negative control. (amplification reaction settings see Table 5)
TABLE 5 amplification reaction setup
| Reagent(s) | Volume of |
| Reaction enzyme and primer probe mixture | 10μL |
| DNA template | 10μL |
1.6. Experimental results
1.6.1 PCR amplification consistency: the sample DNA subjected to gradient dilution was subjected to 3 independent PCR amplification experiments under the same conditions, and the results show that the amplification consistency is good, the sensitivity is high, and the amplification efficiency reaches 98% (Table 6)
TABLE 6 QPCR detection results of histoplasma capsulatum
1.6.2 sensitivity
DNA extracted from plasmid against histoplasma capsulatum at copy number of 2x10 6 copies/mL、2x10 5 copies/mL、2x10 4 copies/mL、2x10 3 copies/mL、2x10 2 copies/mL、2x10 1 The tests were carried out with a gradient of copies/mL and 2copies/mL, 3 replicates per sample, and the lower limit of detection of histoplasma capsulatum DNA was 20copies/mL (FIG. 9, table 7) Table 7 for different concentrations of histoplasma capsulatum DNA
1.6.3 specificity:
the specific verification strain of the histoplasma capsulatum selects common pathogenic bacteria which can be infected by the same clinical diseases according to clinical requirements, and meanwhile, the specific verification template of the histoplasma capsulatum is used for detecting human bodies and simultaneously comprises human DNA. Fluorescence quantitative detection was performed using 100copies/mL (5-fold LOD concentration) of histoplasma capsulatum DNA as a template, and the result showed that histoplasma capsulatum could be detected efficiently (FIG. 10); fluorescence quantitative detection was performed using 10000copies/mL of DNA of other species (see Table 1) as templates, and the detection result was negative (FIG. 11), indicating that the primer specificity was strong and did not cross-react with other templates.
1.6.4 detection time
The amplification procedure was 95℃2min,40 cycles (95℃10 sec, 60℃20 sec) and according to this amplification procedure the detection time was not longer than 40 min.
2 kit composition
Fluorescent quantitative PCR premix 1 pipe
Amplification reaction buffer 2x
And (3) probe: 500nM
Primer: 250nM
taq enzyme: 1U (U)
dNTP：200uM
Mg：2mM
The detection template DNA was added at the time of use in an amount of 10. Mu.L.
The invention uses a new mitochondrial sequence to detect the template, and carries out primer design aiming at the template, and simultaneously, the detection time can be completed within 40 minutes by researching the optimal reaction condition, the minimum detection limit reaches 20copies/mL, the detection sensitivity of the detection product is greatly improved, and the specificity reaches 100%. Provides powerful support for assisting clinical diagnosis detection.
Claims (6)
1. A PCR primer probe composition for identifying histoplasma capsulatum comprising two primers and a probe, the sequences of the primers and probe being as follows:
F1：AAAGGTGAATGGATTATCGC，
R1：TTCTAGGCAACTAAGAGCACA，
P1：cgaccgCAGTAC(LNA)CGTCTG(LNA)CTCGTTcggtcg。
2. the PCR primer probe composition according to claim 1, wherein the probe P1 has a fluorescent label added to one end and a quenching group added to the other end, and has a structure as follows:
5’-FAMcgaccgCAGTAC(LNA)CGTCTG(LNA)CTCGTTcggtcg-3’Tamra。
3. a detection kit comprising a PCR pre-mix containing the PCR primer probe composition of claim 1 or 2.
4. The test kit according to claim 3, wherein the primer F1/R1 concentration is 250nM and the probe P1 concentration is 500nM.
5. The detection kit according to claim 4, wherein the pre-mixed solution further comprises amplification reaction buffer solution 2X, taq enzyme, dNTP and Mg 2+ The total amount of the premix was 10. Mu.L.
6. The detection kit of claim 5, wherein the pre-mixed solution comprises taq enzyme IU, 200. Mu.M dNTP and 2mM Mg 2+ Ions.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211115164.XA CN116179739B (en) | 2022-09-14 | 2022-09-14 | PCR primer probe composition and kit for identifying histoplasma capsulatum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211115164.XA CN116179739B (en) | 2022-09-14 | 2022-09-14 | PCR primer probe composition and kit for identifying histoplasma capsulatum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116179739A true CN116179739A (en) | 2023-05-30 |
| CN116179739B CN116179739B (en) | 2023-09-29 |
Family
ID=86451157
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211115164.XA Active CN116179739B (en) | 2022-09-14 | 2022-09-14 | PCR primer probe composition and kit for identifying histoplasma capsulatum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116179739B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050065330A1 (en) * | 2002-04-24 | 2005-03-24 | The Cleveland Clinic Foundation | Identification of Histoplasma capsulatum using a PCR assay |
| CN110760606A (en) * | 2019-10-31 | 2020-02-07 | 中国人民解放军疾病预防控制中心 | Real-time fluorescence quantitative PCR detection kit for histoplasma capsulatum, special primer and TaqMan probe thereof |
| CN113151557A (en) * | 2021-04-27 | 2021-07-23 | 中国医学科学院北京协和医院 | LAMP primer group, kit and method for detecting histoplasma capsulatum |
| WO2022023564A1 (en) * | 2020-07-30 | 2022-02-03 | Assistance Publique - Hopitaux De Paris | Whole nucleic acids rt-qpcr method for detecting histoplasma capsulatum fungus pathogen(s), histoplasmosis diagnosis and treatment methods, means thereof |
| CN114574628A (en) * | 2022-05-05 | 2022-06-03 | 首都医科大学附属北京友谊医院 | Detection kit and application thereof |
-
2022
- 2022-09-14 CN CN202211115164.XA patent/CN116179739B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050065330A1 (en) * | 2002-04-24 | 2005-03-24 | The Cleveland Clinic Foundation | Identification of Histoplasma capsulatum using a PCR assay |
| CN110760606A (en) * | 2019-10-31 | 2020-02-07 | 中国人民解放军疾病预防控制中心 | Real-time fluorescence quantitative PCR detection kit for histoplasma capsulatum, special primer and TaqMan probe thereof |
| WO2022023564A1 (en) * | 2020-07-30 | 2022-02-03 | Assistance Publique - Hopitaux De Paris | Whole nucleic acids rt-qpcr method for detecting histoplasma capsulatum fungus pathogen(s), histoplasmosis diagnosis and treatment methods, means thereof |
| CN113151557A (en) * | 2021-04-27 | 2021-07-23 | 中国医学科学院北京协和医院 | LAMP primer group, kit and method for detecting histoplasma capsulatum |
| CN114574628A (en) * | 2022-05-05 | 2022-06-03 | 首都医科大学附属北京友谊医院 | Detection kit and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| VOOHIES, M.等: "GenBank: CP069123.1", Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/nuccore/CP069123.1> * |
| VOORHIES, M.等: "GenBank: CP069108.1", Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/nuccore/CP069108.1> * |
| 周婷婷;付玉荣;伊正君;: "真菌感染诊断方法的研究进展", 中国病原生物学杂志, vol. 10, no. 12, pages 1151 - 1152 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116179739B (en) | 2023-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112063747B (en) | Primer probe group and kit for rapidly and efficiently detecting candida otophylla based on fluorescence PCR technology and application of primer probe group and kit | |
| WO2021189546A1 (en) | Kit for detecting sars-cov-2 coronavirus, and specific primer and probe thereof | |
| CN114958837B (en) | Primer composition, kit and method for rapidly and accurately detecting candida auricula | |
| CN110760605A (en) | Real-time fluorescence RPA detection kit for aspergillus fumigatus and special primer and probe thereof | |
| CN110804671B (en) | Real-time fluorescence quantitative PCR detection kit for candida auricularis, special primer and TaqMan probe thereof | |
| CN108060263B (en) | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three cryptococci | |
| CN111534514A (en) | Novel coronavirus detection kit based on Crisper | |
| CN112322733A (en) | Nucleic acid composition and kit for detecting EGFR gene mutation and method for detecting EGFR gene mutation | |
| CN117106938A (en) | Reagent and kit for detecting colpitis pathogen and application thereof | |
| CN113308519B (en) | Primer and probe for detecting single base mutation site and detection method | |
| CN110760606A (en) | Real-time fluorescence quantitative PCR detection kit for histoplasma capsulatum, special primer and TaqMan probe thereof | |
| CN113046452B (en) | Composition for detecting Boeck hollandia farci and application thereof | |
| CN116179739B (en) | PCR primer probe composition and kit for identifying histoplasma capsulatum | |
| CN110804652B (en) | Additive, kit and reaction method for real-time quantitative PCR (polymerase chain reaction) for rapidly detecting DNA (deoxyribonucleic acid) | |
| CN107723375B (en) | RPA method for detecting rickettsia rickettsii, special primer and probe thereof and application | |
| CN106755502B (en) | Primer, probe combination and kit for detecting hyphomycete mildew pathogenic bacteria RT-PCR | |
| CN113186359B (en) | Multiplex PCR rapid diagnosis kit for detecting and parting pig astrovirus | |
| CN105296668B (en) | Primer, probe and kit for specifically detecting type 3 ungulate bocavirus parvovirus | |
| CN112501349A (en) | Primer probe composition and kit for synchronously detecting 8 children digestive tract infection fungi and parasite-related pathogens | |
| KR101835006B1 (en) | Method of enhancing efficiency and sensitivity in polymerase chain reaction and composition therefor | |
| CN106676163B (en) | Primer and method for detecting pichia pastoris cell DNA | |
| CN117512204B (en) | Primer and probe combination for multiplex detection of aspergillus, cryptococcus and yersinia, kit and application | |
| CN105603055B (en) | Multiplex polymerase chain reaction method and application thereof | |
| CN113444842B (en) | Specific primer group for fox retrovirus detection and application of PCR detection kit | |
| CN113025755B (en) | Reagent for detecting porcine circovirus type 2e and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |